Secondary Logo

Journal Logo

Inhibition of interleukin-13 gene expression in T cells through GATA-3 pathway by arsenic trioxide

YAO, Xin; HE, Hai-yan; YANG, Yan; DAI, Shan-lin; SUN, Pei-li; YIN, Kai-sheng; HUANG, Mao

Section Editor(s): QIAN, Shou-chu; WANG, Mou-yue

Brief report
Free
SDC

Edited by

Department of Respiratory Diseases, the First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu 210029, China (Yao X, He HY, Yang Y, Dai SL, Sun PL, Yin KS and Huang M)

Correspondence to: Prof. HUANG Mao, Department of Respiratory Diseases, the First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu 210029, China (Tel: 86-13813886116. Fax: 86-25-83724440. Email: hm6114@126.com).

This work was supported by the National Natural Science Foundation of China (No. 30700342) and the Natural Science Foundation of Jiangsu, China (No. BK2005437)

(Received May 13, 2008)

Arsenic trioxide (AT) has a long history of use in both traditional Chinese medicine and in modern medicine in asthma therapy. Recently, Yin et al1 found that AT even at small doses reduced the airway inflammation of sensitized guinea pigs. However the mechanism underlying this is still largely unknown. Interleukin 13 (IL-13), as one of the important TH2 cytokines, plays an important role in asthma pathogenesis through promoting eosinophilic inflammation, mucus secretion and airway hyperresponsiveness.2 To further explore the molecular anti-inflammatory basis of AT, we employed Hut-78 cells, a human T cell line, with activation via CD3/CD28 receptors to mimick in vivo co-stimulation to investigate the effect of AT on IL-13 transcription.

Back to Top | Article Outline

METHODS

Antibodies and reagents

The following antibodies and reagents were used: mouse monoclonal anti-human CD3 and CD28 antibody (BD Pharmingen, USA. 555329, 555725); goat polyclonal anti-human GATA-3 antibody (Abcam, USA. ab3822); mouse anti-human importin-α2 monoclonal antibody (BD Pharmingen, 610485); normal goat IgG and protein A/G plus-agrose (Santa Cruz Biotechnology, USA. sc-2028, sc-2003); horseradish peroxidase (HRP)-mouse immunoglobulins (DAKO, Denmark. P0448) and HRP-goat immunoglobulins (DAKO, P0449); and CHIP ASSAY Kit (UPSTATE, USA. #17-295).

Back to Top | Article Outline

Cell culture and stimulation

Hut-78 cells were cultured in 10% fetal calf serum (FCS) contained revolutions-per-minute indicator (RPMI). The cells were starved with 0.5% FCS contained RPMI for 24 hours before AT treatment. Anti-CD3 was immobilized over night at the concentration of 10 μg/ml. Hut-78 cells were pre-treated with or without AT for 30 minutes before stimulation with CD28 (5 μg/ml) antibodies.

Back to Top | Article Outline

Luminex assay

Luminex assay was performed to determine the concentration of IL-13, according to the protocol from Upstate Company (UPSTATE, Cat 48-011).

Back to Top | Article Outline

Real time PCR of IL-13 mRNA

Total RNA was extracted as described by the protocol of Rneasy Mini kit (Qiagen, Germany. Cat: 74106). In general, genomic DNA was digested with rnase-free-dnase (Promega, USA. Cat: M6101). Then 1 μg total RNA was reverse transcribed using the avian myeloblastosis virus (AMV) reverse transcriptase (Promega. Cat: M5101). Primer for IL-13 was purchased from Sigma-Genosys. The sequences were: (Forward) TGAGGAGCTGGTCAACATCA, (Reverse) CAGGT-TGATGCTCCATACCAT. The product size was 76 bp. The PCR product was confirmed by agrose electrophoresis and melting curve of real time PCR. Gylceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as input control. The primer sequences of GAPDH were: (Forward) TTCCAGGAGCGAGATCCCT, (Reverse) CACCCATGACGAACATGGG.

Back to Top | Article Outline

Immunoprecipitation (IP)

Nuclear and cytoplasmic fractions were prepared as described.3 Whole cell lysates were prepared in NP-40 lysis buffer (0.5% Nonidet P-40, 20 mmol/L Tris-HCl, pH 7.5, 150 mmol/L NaCl) in the presence of complete protease cocktail inhibitor. Lysates were centrifuged at 4°C for 10 minutes at 12 000 r/min in Eppendoff microfuge to remove cellular debris. Protein concentration in the lysates was determined by Bradford assay (BioRad, USA. gmbH Cat: 500-0006). Each sample containing 1000 μg of protein was subject to immunoprecipitation with anti-importin-α2 antibody in the presence of protease inhibitor. Western blotting analysis was performed using anti-GATA-3 antibody.3 Immuno-reactive proteins were detected using an enhanced chemiluminescence ECL kit (Amersham Biosci, USA, Cat: RPN303D).

Back to Top | Article Outline

Chromatin immunoprecipitation (CHIP)

CHIP assay was performed as described in the protocol of UPSTATE (CHIP ASSAY Kit, UPSTATE, Cat: #17-295). Briefly, each sample containing 106 cells was sheared into cross-linked DNA to 200-1000 base pairs in length. Then the protein A/antibody/DNA complex was immunoprecipitated with 1 mg/ml anti-GATA-3 antibody for over night incubation. After reverse crosslinks at 65°C for 4 hours, DNA was recovered by phenol/chloroform extraction. Real time PCR was employed to amplify the recovered DNA. The primers for IL-13 promoter (-203 to -24) were: (Forward) TTCCTTTATGCGACACTGG, (Reverse) ATTGAGGAGCGGATGCATAG. And the size of PCR product was 179 bp. The products were confirmed by agarose electrophoresis and the melting curve of real time PCR.

Back to Top | Article Outline

Statistical analysis

The Kolmogorov-Smirnov test of normality was used to test whether the distribution of variables followed a Gaussian distribution. Non-skewed continuous variables were reported as mean ± standard deviation (SD) and compared using Student’s t test. Differences among 3 or more groups were tested by analysis of variance (ANOVA) with the LSD method for continuous variables. These variable values compared were indicated using a bar chart. A P value < 0.05 was considered statistically significant.

Back to Top | Article Outline

RESULTS

Effect of AT on IL-13 release from Hut-78 cells by CD3/CD28 co-stimulation for 19 hours (Figure 1)

Figure 1.

Figure 1.

1×106 Hut-78 cells were treated with CD3/CD28 monoclonal antibody with or without AT stimulation for 19 hours. Hut 78 cells released more IL-13 into the cell culture medium from 1.9 pg/ml to nearly 150 pg/ml after CD3/CD28 co-stimulation; however the enhancement of IL-13 release was significantly decreased by 7-fold when pretreated cells with AT at 5 μmol/L.

Back to Top | Article Outline

Effect of AT on IL-13 gene expression in Hut-78 cells by CD3/CD28 co-stimulation for 19 hours (Figure 2)

Figure 2.

Figure 2.

1×106 Hut-78 cells were treated with CD3/CD28 monoclonal antibody with or without AT stimulation. Stimulation of Hut-78 cells with anti-CD3/CD28 for 19 hours caused a significant increase in IL-13 synthesis at mRNA level in Hut-78 cells, which can be decreased by the pretreatment of cells with AT (5 μmol/L).

Back to Top | Article Outline

The effect of AT on GATA3 binding to importin-α2 in Hut-78 cells (Figure 3)

Figure 3.

Figure 3.

1×107 Hut-78 cells were treated with CD3/CD28 monoclonal antibody with or without AT (5 μmol/L) stimulation for 30 minutes. CD3/CD28 co-stimulation induced interaction of importin-α2 with GATA-3, which was disrupted by pretreatment with AT (5 μmol/L).

Back to Top | Article Outline

The effect of AT on GATA-3 binding to the promoter of IL-13 in Hut-78 cells (Figure 4)

Figure 4.

Figure 4.

1×106 Hut-78 cells were treated with CD3/CD28 monoclonal antibody co-stimulation with or without AT pretreatment in 0, 30 minutes, 1 hour and 2 hours. GATA3 was recruited to the IL-13 promoter after the stimulation with CD3/CD28 for 30 minutes and 1 hour; however the recruitment was decreased by pretreatment of cells with AT (5 μmol/L).

Back to Top | Article Outline

DISCUSSION

As one of the medical choices, arsenic trioxide can be dated back to the ancient Greek physicians such as Hippocrates. It became popular in the therapy of asthma after Song Dynasty in China. In the 19th century, Fowler’s solution, a 1% arsenic trioxide solution was prescribed for patients with asthma in some western countries.4 It is still one of commonly used drugs in traditional Chinese medicine in asthma therapy. However the exact mechanism is still poorly understood.

Asthma is a chronic inflammatory disorder of the airway. This chronic inflammation is associated with increased airway responsiveness to a variety of stimuli and with recurrent symptoms and reversible airflow limitation that are characteristics of asthma.5 T Cell is one of the key cells in orchestrating airway inflammation through secretion of IL-4, IL-5 and IL-13.6 IL-13 is one of the central mediators of allergic asthma, through regulating eosinophilic inflammation, mucus secretion, and airway hyperresponsiveness.2,6 Yin et al1 showed that arsenic trioxide even at small doses alleviates the airway inflammation in an animal model. The present study further provides a molecular basis for the anti-inflammatory activity of arsenic trioxide in asthma therapy with the evidence that arsenic trioxide significantly reduced the gene expression of IL-13 induced by anti-CD3/CD28 stimulation.

The expression of Th2 cytokines is regulated by the zinc finger transcription factor GATA-3 in animal studies. And the key role of GATA-3 in airway inflammation has been further demonstrated in mice by the conditional knockout or RNA interference of GATA-3 gene.7,8 Furthermore, nuclear import of transcription factors is also crucial for their action, for instance, nuclear import proteins, such as importin-α (karyopherin-α), play a critical role in transporting large proteins from the cytoplasm into the nucleus.9 Previously we found an enhanced nuclear expression of GATA-3 and improved assistance of importin-α2 for the nuclear import of GATA3 following CD3/CD28 co-stimulation. The GATA-3 nuclear translocation is dependent on its phosphorylation on serine residues by p38 MAPK, which facilitate interaction with the nuclear transporter protein importin-α2.3 In this study, CD3/CD28 co-stimulation induced the interaction of importin-α2 with GATA-3 and 5 μmol/L AT pretreatment disrupted this interaction, indicating the inhibition of GATA3 binding to importin-α2 by AT. Therefore, AT might inhibit the nuclear translocation of GATA-3 through reducing the interaction between GATA-3 and importin-α2. Furthermore, CHIP assay in the present study also showed that the binding of GATA-3 to the promoter of IL-13 was reduced by arsenic trioxide, suggesting that the initiation of IL-13 transcription process could be affected by AT treatment.

In summary, arsenic trioxide could reduce the gene expression of IL-13 through inhibiting the interaction of GATA-3 to importin-α 2 and affecting the binding of GATA-3 to IL-13 promoter. These results shed some light on the molecular mechanism of anti-inflammatory activity of arsenic trioxide.

Back to Top | Article Outline

Acknowledgments:

We would like to thank Professor Peter Barnes and Professor Ian Adcock from National Heart and Lung Institute, UK, for their great help to this work.

Back to Top | Article Outline

REFERENCES

1. Yin KS, Yao X, Chen JD, Huang M, Dai SL. The effect of arsenic trioxide in sensitized guinea pigs. Acta Univ Med Nanjing 1999; 19: 433.
2. Nakajima H, Takatsu K. Role of cytokines in allergic airway inflammation. Int Arch Allergy Immunol 2007; 142: 265-273.
3. Maneechotesuwan K, Yao X, Ito K, Jazrawi E, Lee KY, Usmani OS, et al. Regulation of Th2 cytokine genes by p38 MAPK-mediated phosphorylation of GATA-3. J Immunol 2007; 178: 2491-2498.
4. Miller WH Jr, Schipper HM, Lee JS, Singer J, Waxman S. Mechanisms of action of arsenic trioxide. Cancer Res 2002; 62: 3893-3903.
5. Fireman P. Understanding asthma pathophysiology. Allergy Asthma Proc 2003; 24: 79-83.
6. Ngoc PL, Gold DR, Tzianabos AO, Weiss ST, Celedón JC. Cytokines, allergy, and asthma. Curr Opin Allergy Clin Immunol 2005; 5: 161-166.
7. Zhu J, Yamane H, Cote-Sierra J, Guo L, Paul WE. GATA-3 promotes Th2 responses through three different mechanisms: induction of Th2 cytokine production, selective growth of Th2 cells and inhibition of Th1 cell-specific factors. Cell Res 2006; 16: 3-10.
8. Skapenko A, Leipe J, Niesner U, Devriendt K, Beetz R, Radbruch A, et al. GATA-3 in human T cell helper type 2 development. J Exp Med 2004; 199: 423-428.
9. Mosammaparast N, Pemberton LF. Karyopherins: from nuclear-transport mediators to nuclear-function regulators. Trends Cell Biol 2004; 14: 547-556.
Back to Top | Article Outline

News

Back to Top | Article Outline

Hong Kong government offers free flu vaccination to target groups

The Hong Kong government launched an influenza vaccination program to offer about 300 000 people free shots.

The program, running until March 31 next year, will cover about 300 000 people in eight target groups recommended by the Center for Health Protection of the Department of Health of Hong Kong.

People who will be receiving free vaccinations include elderly people living in residential care homes, long-stay residents of institutions for the disabled, children and pregnant women receiving Comprehensive Social Security Assistance, poultry workers and others.

Hong Kong Secretary for Food and Health York Chow Monday visited an elderly home in Aberdeen to see the implementation of the program.

“The objective of providing free vaccination is to protect the elderly from complications of influenza infection by immunization before the arrival of the peak influenza season,” Chow said.

Since 1998, the Hong Kong government has been providing free vaccination to all elderly living in residential care homes in Hong Kong under the vaccination program.

“The program has all along been well received, with coverage of over 90 percent of residents living in elderly homes in 2007,” Chow said.

(Source: Xinhuanet)

Keywords:

interleukin-13; asthma; GATA-3; arsenic trioxide

© 2008 Chinese Medical Association