Secondary Logo

Journal Logo

Short communication

Effect of Maotai liquor onP53gene in primary hepatocellular carcinoma induced by compound factors in rats

Zhao, Xueke; Cheng, Mingliang; Mu, Mao; Liu, Junling; He, Chang; Zhang, Quan

Author Information
doi: 10.3760/cma.j.issn.0366-6999.20131138
  • Free

In China, the morbidity of alcoholic liver diseases (ALD) is increasing, which is the second cause of liver diseases after viral hepatitis. An epidemiological survey of 99 subjects in Kweichow Maotai Distillery who have drunk a lot of Maotai liquor for a long time showed that fatty livers were predominate and the incidence of hepatic fibrosis and cirrhosis was relatively low.1 Now, we carried out an animal experiment to investigate the mutation of P53 gene in liver tissues of primary hepatocellular carcinoma (HCC) induced by compound factors.

METHODS

Experimental protocols for alcoholic liver injury models

Male Sprague-Dawley (SD) rats ((220±20) g, 4-6 weeks old) were obtained from the Animal Center of the Third Military Medical University, Chongqing, China. Maotai liquor (ML, (530±2) g/L) and ordinary Maotai-flavor liquor (OMFL, (530±2) g/L) were purchased from Grain and Oil Import and Export Company in Guizhou. Ten rats were randomly selected from 130 rats after one-week adaptability feed as normal control group (A), the others were equally divided into 4 groups (30 rats per group): ML low-dose group (B, 5 ml/kg), ML high-dose group (C, 10 ml/kg), OMFL low-dose group (D, 5 ml/kg), and OMFL high-dose group (E, 10 ml/kg). Animals received intragastric administration, once daily in the morning, 5 days per week for 24 weeks. Standard rat feed and water were provided ad libitum. At the end of 24 weeks, liver cancers were produced according to literatures.2 Briefly, Aflatoxin B1 (AFB1) (Sigma, USA) was injected through peritoneal cavity at 400 μg·kg-1·d-1, 6 days per week for 2 weeks. Rats were then given the feed contains 0.015% 2-acetyl aminofluorene (AAF) (Fermentek, Israel) for 2 weeks. Two rats were randomly selected for sacrifice at 8, 16, and 24 weeks. Livers were collected and stored in the refrigerator at -80°C. A portion of the liver was fixed in 4% formaldehyde solution, embedded in paraffin. A 5-μm section was cut and stained with H&E for pathological examination.

Hepatic tissue DNA was extracted according to instruction of DNA kit

Primer design was composed by Beijing Dingguo Biotechnology Co., Ltd (China) according to P53 gene mRNA (serial number: NM-03098910) order. Forward and downward primers of exons 5-8: exon 5: 5′GACCTTTGATTCTTTCTCCTCTCC3′, 5′GGGAGACCCTGGACAACCAG3′; exon 6: 5′GCCTCTGACTTATTCTTGCTCTTAG3′, 5′CCCAAC CTGGCACACAGCTTCCTAC3′; exon 7: 5′CTGTGCCTCCTCTTGTCCCG3′, 5′CCACCTTCT TTGTCCTGCCTG3′; exon 8: 5′AGGTGAGCAG GCAGGACAAA3′, 5′AATCCAATAATAACCTTGGTAC CTT3′. PCR reaction system was processed according to kit instructions.

P53gene sequencing

The P53 gene sequencing was performed by direct sequencing performed by Beijing Dingguo Biotechnology Co., Ltd.

Statistical analysis

All data were analyzed using SPSS statistical software (version 16.0, SPSS Inc., USA). Differences among the groups were analyzed by chi-square tests or Fisher's exact test. Differences were deemed statistically significant at P <0.05.

RESULTS

During modeling, 14 rats died in ML group, 18 rats died in OMFL group, no death in normal group. At the end of the 8th week of intragastric administration, 2 rats randomly selected in group E had spotted and focal hepatocyte necrosis as well as liver fibroplasias in portal area. Meanwhile, the other four groups had no fibroplasias. At the end of the 16th week, 1 rat in group D and 2 rats in group E had liver fibroplasias. All rats in groups B and C had steatosis, spotted and focal necrosis. At the end of the 24th week, 1 rat in group B, 2 rats in group C, group D, and group E respectively had hepatic fibroplasias. In this liver cancer model produced by AFB1, 1 rat in group B, 6 rats in group C, 7 rats in group D and 6 rats in group E had cirrhosis. One rat in group C, 5 rats in group E had cirrhosis and HCC. No cirrhosis or HCC was detected in group A. The incidence of HCC in ML group was lower than that in OMFL group (P <0.05) (Table 1).

Table 1
Table 1:
Incidence of cirrhosis/HCC after HCC short-term modeling in each group

By PCR amplification, we amplified P53 gene of 69 rat livers. Exons 5-8 of P53 gene in 54 samples were successfully amplified. It was found by direct sequencing that the mutations were mainly through base insertion, followed by base mutation and deletion. Among 54 samples there were 29 ones of mutation, the percentage of which was 54%. Meanwhile, there was no mutation in normal group (0/5). About 42% of mutation occurs in ML group (11/26) and 78% in OMFL group (18/23). It showed that the mutation rate in ML group was lower than that in OMFL group significantly (P <0.05). The total mutation rate of exon 5 was 17% (9/54): 8% (2/26) in ML group and 30% (7/23) in OMFL liquor group. The total mutation rate of exon 6 was 6% (3/54): 4% (1/26) in ML group and 9% (2/23) in OMFL group. The total mutation rate of exon 7 was 32% (17/54): 19% (5/26) in ML group and 52% (12/23) in OMFL group. The total mutation rate of exon 8 was 33% (18/54): 23% (6/26) in ML group and 52% (12/23) in OMFL group (Figure 1).

Figure 1.
Figure 1.:
Comparison of mutation rate of P53 gene in each group. A, C, E, G: normal control group. B: Exon 5 base deletion of P53 gene. D: Exon 6 insertion mutation of P53 gene. F: Exon 7 G-T mutation of P53 gene. H: Exon 8 insertion mutation of P53 gene. I: Compared with OMFL group, the mutation rate of P53 gene in ML group was lower relatively. Exon 5: χ2=4.210, * P <0.05; Exon 6: χ2=0.499, P >0.05; Exon 7: χ2=5.846, * P <0.05; Exon 8: χ2=4.446, * P <0.05.

DISCUSSION

The pathogenesis of HCC is very complicated. It is generally believed that HCC is a result of multi-factor. The majority of literatures showed that drinking alcohol excessively was related to HCC. Researches have found that hepatocarcinogenesis was closely related to the mutation of P53 gene.3 After gene mutation, the original spatial conformation of P53 changes and the DNA restoration and regulation of cell apoptosis are lost, which will stimulate a series of changes in normal cells such as atypical hyperplasia and result in cancer.

In the present study, the mutation rates of P53 gene in experimental HCC induced by AFB1 were different, which varied from 10% to 60%.4 In our study, the HCC model induced by compound factors including drinking alcohol and receiving AFB1 and AAF was successfully established. It was found that the overall mutation rate of P53 was 54% with the basis of base insertion and point mutation as well as less base deletion or fragment deletion. There were 9 out of 54 in exon 5 mutation, 3 out of 54 in exon 6 mutation and 17 out of 54 in exon 7 which was relatively higher. Moreover, few literatures had reported exon 8 mutation. The results showed that the mutation percentage of exon 8 was also high, revealing a certain correlation between exon 8 mutation and the incidence of HCC. However, the mechanism is worth of further investigations.

Alcohol consumption has long been recognized as a risk factor for cirrhosis or HCC. Fortunately, the damage to the liver induced by alcohol is attracting increasing attentions. Therefore, it is of a certain significance to study the correlation between Maotai liquor and liver diseases. Research found that Maotai liquor can induce expressions of metallothionein (MT) gene, heme oxygenase-1 gene, and MT protein in liver, thus it may inhibit liver fibrosis by suppression of the activation of the stellate cells and collagen formation. The processed and removed ethanol phosphate-contained residue may reduce alcohol-induced oxidative stress reaction, and increase the liver of lipid antioxidant components.5

We found that the mutation rate of P53 induced by Maotai liquor was lower relatively, so it may be speculated that Maotai liquor may to some extent slow down the hepatocarcinogenesis. We predicted that Maotai liquor drinkers bear a lower risk of HCC compared with the others, which may be due, at least in part, to the low mutation rate of P53, and the intervention of liver fibrosis and cirrhosis. Therefore, Maotai liquor is different from alcohol in producing liver fibrosis, cirrhosis and HCC. However, 1 rat with HCC in Maotai liquor high-dose group was observed. It sheds light on a fact that the more drinking liquor, the higher risk of HCC.

REFERENCES

1. Wu J, Cheng ML, Zhang GH, Zhai RW, Huang NH, Li CX, et al. Epidemiological and histopathological study of relevance of Guizhou Maotai liquor and liver diseases. World J Gastroenterol 2002; 8: 571-574.
2. Solt D, Farber E. Newpriciple for the analysis of chemical carcinogenesis. Nature 1976; 263: 701.
3. Llanos S, Royer C, Lu M, Bergamaschi D, Lee WH, Lu X. Inhibitory member of the apoptosis-stimulating proteins of the p53 Family (iASPP) interacts with protein phosphatase 1 via a noncanonical binding motif. J Biol Chem 2011; 286: 43039-43044.
4. Turner PC, Sylla A, Kuang SY, Marchant CL, Diallo MS, Hall AJ, et al. Absence of TP53 codon 249 mutations in young Guinean children with high aflatoxin exposure. Cancer Epidemiol Biomarkers Prev 2005; 14: 2053-2055.
5. Zhang D, Lu H, Li J, Shi X, Huang C. Essential roles of ERKs and p38K in up-regulation of GST A1 expression by Maotai content in human hepatoma cell line Hep3B. Mol Cell Biochem 2006; 293: 161-171.
Keywords:

primary hepatocellular carcinoma; Maotai liquor; P53

© 2014 Chinese Medical Association