Secondary Logo

Journal Logo

Original article

GATA3 siRNA inhibits the binding of NFAT1 to interleukin-13 promoter in human T cells

YAO, Xin; YANG, Yan; HE, Hai-yan; WANG, Min; YIN, Kai-sheng; HUANG, Mao

Editor(s): WANG, Mou-yue; LIU, Huan

Author Information
doi: 10.3760/cma.j.issn.0366-6999.2010.06.019
  • Free

Abstract

Allergic bronchial asthma, a chronic disease with increasing prevalence and incidence worldwide, is characterized by airway inflammation, reversible bronchoconstriction, and airway hyperresponsiveness (AHR).1 The mechanism underlying the chronic inflammation is related to a Th1/Th2 cell imbalance resulting in over-expression of Th2 cytokines such as interleukin (IL)-4, IL-5, and IL-13.2,3

Among the Th2 cytokines above, IL-13 is considered to be the key modulator. Mice with targeted deletion of IL-13 failed to develop AHR.4 However, AHR could be restored by the administration of recombinant IL-13.4 Selective neutralization of endogenously released IL-13 with a soluble form of IL-13R alpha 2 human Fc fusion protein ameliorated the asthma phenotype, including AHR, eosinophil recruitment, and mucus overproduction, while administration of IL-13 produced an asthma-like phenotype in nonimmunized T cell-deficient mice.5 In addition, mice with pulmonary overexpression of IL-13 demonstrated the important pathologic features of asthma, such as mononuclear and eosinophilic inflammatory response, mucus cell metaplasia, the deposition of Charcot-Leyden-like crystals, airway fibrosis, and so on.6

GATA3 plays a critical role in the differentiation of Th2 cells from uncommitted CD4+ lymphocytes and determines the expression of the Th2 cytokines in Th2 cells.7In vivo, conditional GATA3 knockout mice failed to develop Th2 responses, as assessed by IL-4, IL-5, and IL-13 production. 8,9 Enforced expression of GATA-3 in transgenic mice inhibited Th1 differentiation and induced the formation of IL-1 receptor family member T1/ST2-expressing Th2-committed T cell compartment.10 Normally, GATA3 is localized to the cytoplasm of human T cells. However, due to T cell receptor (CD3) and co-stimulatory receptor CD28 co-stimulation, it was phosphorylated by p38 MAP kinase and translocated to the nucleus via the nuclear import protein importin-alpha, which was followed by the GATA3 binding to the promoters of Th2 cytokines and subsequent Th2 cytokines expression.11,12

Recently, other transcription factor families, such as nuclear factor of activated T cells (NFAT), have been shown to contribute to the regulation of Th2 cytokine expression.13 The NFAT family includes NFAT1 (NFATc2, NFATp), NFAT2 (NFATc1, NFATc), NFAT3 (NFATc4), NFAT4 (NFATc3, NFATx), and NFAT5. NFAT proteins are expressed in a variety of cell types, including T cells, B cells, mast cells, natural killer cells, and eosinophils.14 Our preliminary studies15,16 revealed that due to CD3 plus CD28 co-stimulation, NFAT1 underwent dephosphorylation and translocation into the nucleus, followed by the formation of NFAT1-GATA3 complex and NFAT1 binding to the promoter of IL-13. Herein, we constructed the small interference RNA of GATA3 (GATA3 siRNA) to inhibit the expression of GATA3 in Hut-78 cells to further delineate the role of the GATA3-NFAT1 complex in IL-13 transcription during human T cells activation.

METHODS

Antibodies and reagents

The following antibodies and reagents were used: mouse monoclonal anti-human CD3 and CD28 antibody: (R&D, USA. MAB 100, MAB342); anti-human GATA3 monoclonal antibody (Santa Cruz Biotechnology, USA. sc-269x); anti-human NFAT1 monoclonal antibody (Abcam, USA. ab2722); anti-human β-actin monoclonal antibody (BOSTER, China. BM0627); HRP-goat Immunoglobulins (DAKO, Denmark. P0449); FuGENE® HD Transfection Reagent (Roche, USA. 04709705001); ChIP ASSAY Kit (Millipore, USA. #17-295).

Cell culture and transfection

Hut-78 cells were cultured in 10% fetal calf serum (FCS) and 0.5% L-glutamine (LG) contained RPMI. Cells were transfected with small interfering RNA (siRNA) using FuGENE® HD Transfection, as described by the manufacturer. The cells were starved with 0.5% FCS contained revolutions-per minute indicator (RPMI) for 24 hours before experiment.

Detection of transfection efficiency and knockdown of GATA3 expression

The target sequences of siRNA for GATA3 were as follows: AAUCCAGACCAGAAACCGAAA (synthesized by Gene Pharma, China). Hut-78 cells were transfected with FAM-negative siRNA (0, 25, 50, 75, 100 nmol/L, respectively). Transfection efficiencies of different concentrations were evaluated with flow cytometry after 6 hours of incubation.

Cell stimulation

Anti-CD3 antibody was immobilized over night at the concentration of 10 μg/ml. Hut-78 cells were transfected with GATA3 siRNA or negative control siRNA for 48 hours before co-stimulation with anti-CD3 and anti-CD28 antibodies (5 μg/ml).

Western blotting analysis

The 2×106 cells were lysed in 30 μl NP-40 lysis buffer (0.5% Nonidet P-40, 20 mmol/L Tris-HCl, pH 7.5, 150 mmol/L NaCl) in the presence of complete protease cocktail inhibitor. Lysates were centrifuged at 4°C for 10 minutes at 12 000 r/min in eppendoff microfuge to remove cellular debris. Protein concentration in the lysates was determined by Bradford assay (BioRad gmbH, 500-0006). Each sample contained 100 μg of protein and was boiled and subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) on 10% Tris-glycine gels; it was then transferred electrophoretically to nitrocellulose membrane, which was incubated (overnight, 4°C) with GATA3 and β-actin monoclonal antibody at dilutions of 1:500. The membrane was washed twice with Tris Buffered Saline with Tween 20 (TBST) containing 0.05% Tween-20 and then incubated with horseradish peroxidase-linked secondary antibody (goat anti-mouse IgG, 1:3000). The membrane was washed twice with TBST. Immunoreactivity was determined using an enhanced chemiluminescence (ECL) kit (Amersham biosci, USA. RPN303D) according to the manufacturer's instructions and exposed on medical film. The band density was quantified with Bio-Rad Quantity One 1-D Analysis Software (Bio-Rad, USA).

Real-time PCR of GATA3 mRNA and IL-13 mRNA

Total RNA was isolated using TRIzol reagent (Invitrogen Life Technologies, USA. 15596-026). Reverse transcription was performed using ReverTra Ace-α-TM (TOYOBO, FSK-100). The primer sequences for GATA3 were (Forward) GAAGGCATCCAGACCCGAAAC; (Reverse) ACCCATGGCGGTGACCATGC. The product size was 255 bp. Primer sequences for IL-13 were (Forward) TGAGGAGCTGGTCAACATCA; (Reverse) CAGGTTGATGCTCCATACCAT. The product size was 76 bp. The PCR product was confirmed by agarose electrophoresis and melting curve of real-time PCR.

Gylceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as input control. The primer sequences of GAPDH were (Forward) TTCCAGGAGCGAGATCCCT; (Reverse) CACCCATGACGAACATGGG. The product size was 175 bp.

Chromatin immunoprecipitation (CHIP)

CHIP assay was performed as described in the protocol of UPSTATE (CHIP ASSAY Kit, Millipore, #17-295). Briefly, each sample containing 1×106 cells was sheared into cross-linked DNA to 200-1000 base pairs in length. Then the protein A/antibody/DNA complex was immunoprecipitated with 1 μg/ml anti-NFAT1 antibody for over night incubation. After reverse crosslinks at 65°C for 4 hours, DNA was recovered by phenol/chloroform extraction. Real-time PCR was employed to amplify the recovered DNA. The primers for IL-13 promoter (-393 to -65) were (Forward) GGAGCTCAGAGTTGGGTCAG; (Reverse) GCGTCTT-GTGGCAGCTTTT, and the size of PCR product was 328 bp. The products were confirmed by agarose electrophoresis and the melting curve of real-time PCR.

Statistical analysis

Prism 5.0 software was used for statistical analysis and figure drawing. Data are represented as the mean ± standard deviation (SD). Statistically significant differences were determined using one-way analysis of variance (ANOVA) among groups. The null hypothesis was rejected at P <0.05.

RESULTS

Effect of different concentrations of carboxyfluoresceine (FAM)-negative GATA3 siRNA on transfection efficiencies in Hut-78 cells (Figure 1)

Figure 1.
Figure 1.:
Transfection efficiency of GATA3 siRNA. A: Flow cytometry of Hut-78 cells at different concentrations of GATA3 siRNA transfection. a: 0 nmol/L (control). b: 25 nmol/L. c: 50 nmol/L. d: 75 nmol/L. e: 100 nmol/L. B: Transfection efficiency of GATA3 siRNA. *P <0.05, compared with control group.

Hut-78 cells were incubated with different concentrations of GATA3 siRNA (0 (control group), 25, 50, 75 and 100 nmol/L respectively) for 6 hours using FuGENE® HD Transfection. The transfection efficiency in 75 nmol/L group and 100 nmol/L group were remarkably higher than those in the control and other groups. However, there was no significant difference in transfection efficiency between 75 nmol/L group and 100 nmol/L group.

The transfection efficiency of GATA3 siRNA was remarkably higher in 75 nmol/L group and 100 nmol/L group. However, there was no significant difference in transfection efficiency between 75 nmol/L group and 100 nmol/L group (P >0.05).

Effect of GATA3 siRNA on the expression of GATA3 in Hut-78 cells

Hut-78 cells were incubated with GATA3 siRNA at the concentration of 75 nmol/L for 48 hours. The GATA3 protein from whole cell lysates was measured with Western blotting (Figure 2). Real-time PCR was employed to measure the mRNA level of GATA3 (Figure 3). Transfection of GATA3 siRNA resulted in significant suppression of both GATA3 protein and mRNA expression within 48 hours in Hut-78 cells, whereas negative control siRNAs had no effect on its expression.

Figure 2.
Figure 2.:
GATA3 protein in whole cell lysates of Hut-78 cells after 48-hour incubation with GATA3 siRNA (75 nmol/L). A: Western blotting of GATA3 protein. B: Western blotting band density analysis of GATA3. *P <0.05 compared with control group. Control: Hut-78 cells only. GATA-3 siRNA: Hut-78 cells incubated with GATA3 siRNA. Negative control siRNA: Hut-78 cells incubated with negative control of siRNA. GATA3 siRNA significantly inhibibited the GATA3 protein expression in Hut-78 cells within 48 hours.
Figure 3.
Figure 3.:
GATA3 mRNA level in Hut-78 cells after 48 hours incub ation with GATA3 siRNA (75 nmol/L). *P <0.05 compared with control group. Contrl: Hut-78 cells only. GATA-3 siRNA: Hut-78 cells incubated with GATA3 siRNA. Negative control siRNA: Hut-78 cells incubated with negative control of siRNA. GATA3 siRNA significantly reduced the GATA3 mRNA level in Hut-78 cells in 48 hours.

Effect of GATA3 siRNA on NFAT1 binding to the promoter of IL-13 in Hut-78 cells

Hut-78 cells were treated with anti-CD3/anti-CD28 antibodies co-stimulation with or without GATA3 siRNA pretreatment in 0, 30 minutes, 1 hour and 2 hours (Figure 4). CHIP was used to investigate the binding of NFAT1 to IL-13 promoter. NFAT1 was recruited to the IL-13 promoter after the stimulation with anti-CD3/anti-CD28 antibodies for 30 minutes, 1 hour and 2 hours. This recruitment was significantly decreased by pre-treatment of cells with GATA3 siRNA.

Figure 4.
Figure 4.:
The binding of NFAT1 to IL-13 promoter due to anti-CD3/anti-CD28 antibodies stimulation. *P <0.05, compared with anti-CD3/antiCD28 antibodies group (30 minutes).

The 1×106 Hut-78 cells was used with chromatin immunoprecipitation to investigate the binding of NFAT1 to IL-13 promoter. NFAT1 was recruited to the IL-13 promoter within 30 minutes after the stimulation with anti-CD3/ anti-CD28 antibodies, however, this recruitment was inhibited by pre-treatment of cells with GATA3 siRNA.

Effect of GATA3 siRNA on IL-13 mRNA expression in Hut-78 cells due to anti-CD3/anti-CD28 antibodies co-stimulation for 19 hours

Hut-78 cells were treated with anti-CD3/anti-CD28 antibodies co-stimulation for 6 hours and 19 hours with or without GATA3 siRNA pre-treatment (Figure 5). Stimulation of Hut-78 cells with anti-CD3/anti-CD28 antibodies caused an increase in IL-13 gene transcription in Hut-78 cells, which could be suppressed by GATA3 siRNA.

Figure 5.
Figure 5.:
IL-13 mRNA level in Hut-78 cells. *P=0.011, compared with anti-CD3/anti-CD28 antibodies stimulation group (19 hours).

Stimulation of Hut-78 cells with anti-CD3/anti-CD28 antibodies caused an increase in IL-13 synthesis at mRNA level at 6-hour and 19-hour, which could be inhibited significantly with the pre-treatment of GATA3 siRNA in 19 hours.

DISCUSSION

In our study, GATA3 siRNA significantly inhibited the expression of GATA3 in Hut-78 cells both in mRNA and protein levels. GATA3 siRNA also inhibited the transcription of IL-13 due to anti-CD3/anti-CD28 antibodies co-stimulation. Furthermore, GATA3 siRNA reduced the DNA binding of NFAT1 to IL-13 promoter, which implicated that GATA3 and NFAT1 were functionally correlated in IL-13 transcription.

IL-13 is predominantly produced by Th2 cells, although it is also released by mast cells, and basophils.17 In Monticelli's study, they found the asscociation of NFAT1 and GATA3 in human mast cells.18 Recently, we further confirmed the formation of GATA3-NFAT1 complex in human T cells during the activation with anti-CD3 and anti-CD28 antibodies.15,16 NFAT inhibitor FK506 significantly suppressed the association of GATA3 and NFAT1, therefore the binding of GATA3 to the promoter of IL-13.15 In this study, with GATA3 siRNA, we further explored the role of GATA3-NFAT1 association in IL-13 transcription in human T cells.

Finotto et al19 demonstrated that the blockage of GATA3 gene expression by an antisense phosphorothioate oligonucleotide molecules, could serve as a therapeutic method in allergic diseases. Compared with antisense oligonucleotides, RNA interference is a powerful new tool with which to perform loss-of-function genetic screens and can greatly facilitate the identification of components of cellular signalling pathways.20,21 Recently, the study22 have shown that siRNA is quantitatively more efficient and its effect lasts for longer time than antisense oligonucleotides do. Therefore, GATA3 siRNA was constructed to inhibit the expression of GATA3. We found that GATA3 siRNA successfully suppressed GATA3 expression both in mRNA and protein levels. In addition, we found that GATA3 siRNA also reduced the NFAT1 binding to IL-13 promoter and inhibited IL-13 transcription due to CD3/CD28 co-stimulation in Hut-78 cells. Taken together with our previous study, in which FK506, an NFAT inhibitor, suppressed the complex of GATA3-NFAT1 association and the binding of GATA3 to IL-13 promoter in the same cell model, these results suggest that the GATA3-NFAT1 complex might be the key link of the two DNA binding transcription factors to the IL-13 promoter, which could control the transcription of IL-13 in human T cells.

The absence of NFAT1 led to an increased pleural eosinophilic allergic response accompanied by an increased production of the Th2 cytokines.23,24 Fonseca et al25 analyzed NFAT1-/- mice to address the role of NFAT1 in a model of allergic airway inflammation. They found NFAT1-/- mice subjected to airway inflammation displayed a significant exacerbation of several features of the allergic disease, including lung inflammation, eosinophilia, increased serum IgE levels and elevation of IL-4 and IL-13.25 These studies above showed the negative role of NFAT1 in Th2 cytokines regulation. Thus, it could be possible that during T cell activation, GATA3 is the main transcription factor starting the expression of Th2 cytokines, NFAT1 might partly inhibit the function of GATA3 through its binding to IL-13 promoter and forming the GATA3-NFAT1 complex in order to make an accurate regulation of Th2 cytokines expression, which might be a mechanism of negative feedback of T cell activation.

In summary, we demonstrated that GATA3 siRNA significantly reduced GATA3 expression both in mRNA and protein levels, and further confirmed the interaction between GATA3 and NFAT1, which play a critical role in the regulation of IL-13 transcription in T cells. This interaction might also be important in other Th2 cytokines expression, such as IL-4 and IL-5.

REFERENCES

1. Busse WW, Lemanske RF Jr. Asthma. N Engl J Med 2001; 344: 350-362.
2. Ngoc PL, Gold DR, Tzianabos AO, Weiss ST, Celedón JC. Cytokines, allergy, and asthma. Curr Opin Allergy Clin Immunol 2005; 5: 161-166.
3. Nakajima H, Takatsu K. Role of cytokines in allergic airway inflammation. Int Arch Allergy Immunol 2007; 142: 265-273.
4. Walter DM, McIntire JJ, Berry G, McKenzie AN, Donaldson DD, DeKruyff RH, et al. Critical role for IL-13 in the development of allergen-induced airway hyperreactivity. J Immunol 2001; 167: 4668-4675.
5. Grünig G, Warnock M, Wakil AE, Venkayya R, Brombacher F, Rennick DM, et al. Requirement for IL-13 independently of IL-4 in experimental asthma. Science 1998; 282: 2261-2263.
6. Zhu Z, Homer RJ, Wang Z, Chen Q, Geba GP, Wang J, et al. Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, sub epithelial fibrosis, physiologic abnormalities, and eotaxin production. J Clin Invest 1999; 103: 779-788.
7. Barnes PJ. Role of GATA-3 in allergic diseases. Curr Mol Med 2008; 8: 330-334.
8. Pai SY, Truitt ML, Ho IC. GATA-3 deficiency abrogates the development and maintenance of T helper type 2 cells. Proc Natl Acad Sci U S A 2004; 101: 1993-1998.
9. Zhu J, Min B, Hu-Li J, Watson CJ, Grinberg A, Wang Q, et al. Conditional deletion of Gata3 shows its essential function in T(H)1-T(H)2 responses. Nat Immunol 2004; 5: 1157-1165.
10. Nawijn MC, Dingjan GM, Ferreira R, Lambrecht BN, Karis A, Grosveld F, et al. Enforced expression of GATA-3 in transgenic mice inhibits Th1 differentiation and induces the formation of a T1/ST2-expressing Th2-committed T cell compartment in vivo. J Immunol 2001; 167: 724-732.
11. Maneechotesuwan K, Yao X, Ito K, Jazrawi E, Usmani OS, Adcock IM, et al. Suppression of GATA-3 nuclear import and phosphorylation: a novel mechanism of corticosteroid action in allergic disease. PLoS Med 2009; 6: e1000076.
12. Maneechotesuwan K, Xin Y, Ito K, Jazrawi E, Lee KY, Usmani OS, et al. Regulation of Th2 cytokine genes by p38 MAPK-mediated phosphorylation of GATA-3. J Immunol 2007; 178: 2491-2498.
13. Torgerson TR, Colosia AD, Donahue JP, Lin YZ, Hawiger J. Regulation of NF-kappa B, AP-1, NFAT, and STAT1 nuclear import in T lymphocytes by noninvasive delivery of peptide carrying the nuclear localization sequence of NF-kappa B p50. J Immunol 1998; 161: 6084-6092.
14. Rao A, Luo C, Hogan PG. Transcription factors of the NFAT family: regulation and function. Annu Rev Immunol 1997; 15: 707-747.
15. Yao X, Jazrawi E, Barnes PJ, Adcock IM. NF-AT and GATA3 complex mediates anti-CD3/CD28-induced IL-13 expression: effect of glucocorticoid. ERS conference, Berline 2008, A2247 (abstract).
16. He HY, Yao X, Huang M, Dai SL, Sun PL, Yin KS. Arsenic trioxide inhibits the gene expression of IL-13 in activated T cells. Acta Univ Med Nanjing (Chin) 2008; 28: 296-299.
17. Wills-Karp M. Interleukin-13 in asthma pathogenesis. Immunol Rev 2004; 202: 175-190.
18. Monticelli S, Solymar DC, Rao A. Role of NFAT proteins in IL13 gene transcription in mast cells. J Biol Chem 2004; 279: 36210-36218.
19. Finotto S, De Sanctis GT, Lehr HA, Herz U, Buerke M, Schipp M, et al. Treatment of allergic airway inflammation and hyperresponsiveness by antisense-induced local blockade of GATA-3 expression. J Exp Med 2001; 193: 1247-1260.
20. Kamath RS, Fraser AG, Dong Y, Poulin G, Durbin R, Gotta M, et al. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 2003; 421: 231-237.
21. Ashrafi K, Chang FY, Watts JL, Fraser AG, Kamath RS, Ahringer J, et al. Genome-wide RNAi analysis of Caenorhabditis elegans fat regulatory genes. Nature 2003; 421: 268-272.
22. Bertrand JR, Pottier M, Vekris A, Opolon P, Maksimenko A, Malvy C. Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo. Biochem Biophys Res Commun 2002; 296: 1000-1004.
23. Xanthoudakis S, Viola JP, Shaw KT, Luo C, Wallace JD, Bozza PT, et al. An enhanced immune response in mice lacking the transcription factor NFAT1. Science 1996; 272: 892-895.
24. Viola JP, Kiani A, Bozza PT, Rao A. Regulation of allergic inflammation and eosinophil recruitment in mice lacking the transcription factor NFAT1: role of interleukin-4 (IL-4) and IL-5. Blood 1998; 91: 2223-2230.
25. Fonseca BP, Olsen PC, Coelho LP, Ferreira TP, Souza HS, Martins MA, et al. NFAT1 transcription factor regulates pulmonary allergic inflammation and airway responsiveness. Am J Respir Cell Mol Biol 2009; 40: 66-75.
Keywords:

interleukin-13; asthma; GATA3; NFAT1

© 2010 Chinese Medical Association