Secondary Logo

Journal Logo

Effect of breviscapine on fractalkine expression in chronic hypoxic rats

CHEN, Xiao-ju; CHENG, De-yun; YANG, Li; XIA, Xiu-qiong; GUAN, Jian

Section Editor(s): WANG, Mou-yue; SHEN, Xi-bin

Brief report
Free
SDC

Edited by

Department of Respiratory Medicine, West China Hospital, Sichuan University, Chengdu 610041, China (Chen XJ, Cheng DY, Yang L, Xia XQ and Guan J)

Correspondence to: Dr. CHENG De-yun, Department of Respiratory Medicine, West China Hospital, Sichuan University, Chengdu 610041, China (Tel: 86-28-85422377. Email: chengdeyun@sohu.com)

This study was supported by a research grant from the National Natural Science Foundation of China (No. 30370629).

(Received March 29, 2006)

Fractalkine (FKN) is the only known chemokine that fulfils the dual functions of an adhesive molecule and a soluble chemoattractant.1 FKN expression was reported increase in lungs of patients with severe pulmonary arterial hypertension,2 suggesting that FKN may participate in pathogenesis of pulmonary hypertension. Breviscapine is a flavonoid extracted from Erigeron breviscapus (Vant.) Hand. Mazz. Breviscapine can prevent the development of hypoxic pulmonary hypertension3 but the mechanism is unknown. This study evaluated the role of FKN in the pathogenesis of hypoxic pulmonary hypertension and the effect of breviscapine on FKN in hypoxic pulmonary hypertension.

Back to Top | Article Outline

METHODS

Animals and treatment

Twenty-four male Sprague Dawley rats weighting 150—200 g were randomly divided into 3 groups: a normoxic control group, a hypoxic group and a hypoxic group treated with breviscapine (breviscapine group). The rats in hypoxic and breviscapine groups were exposed to normobaric hypoxia (9.5% —10.5% oxygen) for 3 weeks (8 h/d). The breviscapine group rats were orally administered 60 mg/kg of breviscapine diluted in 1 ml saline before exposure to hypoxic condition every day.

Back to Top | Article Outline

Measurement of pulmonary arterial pressure and right ventricular hypertrophy

After rats were anaesthetized with chloral hydrate (300 mg/kg intraperitoneally), a catheter was inserted into the main pulmonary artery through the right jugular vein. The mean pulmonary arterial pressure (mPAP) was measured in each rat by a pressure transducer and a polygraphic recording system (Gould, USA). The hearts were fixed in 10% neutral formaldehyde solution for 7 days. The weight of the right ventricle (RV) and the left ventricle plus septum (LV+S) were measured. The right ventricular hypertrophy index was expressed as RV/ (LV+S) %.

Back to Top | Article Outline

Light microscopic analysis of pulmonary arterioles

The lung tissue sections stained by haematoxylin and eosin were analysed with a light microscope equipped with a computerized image analyser. In each tissue section, 8 arterioles 50 — 100 μm in diameter were measured. The percentage of vascular wall thickness/vascular external diameter (WT%) and the percentage of vascular wall area/total vascular area (WA%) were calculated to express pulmonary vascular remodelling.

Back to Top | Article Outline

Semi-quantitation of FKN mRNA by reverse transcriptase polymerase chain reaction (RT-PCR) assay

Total RNA was extracted from rat lungs by a phenol/chloroform method (TRIzol reagent; Invitrogen, USA), and then cDNA was synthesized and amplified with the One Step RNA PCR Kit (TaKaRa Biotechnology, China). The primer pair sequences for FKN were 5′-ACTGGAATTTCTGA GGTGGC-3′ (sense) and 5′-GAACTGGGTTTGTCT CCTCA -3′ (antisense). The primer pair sequences for GAPDH were 5′-AGTTCAACGGCACAGT CAAG-3′ (sense) and 5′-ACAGTCTTCTGAGTGG CAGT-3′ (antisense). The amplified RT-PCR products for FKN and GAPDH are 249 bp and 400 bp. The products were electrophoresed on 1.5% agarose gels and viewed by ethidium bromide staining. Measured RNA levels were normalized to GAPDH and expressed as a ratio of rat FKN/GAPDH.

Back to Top | Article Outline

Serum and lung tissue FKN

Right lung (100 mg) was homogenized in 1 ml of saline, centrifuged at 10 000 ×g for 20 minutes and the supernatant stored at — 70°C. Concentrations of FKN in serum and lung tissue homogenate were determined using murine fractalkine DuoSet ELISA Development kit (R&D Systems, USA) according to the manufacturer's instructions.

Back to Top | Article Outline

Immunohistochemical analysis and in situ hybridization of FKN

A SP Kit (Zhongshan Biotechnology, China) was used for immunohistochemistry (IHC). The tissue sections were incubated with antiFKN polyclonal antibody (R&D Systems, USA) at a concentration of 20 μg/ml. In situ hybridization (ISH), DIG Labelled Probe Detection Kit (Boster Biotechnology, China) was used. The sequence of probe against FKN mRNA was AGGTCCTCTGTCTTGGAAAATATCA GTATG.

Brownish yellow colour in cytoplasm indicated presence of FKN. Eight pulmonary arterioles 50 — 100 μm in diameter were selected from each section for analysis. The pulmonary arterioles were photographed under a light microscope and analysed by image analysis software. Average absorbance of pulmonary arterioles and background of every section were measured. FKN mRNA and protein levels were expressed as a ratio of the average absorbance: pulmonary arterioles/ background.

Back to Top | Article Outline

Statistical analysis

All statistical analysis was performed using SPSS v11.0. All data were expressed as mean ± standard deviation (SD). One way analysis of variance (ANOVA) was used for the comparison of three groups. Between group variance was determined by Least Significant Difference post hoc test. A P value <0.05 was considered statistically significant.

Back to Top | Article Outline

RESULTS

Haemodynamic analysis and assessment of right ventricular hypertrophy

Compared with the control group, the mPAP and RV/(LV+S) were significantly increased in hypoxic group (P<0.01, Table 1). Treatment with breviscapine markedly prevented the increase in mPAP and RV/(LV+S) (P<0.01, Table 1).

Table 1

Table 1

Back to Top | Article Outline

Light microscopic analysis of pulmonary arterioles

In hypoxic rats, the pulmonary arteriolar wall thickened significantly and the lumen diameter narrowed significantly. The WT% and WA% were significantly higher in hypoxic rats than in control rats (P<0.01, Table 1). In breviscapine group, the WT% and WA% were significantly decreased compared with the hypoxic group (P<0.01, Table 1). Treatment with breviscapine prevented any pulmonary arteriolar wall thickening and lumen diameter narrowing.

Back to Top | Article Outline

FKN concentrations in serum and lung tissue

Serum and lung tissue FKN concentrations were significantly higher in the hypoxic rats than in the control rats (P<0.01, Table 2). In the breviscapine group, serum and lung tissue FKN concentrations were significantly decreased compared with the hypoxic group (P<0.01, Table 2). Linear regression analysis showed that serum FKN concentrations correlated positively with WT%(r=0.850, P<0.05), WA%(r=0.917, P<0.05), and lung tissue FKN concentrations correlated positively with WT% (r= 0.832, P<0.05), WA%(r=0.828, P<0.05).

Table 2

Table 2

Back to Top | Article Outline

FKN mRNA expression in lung

RT-PCR studies detected FKN mRNA in all rats (Fig. 1). However, FKN mRNA expression was significantly increased in chronic hypoxic rats compared with control rats (P<0.01, Table 2). Linear regression revealed significant association between FKN mRNA levels and WT% (r=0.904, P<0.05), WA% (r=0.933, P<0.05). In the breviscapine group, FKN mRNA expression was significantly decreased compared with the hypoxia group (P<0.01, Table 2).

Fig. 1.

Fig. 1.

Back to Top | Article Outline

FKN mRNA and protein expression in pulmonary arterioles

ISH and IHC experiments showed that the endothelial cells of normal pulmonary arterioles express FKN, but the expression was weak (Figs. 2A and 3A). In chronic hypoxic rats, the endothelium of pulmonary arterioles showed strong FKN expression and smooth muscle cells of pulmonary arterioles were also strongly positive (Figs. 2B and 3B). In the breviscapine group, the endothelial cells and smooth muscle cells of pulmonary arterioles showed weak FKN mRNA and protein expression (Figs. 2C and 3C). By computer image analysis, FKN mRNA and protein levels in pulmonary arterioles of hypoxic group were higher than those of the control group (P<0.01, Table 2). FKN mRNA and protein levels in pulmonary arterioles of breviscapine group were lower than those of the hypoxic group (P<0.01, Table 2).

Fig. 2.

Fig. 2.

Fig.

Fig.

Back to Top | Article Outline

DISCUSSION

FKN is a chemokine that exists in a soluble form and a membranous anchored form. Membranous FKN is mainly expressed on the surface of endothelial or epithelial cells activated with inflammatory cytokines such as tumour necrosis factor-α, interleukin-1 or interferon- γ.4-6 It mediates adhesion in an intergrin independent pathway. Soluble FKN (sFKN) can be released after proteolytic cleavage and exhibits chemotactic activity for monocytes and T cells. In both cases, its actions are mediated by CX3CR1, high affinity FKN receptor that is mainly expressed on monocytes, T cells and natural killer cells.7-9 FKN plays a key role in the recruitment of leukocytes in sites of active inflammation.

These results suggest that chronic hypoxia induces upregulation of FKN mRNA and subsequent increase in the synthesis and release of FKN protein. Furthermore, increased concentrations of serum sFKN protein in hypoxic rats may be due to a raised production and an increased cleavage of the membranous FKN.

This study show that chronic hypoxic rats developed pulmonary hypertension and vascular remodelling which latter correlated with FKN mRNA and protein levels. These results indicate FKN may participate in regulating the pulmonary vascular remodelling induced by hypoxia. Although normal pulmonary artery endothelial cells express FKN, as previously reported,2,4 this is the first report that chronic hypoxia can lead to a remarkable increase in the expression of FKN in endothelial cells and smooth muscle cells of murine pulmonary arterioles.

Breviscapine is a flavonoid extracted from Erigeron breviscapus (Vant.) Hand.-Mazz. It has been reported that breviscapine can dilate vessels, inhibit platelet aggregation and scavenge free radicals. In breviscapine group, the mPAP, ratio of RV/(LV+S), the WT% and WA% were decreased significantly compared with hypoxic group. Serum and lung tissue FKN concentrations, the expression of FKN mRNA and protein in lung were significantly decreased in breviscapine group as compared with hypoxic group. The results suggest that breviscapine inhibits expression and activation of FKN, which may be one mechanism by which breviscapine prevents hypoxic pulmonary hypertension and pulmonary vascular remodelling.

In summary, chronic hypoxia stimulates synthesis and release of FKN, which plays an important role in regulating pulmonary vascular remodelling. Breviscapine may prevent hypoxic pulmonary hypertension through inhibiting expression and activation of FKN.

Back to Top | Article Outline

REFERENCES

1. Umehara H, Bloom ET, Okazaki T, Nagano Y, Yoshie O, Imai T. Fractalkine in vascular biology from basic research to clinical disease. Arterioscler Thromb Vas Bio 2004;24:34-40.
2. Balabanian K, Foussat A, Dormuller P, Durand-Gasselin I, Capel F, Bouchet-Delbos L, et al. CX3C chemokine fractalkine in pulmonary arterial hypertension. Am J Respir Crit Care Med 2002;165:1419-1425.
3. Zhou H, Chen S, Wang L, Xie Y, Yan C, Wang Q, et al. Effect of breviscapine on protein kinase C of chronic hypoxic rats. Chin Pharmaco Bull (Chin) 2002;18:39-42
4. Bazan JF, Bacon KB, Hardiman G, Wang W, Soo K, Rossi D, et al. A new class of membrane-bound chemokine with a CX3C motif. Nature 1997;385: 840-844.
5. Yoneda O, Imai T, Goda S, Inoue H, Yamauchi A, Okazaki T, et al. Fractalkine-mediated endothelial cell injury by NK cells. J Immunol 2000; 164:4055-4062.
6. Imaizumi T, Matsumiya T, Fujimoto K, Okamoto K, Cui X, Ohtaki U, et al. Interferon-gamma stimulates the expression of CX3CL1/fractalkine in cultured human endothelial cells. Tohoku J Exp Med 2000; 192:127-139.
7. Foussat A, Coulomb-L'Hermine A, Gosling J, Krzysiek R, Durand-Gasselin I, Schall T, et al. Fractalkine receptor expression by T lymphocyte subpopulations and in vivo production of fractalkine in human. Eur J Immunol 2000; 30:87-97.
8. Nishimura M, Umehara H, Nakayama T, Yoneda O, Hieshima K, Kakizaki M, et al. Dual functions of fractalkine/CX3CR1 in trafficking of circulating cytotoxic effector lymphocytes that are defined by CX3CR1 expression. J Immunol 2002; 168:6173-6180.
9. Umehara H, Goda S, Imai T, Nagano Y, Minami Y, Tanaka Y, et al. Fractalkine, a CX3C-chemokine, functions predominantly as an adhesion molecule in monocytic cell line THP-1. Immunol Cell Biol 2001; 79:298-302.
Keywords:

hypoxia; pulmonary hypertension; fractalkine; breviscapine

© 2006 Chinese Medical Association