Secondary Logo

Journal Logo

Multipotent Stromal Cells Derived From the Infrapatellar Fat Pad of the Knee

Wickham, M., Quinn*; Erickson, Geoffrey, R.*,**; Gimble, Jeffrey, M.; Vail, T., Parker*; Guilak, Farshid*,**,†

Clinical Orthopaedics and Related Research: July 2003 - Volume 412 - Issue - p 196-212
doi: 10.1097/01.blo.0000072467.53786.ca
SECTION II ORIGINAL ARTICLES: Research
Free
SDC

Tissue engineering approaches for promoting the repair of skeletal tissues have focused on cell-based therapies involving multipotent stromal cells. Recent studies have identified such cells in several tissues in the adult human, including skin, muscle, bone marrow, and subcutaneous fat. This study examined the hypothesis that the infrapatellar fat pad of the adult knee contains progenitor cells that have the ability to differentiate into chondrocytes, osteoblasts, or adipocytes under appropriate culture conditions. Cells isolated from the fat pad stroma had a profile of cell-surface molecules similar but not identical to that of bone marrow-derived mesenchymal stem cells. Using defined culture conditions, fat pad-derived stromal cells were induced to differentiate cells with phenotypic characteristics of: (1) chondrocytes, synthesizing cartilage matrix molecules; (2) adipocytes, producing lipid vacuoles and leptin; or (3) osteoblasts, forming mineralized tissue. The culture conditions also modulated the expression of characteristic gene markers for each lineage. This study supports the hypothesis that multipotent stromal cells are present in many connective tissues in the adult human. Given its location and accessibility, the fat pad may prove to be a potential source of progenitor cells for musculoskeletal tissue engineering.

From the Departments of *Surgery, **Biomedical Engineering, and Mechanical Engineering & Materials Science, Orthopaedic Research Laboratories, Duke University Medical Center, Durham, NC; and Artecel Sciences, Inc., Durham, NC.

This study was funded in part by Artecel Sciences Inc., the North Carolina Biotechnology Center, National Institutes of Health Grants AR43876, AG15768, and GM08555, and the Kenan Foundation.

Reprint requests to Farshid Guilak, PhD, Orthopaedic Research Laboratories, Box 3093, 375 MSRB, Duke University Medical Center, Durham, NC 27710. Tel: 919-684-2521; Fax: 919-681-8490; E-mail: guilak@duke.edu.

Received: January 15, 2002.

Revised: June 3, 2002; October 8, 2002.

Accepted: November 4, 2002.

List of Abbreviations Used: cDNA complementary deoxyribonucleic acid, GAPDH glyceraldehyde phosphate dehydrogenase, IgG immunoglobulin G, mRNA messenger ribonucleic acid, PDGF platelet derived growth factor, PPARγ2 peroxisome proliferator activated receptor γ2, RNA ribonucleic acid, TGF-β1 transforming growth factor-beta 1

During embryonic development, stem cells from the blastocyst give rise to cell progenies that seem to become progressively restricted in their phenotypic potential to generate mature tissues. 24 However, increasing evidence supports the hypothesis that many adult tissues maintain populations of cells that are not differentiated terminally and may have the capacity for renewal after trauma, disease, or aging. 12,26,31,53,55,64,70 The isolation and manipulation of these adult stem cell reserves represent a promising pool of candidate cells for the engineered repair and regeneration of tissues and organ systems.

One of these reserves, bone marrow-derived mesenchymal stem cells, has been studied extensively with respect to its application in promoting the repair of musculoskeletal tissues such as bone, 9 cartilage, 65 tendon, 71 or meniscus, 67 and for the treatment of osteogenesis imperfecta. 34 It is accepted that cartilage, fat, bone, and other connective tissues are derived from a common ancestor, the stromal stem cell. 12,13,23,53 In response to appropriate culture conditions, bone marrow-derived mesenchymal stem cells have been shown to selectively form adipocytes, osteoblasts, fibroblasts, and chondrocytes in vitro. 4,8,20,26,38,40,42,55,56,68 There is evidence to suggest that other connective tissues, such as synovial tissue, muscle, skin, and periosteum, also contain multipotent progenitor cells capable of forming bone, fat, cartilage, and possibly other tissue types. 17,37,46–48,69,70 In addition, it is hypothesized that the mature stromal cells in the musculoskeletal system may not be differentiated terminally, but may maintain significant plasticity in their phenotypic capabilities. 50,51

Recent studies suggest that multipotent stromal cells are present in adult human adipose tissue. 21,30–32,72 Using defined culture conditions, human adipose-derived stromal cells have been shown to produce markers associated with the adipocyte and osteoblast phenotypes. 30–32,60,61,72 It also has been shown that these adipose-derived stromal cells are capable of producing markers of the chondrocyte phenotype. 21,72

New techniques involving implantation of cells and tissue-engineered constructs are being developed to improve musculoskeletal tissue repair. Surgical repair of cartilage has received particular attention given the limited ability for cartilage self-repair in the adult human. Despite the metabolic activity of the chondrocytes, articular cartilage has extremely limited ability to recruit functional progenitor cells for tissue repair. 11,14 Historically, surgeons have had few options for repair of cartilage lesions, including techniques such as abrasion, 39 microfracture, 62,63 and transplantation of autologous cartilage. 5–7,25 However, investigators have developed new cell-based therapies involving implantation of primary articular chondrocytes or mesenchymal stromal cells to improve osteochondral repair. 1,15,18,27,36,52,57,65,66 Although these technologies have shown promise, they face limitations with respect to the availability of donor cells, the incorporation of the donor cells into the surrounding cell matrix, and local morbidity of the donor sites attributable to the harvesting procedures. 14,43

The goal of the current study was to determine if the infrapatellar fat pad of the adult human knee contains a source of multipotent progenitor cells. The authors hypothesized that the fat pad contains progenitor stromal cells in sufficient quantity for clinical use and that these cells would have a chondrocytic functional capacity, in vitro. Secondarily, the authors hypothesized that under appropriate culture conditions, the cells would have the functional capacity of adipocytes or osteoblasts, suggesting that they have a similar multipotent nature to adult stem cells previously described in the literature.

Back to Top | Article Outline

MATERIALS AND METHODS

Tissue Preparation

Infrapatellar fat pads were obtained as surgical waste tissue from total knee arthroplasties in accordance with a protocol approved by the Institutional Review Board. The tissues were obtained from patients 49 to 82 years of age with a mean age of 68 ± 11.1 years (n = 16). The fat pads were minced with a scalpel and washed with Krebs-Ringer-Bicarbonate (Sigma, St Louis, MO) to remove contaminating blood and then were digested with 0.04% collagenase Type I (Worthington Biochemical, Lakewood, NJ) for 3 hours at 37° C under constant agitation. The floating adipocytes were separated from the stromal fraction by centrifugation at 300 × g for 5 minutes. The cells contained in the stromal-connective tissue fraction were plated in tissue culture flasks containing Dulbecco’s Modified Eagle Media F-12 (Gibco BRL, Grand Island, NY) supplemented with 10% fetal bovine serum (Gibco BRL), 15 mmol/L HEPES (pH 7.4, Gibco BRL), 100 units/mL penicillin, and 100 μg/mL streptomycin. The cells were washed and media were replaced after 48 hours. The primary cells were cultured until they reached confluence and harvested by digestion with 0.5 mmol/L of ethylenediaminetetraacetic acid/0.05% trypsin (Gibco BRL). At this stage, cells were used immediately for assays after two passages.

Back to Top | Article Outline

Flow Cytometry

Cells were cultured under control conditions, harvested with trypsin-ethylenediaminetetraacetic acid (Gibco BRL), and resuspended in Isocove’s Modified Dulbecco’s Media (Gibco BRL) with 2% fetal bovine serum (Gibco BRL). Aliquots were incubated with individual primary antibodies (HLA-DR, CD9, CD11a, CD11b, CD11c, CD10, CD13, CD14, CD18, CD29, CD31, CD34, CD44, CD45, CD49e, CD50, CD54, CD56, CD59, CD62e, CD105, CD106, CD166) for 15 minutes at room temperature and then washed in phosphate buffered saline (Gibco BRL) with 2% fetal bovine serum. When necessary, the cells were incubated with a conjugated secondary antibody (antimouse IgG, Molecular Probes, Eugene, OR). The cells were fixed in 10% formalin in phosphate buffered saline with 2% fetal bovine serum. Samples were analyzed using a FACSCalibur immunocytometer system (Becton Dickinson, San Jose, CA).

Back to Top | Article Outline

Chondrocyte Differentiation

Culture Conditions

Cells were trypsinized from culture flasks, washed and centrifuged, and resuspended in 1.2% low viscosity alginate (Sigma) (in 0.9% NaCl) at a concentration of 4 × 106 cells/mL. 21 This cell suspension was drawn into a syringe and expressed through a 22-gauge needle into a bath of 102 mmol/L CaCl2 and cured for 10 minutes. The CaCl2 was removed and the beads were washed three times in 0.9% NaCl and once in Dulbecco’s Modified Eagle Media, high glucose. The cells were grown in control or chondrogenic culture media in a humidified environment at 5% CO2 and 37° C for 14 days, with culture media replaced every 3 days. Control culture media contained Dulbecco’s Modified Eagle Media, high glucose, 10% fetal bovine serum, 100 u/mL penicillin, and 100 μg/mL streptomycin. The chondrogenic culture media contained the following additional components: 1× insulin-transferrin-selenium supplement (Collaborative Biomedical, Becton Dickinson, Bedford, MA), 37.5 μg/mL ascorbate 2-phosphate (Sigma), 100 nmol/L dexamethasone (Sigma), and 10 ng/mL TGF-ß1 (R & D Systems, Minneapolis, MN). 21,40,68

Back to Top | Article Outline

Immunohistochemistry

Evidence of chondrogenesis was assessed based on immunohistochemical detection of cartilaginous matrix proteins, including collagen Types I, II, VI, X, and sulfated glycosaminoglycan (chondroitin-4-sulfate). Alginate beads were irreversibly cross-linked with 100 mmol/L BaCl2 and then fixed in 4% formalin for 1 hour. The beads were embedded in paraffin and sectioned. The slides were stained for the aforementioned markers using the following primary antibodies: II-II6B3 for Type II collagen (Developmental Hybridoma Bank, University of Iowa, Iowa City, IA), 5C6 for Type VI collagen (Developmental Hybridoma Bank, University of Iowa), Type X collagen (Quartett, Berlin, Germany), and 2B6 for chondroitin 4-sulfate (provided by Dr. Virginia Kraus, Duke University Medical Center, Durham, NC). Immunohistochemistry was done using Histostain-SP Kit (Zymed, San Francisco, CA) and the slides were examined using conventional light microscopy (Axiovert, Zeiss, Thornwood, NY).

Back to Top | Article Outline

Extracellular Matrix Biosynthesis

To quantify cellular biosynthetic activity during a differentiation period of 2 weeks, alginate cultures were incubated for the final 24 hours of the culture period in the presence of [35S]-sulfate (10 μCi/mL) and [3H]-proline (20 μCi/mL) at Days 1, 3, 5, 7, and 14. The beads then were washed four times for 15 minutes each in phosphate buffered saline containing 0.8 mmol/L sodium sulfate and 1 mmol/L proline to remove free label. The beads then were solubilized in 0.5 mL Soluene (Packard, Meriden, CT) in glass scintillation counting tubes (Bio-Safe, Research Products International, Mount Prospect, IL). After the addition of 4.5 mL liquid scintillation fluid, the [35S]-sulfate and [3H]-proline were measured on a beta counter (Packard, Meriden, CT).

Back to Top | Article Outline

Adipocyte Differentiation

Culture Conditions

Stromal cells were trypsinized and plated in 96-well plates at 30,000 cells/cm2 for 16 hours to allow attachment in control media (Day 0). On Day 1, the medium was changed to Dulbecco’s Modified Eagle Media F-10 supplemented with 3% fetal bovine serum, 100 units/mL penicillan, 100 μg/mL streptomycin, 15 mmol/L HEPES buffer solution (pH 7.4), biotin (33 μm, Sigma), pantothenate (17 μm), human recombinant insulin (100 nmol/L, Boehringer Mannheim, IN), dexamethasone (1 μmol/L), 1-methyl-3-isobutylxantine (0.25 mmol/L), and BRL49653 (1 μmol/L) for 3 days. 31,32,60,61 After the initial feeding, the cells were fed every 3 days with the same media without 1-methyl-3-isobutylxantine and BRL49653 supplementation for the remaining 10 days of the differentiation period.

Back to Top | Article Outline

Intracellular Lipid Accumulation

Cells were rinsed three times with phosphate buffered saline, fixed with 10% formalin in phosphate buffered saline for 1 hour at 4° C, and stained with 30 μL of the oil red O solution per well for 15 minutes at room temperature. 32,61 The wells were rinsed with distilled water until the supernatant was clear and the dye retained by the cells was eluted with 50 μL isopropanol. The optical density at 540 nm was determined using a microplate reader (Molecular Devices, Sunnyvale, CA). Blank wells (without cells) were stained with dye and rinsed in the same manner. The blank well optical density values were subtracted from the experimental well data points to control for stain retention by the walls of the well. Data were expressed as a foldinduction of differentiation. This value was calculated by taking a ratio of the average optical absorbance of wells grown under adipogenic or osteogenic conditions over the absorbance of the control wells for each human donor.

Back to Top | Article Outline

Leptin Production

Leptin production in the media was measured using a quantitative sandwich enzyme-linked immunoassay technique (R&D Systems) in 96-well plates. During the differentiation period, media aliquots were obtained every 3 days from cells being grown under control, adipogenic, and osteoblast conditions. These samples were stored at −80° C until analysis. After a wash to remove any unbound antibody-enzyme reagent, a substrate solution was added to the wells and color developed in proportion to the amount of leptin bound to the plate. This color change was read on a microplate reader (Molecular Devices).

Back to Top | Article Outline

Osteoblast Differentiation

Culture Conditions

The expanded stromal cells were trypsinized and plated in 96-well plates at 30,000 cells/cm2 for 16 hours to allow attachment in control media (Day 0). On Day 1, the media was changed in Fitton-Jackson modified media supplemented with 10% fetal bovine serum, 100 units/mL penicillin, and 100 μg/mL streptomycin, 10 mmol/L B-glycerophosphate, and 50 μg/mL ascorbate 2-phosphate, 10 nmol/L 1,25-vitamin D3 (BioMol, Plymouth Meeting, PA), and 10 nmol/L dexamethasone. 30,31 Media were replaced every third day throughout the study.

Back to Top | Article Outline

Mineral Formation

Alizarin red staining was used to quantify calcium phosphate mineral formation in culture. Alizarin red was dissolved in distilled water at 2% (weight/ volume) concentration and was adjusted to pH 4.2 with NaOH and passed through a 0.22 μm filter. 30 Cultures in 96-well plates were rinsed with 150 mmol/L NaCl three times, fixed in ice cold 70% ethanol, rinsed with distilled water, and stained at room temperature for 10 minutes with 30 μL of alizarin red solution per well. After staining, all wells were washed with distilled water until supernatant was clear. For optical density measurements, each well was eluted for 30 minutes with 50 μL 10% cetylpyridinium chloride monohydrate. The optical density at 540 nm was determined using a microplate reader (Molecular Devices). Blank wells (without cells) were stained with dye and rinsed in the same manner. The blank-well optical density values were subtracted from the experimental well data points to control for stain retention by the walls of the well. Data were expressed as a fold-induction of differentiation. This value was calculated by taking a ratio of the average optical absorbance of wells grown under adipogenic or osteogenic conditions over the absorbance of the control wells for each human donor.

Back to Top | Article Outline

Ribonucleic Acid Isolation and Polymerase Chain Reaction

For the analysis of chondrocyte mRNA expression, alginate beads were dissolved with a brief incubation in 55 mmol/L sodium citrate and 50 mmol/L NaCl and then spun at 400 × g for 10 minutes. For the adipocyte and osteoblast analyses of mRNA expression, cells were differentiated in monolayer in six-well plates. Total RNA for all three lineages was isolated using an RNeasy mini kit (Qiagen, Valencia, CA) following the standard protocol for animal cells. Reverse transcriptase reactions were done with 1-μg total RNA using GeneAmp RNA PCR kit (Qiagen). Polymerase chain reactions were done using one cycle of 5 minutes at 94° C; multiple cycles of 30 seconds at 94° C, 1 minute at a primer specific annealing temperature, and 1 minute at 72° C; and an 8-minute extension at 72° C. The following oligonucleotide primer sets were used: (1) aggrecan and proteoglycan link protein as chondrocyte-associated markers; (2) lipoprotein lipase and PPARγ2 as adipocyte-associated markers; and (3) osteocalcin and osteopontin as osteoblast-associated markers. The sets of forward and reverse oligonucleotide primers indicated below were synthesized (Gibco-BRL) specific for the following human cDNAs: hGAPDH F: ACC ACA GTC CAT GCC ATC AC (471 bp); hGAPDH R: TCC ACC ACC CTG TTG CGT TA (30 cycles, 55° C) hAggrecan F: CGCTACGACGCCATCTGCTAC (357 bp); hAggrecan R: GCCTGCTGTGCCTCCTCAAA (35 cycles, 55° C); hLink F: CCTATGATGAAGGCGGTGC (340 bp); hLink R: GGTAACTTGCATGAGTTC (35 cycles, 55° C); hLipoprotein Lipase F: GAGATTTCTCTGTATGGCACC (276 bp); hLipoprotein Lipase R: CTGCAAATGAGACACTTTCTC (35 cycles, 55° C); hPPARγ2 F: TGGGTGAAACTCTGGGAGATTC (380 bp); hPPARγ2 R: CATGAGGCTTATTGTAGAGCTG (35 cycles, 58° C); hOsteocalcin F: CATGAGAGCCCTCACA (310 bp); hOsteocalcin R: AGAGCGACACCCTAGAC (30 cycles, 60° C); hOsteopontin F: CCAAGTAAGTCCAACGAAAG (347 bp); and hOsteopontin R: GGTGATGTCCTCGTCTGTA (35 cycles, 58° C).

Back to Top | Article Outline

RESULTS

Isolation Procedure and Cell Yield

The mean weight of the donor pads before isolation was 21.5 ± 8.8 g (n = 16). An average of 27.7 ± 7.8 million stromal cells were obtained from these samples after two passages in culture.

Back to Top | Article Outline

Surface Protein Expression by Undifferentiated Fat Pad-Derived Stromal Cells

Fat pad isolates were cultured under the control conditions in the absence of any added stimuli. Positive staining was defined as a fluorescent intensity greater than 99% of that obtained with the isotype-matched control antibody. The mean results from four donors, using a panel of 25 antibodies, are summarized in Table 1. The undifferentiated stromal cell populations isolated from the fat pad seem to be a heterogeneous population. The populations tested were consistently positive for the following surface proteins: CD9, CD10, CD13, CD29, CD44, CD49e, CD59, CD 105, CD 106, and CD 166.

TABLE 1

TABLE 1

Back to Top | Article Outline

Chondrocyte Differentiation

Fat pad cell isolates, which were grown in alginate beads and treated with chondrogenic media, synthesized cartilage matrix molecules. Immunohistochemical analysis revealed that Types I, II, and VI collagen, and chondroitin-4-sulfate, but not Type X collagen, were synthesized by cells grown in chondrogenic conditions for 14 days (Fig 1). None of these matrix proteins was synthesized under control conditions after 2 weeks of bead culture (Fig 1). Collagen Type X staining was seen in control analyses of human articular cartilage specimens run in parallel with all experiments (data not shown). In addition, none of these proteins was present in sections from cells cultured for just 1 day under treated and control conditions (data not shown).

Fig 1.

Fig 1.

The biosynthetic activity of the fat padderived cells was quantified by radioisotope incorporation of [3H]-proline and [35S]-sulfate as measures of protein and proteoglycan synthesis, respectively. Cells were cultured in alginate beads under control and chondrogenic conditions for 1, 3, 5, 7, and 14 days. These assays showed a significant increase in biosynthetic rates under chondrogenic conditions. The rate of [3H]-proline (Fig 2A) and [35S]-sulfate (Fig 2B) incorporation was significantly greater under chondrogenic conditions when compared with controls at all times (p < 0.05).

Fig 2A–B.

Fig 2A–B.

Messenger RNA expression for the human fat pad-derived stromal cells was determined by polymerase chain reactions of RNA isolated from cells cultured under control and chondrogenic conditions for 14 days. Chondrocyte-associated genes, aggrecan, and proteoglycan link protein were abundant after 14 days in chondrogenic conditions (Fig 3). There was a clear induction in the expression of aggrecan by the chondrogenic growth factors. Link protein was expressed in the fat pad cells under control and chondrogenic conditions (Fig 3).

Fig 3.

Fig 3.

Back to Top | Article Outline

Adipocyte Differentiation

The differentiation of human fat pad-derived stromal cells into adipocytes was examined by oil red O staining for neutral lipid. After 2 weeks under adipogenic conditions, many of the cells had formed large lipid vacuoles, which were not observed under control conditions (Fig 4A–B). Under adipogenic conditions, there was a threefold induction in neutral lipid accumulation as compared with cells grown in control conditions (Fig 4C; p < 0.001).

Fig 4A–C.

Fig 4A–C.

Enzyme-linked immunosorbent assay analysis showed a time-dependent increase in the secretion of leptin, an adipocyte specific protein (Fig 5). 32 Leptin levels increased to 4.9 ng/mL by 2 weeks in adipogenic conditions, but remained near baseline (zero) under control and osteogenic conditions (Fig 5; p < 0.05).

Fig 5.

Fig 5.

Messenger RNA expression for the fat pad-derived cells was determined by polymerase chain reactions of RNA isolated from cells cultured under control and adipogenic conditions for 14 days. Adipocyte associated genes, PPARγ2, and lipoprotein lipase were abundant after 14 days (Fig 6). There was a clear induction of PPARγ2 by adipogenic conditions. The three donors also expressed low levels of lipoprotein lipase under control conditions (Fig 6).

Fig 6.

Fig 6.

Back to Top | Article Outline

Osteoblast Differentiation

Cells grown under osteogenic conditions stained red with the alizarin stain to a much greater extent than cells grown under control conditions (Fig 7A–B). A threefold induction of calcium phosphate deposition was observed under osteogenic conditions relative to control and adipogenic conditions after 3 weeks of culturing (Fig 7C; p < 0.05). Under adipogenic conditions stromal cell mineralization was not significantly different from the controls (Fig 7C).

Fig 7A–C.

Fig 7A–C.

Messenger RNA expression for the stromal cells was determined by polymerase chain reactions of RNA isolated from cells cultured under control and osteogenic conditions for 14 and 21 days. The cells expressed osteoblast-associated mRNAs encoding the extracellular matrix proteins osteocalcin and osteopontin (Fig 8). Osteopontin, an early marker of osteoblast differentiation, was expressed constitutively in control and osteogenic conditions after 14 and 21 days of culture. Expression of osteocalcin, a late marker of osteoblast differentiation, was induced by osteogenic growth factors at 14 and 21 days (Fig 8).

Fig 8.

Fig 8.

Back to Top | Article Outline

DISCUSSION

It is accepted that chondrocytes, osteoblasts, and adipocytes derive from common progenitor cells. 4,12,13,23,26,53 Recent evidence suggests that adults retain such progenitor cells, often termed adult stem cells (because of their multipotent capabilities) in various depots of the body, including subcutaneous adipose tissue. 17,30–32,37,46–48,69,70 Previous studies show that these cells can be induced to differentiate down multiple lineages through appropriate control of their biochemical environment. 4,8,20,26,38,40,42,55,56,68 The current study showed that human stromal cells isolated from the infrapatellar fat pad of the knee have the ability, under lineage-specific culture conditions, to synthesize molecules that typically are considered to be markers of specific musculoskeletal tissues, namely collagens and proteoglycans, large lipid vacuoles, leptin, or calcium phosphate mineral (Table 2). In addition, modulation of characteristic gene markers for each of the three mesodermal lineages was observed under the appropriate culture conditions. The current findings indicate that the infrapatellar fat pad of the adult knee harbors a source of stromal cells with multilineage potential similar to those of cells derived from bone marrow stroma. 13,15,26,38,40,55,56,68 or from subcutaneous adipose tissue. 21,30–32,72 Although the function of these multipotent progenitor cells in the fat pad is not fully understood, their presence is consistent with previous reports identifying undifferentiated cells within various adult tissues.

TABLE 2

TABLE 2

The infrapatellar fat pad of the knee is a heterogeneous and fibrous structure that differs significantly from the tissue recovered in liposuction. Histologic analysis with hematoxylin and eosin staining indicated that a large proportion of the fat pad is dense collagenous tissue (Fig 9). The fat pad isolates are a heterogeneous population of cells that may contain small amounts of other cells such as pericytes, endothelial cells, and smooth muscle cells. 72 An analysis of the cell surface markers expressed by these cells, however, indicates a profile similar to those of multipotent cells isolated from bone marrow or subcutaneous adipose tissue. In general, the populations from the fat pad share the same adhesion and receptor molecules. 16,22,28,29,33,42,54,55 Three of these common surface markers, CD 105, CD 106, and CD 166, have been used to define the bone marrow population called mesenchymal stem cells that are capable of adipogenesis, chondrogenesis, osteogenesis, and hematopoietic support. 3,10,33,55 In contrast, the populations were negative for markers of the hematopoietic lineage, including CD 14, CD 34, and CD 45. However, the surface protein profile of the fat pad isolates is not identical to that reported for subcutaneous or bone marrow-derived stromal cells. This difference may reflect significant numbers of fibroblasts in the isolates given the amount of dense connective tissue in the fat pad. Also, synoviocytes, which have been shown to possess multipotent capabilities, 17 may be contained in the isolates because the fat pad is attached to synovium. In future studies, expanded single cell colonies will be required to determine the multipotent nature of individual cells derived from the fat pad. This information will be important in trying to determine the differences in cell availability and inductive potential from one tissue type to another, or one fat reservoir to another.

Fig 9.

Fig 9.

In the presence of chondrogenic media, fat pad-derived adult stromal cells produced Types I, II, and VI collagen, and chondroitin-4-sulfate. This profile of matrix molecules is similar to that of subcutaneous adipose isolates. 21,72 Bone marrow mesenchymal stem cells have been reported to produce collagen Types I, II, and X by immunostaining. 2,40,68 In the current study, collagen Type II was observed intracellularly and in the pericellular region of the fat padderived cells. This finding is consistent with studies of bone marrow-derived mesenchymal stem cells, which do not produce significant amounts of collagen Type II until at least the second week of in vitro culture. 2 Type VI collagen, which also was synthesized by the cell at 14 days, is present in articular cartilage. In normal cartilage, this molecule is localized to the pericellular matrix of chondrocytes and is thought to play an important role in the interaction of chondrocytes with the extracellular matrix. There was no production of collagen Type X, a marker of hypertrophic cartilage, 40,68 by the fat pad isolates at 14 days.

Chondrogenic culture conditions significantly increased and maintained the biosynthetic activity of the fat pad-derived cells, suggesting increases in the production of protein and proteoglycan. These findings are similar to those for stromal cells harvested from subcutaneous adipose tissue. 21 In contrast, [35S]-sulfate incorporation by bone marrow-derived mesenchymal stem cells has been shown to remain near baseline for 7 days and then increase reaching a maximum at 21 days. 2

Quantitative measures of the induction of adipocytic and osteoblastic differentiation by oil red O and alizarin red staining, respectively, are similar to findings of subcutaneous adipose isolates. 30–32,61 The fat pad isolates also produced similar levels of leptin in culture as compared with isolates of subcutaneous fat, but had comparatively less accumulation of lipid as measured by oil red O staining. 30,32,61 This finding may be attributable to the different nature of fat pad cell populations, which may contain more fibroblastlike cells, as compared with subcutaneous isolates that are thought to be rich in cells termed preadipocytes. 32

Under lineage-specific culture conditions, a significant increase was observed in the expression of aggrecan, PPARγ2, or osteocalcin genes. However, the cells under control conditions expressed link protein, lipoprotein lipase, and osteopontin. These findings may suggest that a portion of these fat pad-derived cells is producing genes associated with chondrocytes, adipocytes, and osteoblasts without growth factor stimulation. There is evidence that progenitor cells isolated from bone marrow and adipose tissue also express genes characteristic of mature mesodermal phenotypes, under undifferentiated control culture conditions. 2,21 This finding suggests that these isolates, including the fat pad-derived cells, already may contain subpopulations of more differentiated cells. Alternatively, regulation of the differentiation of these progenitor cells may be at the posttranscriptional level. This finding also supports the hypothesis that many cells of the body may not be terminally differentiated in vivo. Under controlled ex vivo environments, such progenitor cells may have the ability to express mRNA of genes that are considered to be unique to mature connective tissue cells.

That these fat pad-derived cells were obtained from an elderly population (mean age, 68 ± 11.1 years) suggests that stromal cells’ multipotency continues in later stages of life. The studies investigating the multipotent nature of subcutaneous adipose tissue-derived stromal cells have been done on a younger population with a mean age of approximately 40 years. 28,30,32,60,61 In contrast, there is evidence that the numbers of osteoprogenitor cells markedly decrease with age in mesenchymal stem cell populations derived from human bone marrow. 19,49

The findings of the current study also suggest a possible role for undifferentiated stromal cells in postoperative fibrosis after injury and surgery. 44,45 For example, collagen content in the fat pad increases after reconstruction of the anterior cruciate ligament. 44 In addition, fibrogenic cytokines, PDGF, and TGF-ß have been detected in the fat pad after anterior cruciate ligament injury. 45 Infrapatellar contraction syndrome, caused by postoperative arthrofibrosis, provides evidence that the cells within the fat pad may have the ability to adopt a fibroblastic phenotype. This may be attributable to alterations in the concentrations of growth factors or cytokines subsequent to injury or trauma to the fat pad or to the surrounding intraarticular soft tissue structures. 45 Some surgeons remove the fat pad during total knee arthroplasty, treating it as a waste product in the hope of preventing the aforementioned fibrosis. 58,59 Others think that the fat pad is a crucial structure in the knee, which should be saved. 35,41 However, these findings generally are based on clinical experience and there are few if any controlled outcome studies available on this topic.

The current findings provide evidence that cells with multipotent characteristics exist in the stroma of the knee fat pad. Given its location and accessibility, the fat pad may prove to be a readily accessible source of progenitor cells for tissue engineering or other cell-based therapies. For example, the fat pad could provide an autologous source of cells for chondral or osteochondral repair within the same knee. The current findings also provide additional support for the hypothesis that stromal progenitor cells are readily accessible in many of the body’s connective tissues, have multipotent capabilities, and are not terminally differentiated in vivo.

Back to Top | Article Outline

Acknowledgements

The authors thank the Development Hybridoma Bank, University of Iowa for several of the antibodies used in these experiments and Dr. Virginia Kraus for providing the 2B6 epitope of proteoglycan. The authors also thank Kevin Hicok, Dawn Franklin, Robert Nielsen, Holly Leddy, and Hubertus Winkler for support.

Back to Top | Article Outline

Glossary

  • 2B6 chondroitin-4-sulfate epitope of proteoglycan
  • 5C6 Type VI collagen antibody
  • II-II6B3 Type II collagen antibody
  • HLA-DR receptor for major histocompatibility molecule
  • CD 9 receptor for tetraspan
  • CD 10 receptor for common acute lymphocytic leukemia antigen
  • CD 11a receptor for integrin αL
  • CD 11b receptor for integrin αM
  • CD 11c receptor for integrin αX
  • CD 13 receptor for aminopeptidase N
  • CD 14 receptor of hematopoietic lineage
  • CD 18 receptor for integrin β2
  • CD 29 receptor for integrin β1
  • CD 31 receptor for platelet endothelial cell adhesion molecule
  • CD 34 receptor of hematopoietic lineage
  • CD 44 receptor for hyaluronate
  • CD 45 receptor for leukocyte common antigen
  • CD 49e receptor for integrin α5
  • CD 50 receptor for intercellular adhesion molecule-3
  • CD 54 receptor for intercellular adhesion molecule-1
  • CD 56 receptor for neural cell adhesion molecule
  • CD 59 receptor for complement protectin
  • CD 62e receptor for E-selectin
  • CD 105 receptor for endoglin
  • CD 106 receptor for vascular cell adhesion molecule
  • CD 166 receptor for activated leukocyte cell adhesion molecule
Back to Top | Article Outline

References

1. Angele P, Kujat R, Nerlich M, et al: Engineering of osteochondral tissue with bone marrow mesenchymal progenitor cells in a derivatized hyaluronan-gelatin composite sponge. Tissue Eng 5:545–554, 1999.
2. Barry F, Boynton RE, Liu B, Murphy JM: Chondrogenic differentiation of mesenchymal stem cells from bone marrow: Differentiation-dependent gene expression of matrix components. Exp Cell Res 268:189–200, 2001.
3. Barry FP, Boynton RE, Haynesworth S, et al: The monoclonal antibody SH-2, raised against human mesenchymal stem cells, recognizes an epitope on endoglin (CD105). Biochem Biophys Res Commun 265:134–139, 1999.
4. Bianco P, Cossu G: Uno, nessuno e centomila: Searching for the identity of mesodermal progenitors. Exp Cell Res 251:257–263, 1999.
5. Breinan HA, Minas T, Hsu HP, et al: Effect of cultured autologous chondrocytes on repair of chondral defects in a canine model. J Bone Joint Surg 79A:1439–1451, 1997.
6. Brittberg M, Lindahl A, Nilsson A, et al: Treatment of deep cartilage defects in the knee with autologous chondrocyte transplantation. N Engl J Med 331:889–895, 1994.
7. Brittberg M, Nilsson A, Lindahl A, et al: Rabbit articular cartilage defects treated with autologous cultured chondrocytes. Clin Orthop 326:270–283, 1996.
8. Bruder SP, Fink DJ, Caplan AI: Mesenchymal stem cells in bone development, bone repair, and skeletal regeneration therapy. J Cell Biochem 56:283–294, 1994.
9. Bruder SP, Kurth AA, Shea M, et al: Bone regeneration by implantation of purified, culture-expanded human mesenchymal stem cells. J Orthop Res 16:155–162, 1998.
10. Bruder SP, Ricalton NS, Boynton RE, et al: Mesenchymal stem cell surface antigen SB-10 corresponds to activated leukocyte cell adhesion molecule and is involved in osteogenic differentiation. J Bone Miner Res 13:655–663, 1998.
11. Buckwalter JA, Mankin HJ: Articular cartilage: Degeneration and osteoarthritis, repair, regeneration, and transplantation. Instr Course Lect 47:487–504, 1998.
12. Caplan AI: Mesenchymal stem cells. J Orthop Res 9:641–650, 1991.
13. Caplan AI: The mesengenic process. Clin Plast Surg 21:429–435, 1994.
14. Caplan AI, Elyaderani M, Mochizuki Y, et al: Principles of cartilage repair and regeneration. Clin Orthop 342:254–269, 1997.
15. Cassiede P, Dennis JE, Ma F, Caplan AI: Osteochondrogenic potential of marrow mesenchymal progenitor cells exposed to TGF-beta 1 or PDGF-BB as assayed in vivo and in vitro. J Bone Miner Res 11:1264–1273, 1996.
16. Conget PA, Minguell JJ: Phenotypical and functional properties of human bone marrow mesenchymal progenitor cells. J Cell Physiol 181:67–73, 1999.
17. De Bari C, Dell’Accio F, Tylzanowski P, Luyten FP: Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheum 44:1928–1942, 2001.
18. Diduch DR, Jordan LC, Mierisch CM, Balian G: Marrow stromal cells embedded in alginate for repair of osteochondral defects. Arthroscopy 16:571–577, 2000.
19. D’Ippolito G, Schiller PC, Ricordi C, et al: Agerelated osteogenic potential of mesenchymal stromal stem cells from human vertebral bone marrow. J Bone Miner Res 14:1115–1122, 1999.
20. Dorheim MA, Sullivan M, Dandapani V, et al: Osteoblastic gene expression during adipogenesis in hematopoietic supporting murine bone marrow stromal cells. J Cell Physiol 154:317–328, 1993.
21. Erickson G, Gimble J, Franklin D, et al: Chondrogenic potential of adipose tissue-derived stromal cells in vitro and in vivo. Biochem Biophys Res Commun 290:763–769, 2002.
22. Filshie RJ, Zannettino AC, Makrynikola V, et al: MUC18, a member of the immunoglobulin superfamily, is expressed on bone marrow fibroblasts and a subset of hematological malignancies. Leukemia 12:414–421, 1998.
23. Friedenstein AJ, Petrakova KV, Kurolesova AI, Frolova GP: Heterotopic of bone marrow: Analysis of precursor cells for osteogenic and hematopoietic tissues. Transplantation 6:230–247, 1968.
24. Fuchs E, Segre JA: Stem cells: A new lease on life. Cell 100:143–155, 2000.
25. Gillogly SD, Voight M, Blackburn T: Treatment of articular cartilage defects of the knee with autologous chondrocyte implantation. J Orthop Sports Phys Ther 28:241–251, 1998.
26. Gimble JM, Robinson CE, Wu X, Kelly KA: The function of adipocytes in the bone marrow stroma: An update. Bone 19:421–428, 1996.
27. Grande DA, Pitman MI, Peterson L, et al: The repair of experimentally produced defects in rabbit articular cartilage by autologous chondrocyte transplantation. J Orthop Res 7:208–218, 1989.
28. Gronthos S, Franklin DM, Leddy HA, et al: Surface protein characterization of human adipose tissue-derived stromal cells. J Cell Physiol 189:54–63, 2001.
29. Gronthos S, Zannettino AC, Graves SE, et al: Differential cell surface expression of the STRO-1 and alkaline phosphatase antigens on discrete developmental stages in primary cultures of human bone cells. J Bone Miner Res 14:47–56, 1999.
30. Halvorsen Y, Franklin D, Bond A, et al: Extracellular matrix mineralization and osteoblast gene expression by human adipose tissue-derived stromal cells. Tissue Eng 7:729–741, 2001.
31. Halvorsen YC, Wilkison WO, Gimble JM: Adipose-derived stromal cells: Their utility and potential in bone formation. Int J Obes Relat Metab Disord 24(Suppl):41–44, 2000.
32. Halvorsen YD, Bond A, Sen A, et al: Thiazolidinediones and glucocorticoids synergistically induce differentiation of human adipose tissue stromal cells: Biochemical, cellular, and molecular analysis. Metab Clin Exp 50:407–413, 2001.
33. Haynesworth SE, Baber MA, Caplan AI: Cell surface antigens on human marrow-derived mesenchymal cells are detected by monoclonal antibodies. Bone 13:69–80, 1992.
34. Horwitz EM, Prockop DJ, Fitzpatrick LA, et al: Transplantability and therapeutic effects of bone marrow-derived mesenchymal cells in children with osteogenesis imperfecta. Nat Med 5:309–313, 1999.
35. Hughes SS, Cammarata A, Steinmann SP, Pellegrini Jr VD: Effect of standard total knee arthroplasty surgical dissection on human patellar blood flow in vivo: An investigation using laser Doppler flowmetry. J South Orthop Assoc 7:198–204, 1998.
36. Im GI, Kim DY, Shin JH, et al: Repair of cartilage defect in the rabbit with cultured mesenchymal stem cells from bone marrow. J Bone Joint Surg 83B:289–294, 2001.
37. Iwasaki M, Nakata K, Nakahara H, et al: Transforming growth factor-beta 1 stimulates chondrogenesis and inhibits osteogenesis in high density culture of periosteum-derived cells. Endocrinology 132:1603–1608, 1993.
38. Jaiswal N, Haynesworth SE, Caplan AI, Bruder SP: Osteogenic differentiation of purified, cultureexpanded human mesenchymal stem cells in vitro. J Cell Biochem 64:295–312, 1997.
39. Johnson LL: Arthroscopic abrasion arthroplasty historical and pathologic perspective: Present status. Arthroscopy 2:54–69, 1986.
40. Johnstone B, Hering TM, Caplan AI, et al: In vitro chondrogenesis of bone marrow-derived mesenchymal progenitor cells. Exp Cell Res 238:265–272, 1998.
41. Kayler DE, Lyttle D: Surgical interruption of patellar blood supply by total knee arthroplasty. Clin Orthop 229:221–227, 1988.
42. Kuznetsov SA, Krebsbach PH, Satomura K, et al: Single-colony derived strains of human marrow stromal fibroblasts form bone after transplantation in vivo. J Bone Miner Res 12:1335–1347, 1997.
43. Lee CR, Grodzinsky AJ, Hsu HP, et al: Effects of harvest and selected cartilage repair procedures on the physical and biochemical properties of articular cartilage in the canine knee. J Orthop Res 18:790–799, 2000.
44. Murakami S, Muneta T, Ezura Y, et al: Quantitative analysis of synovial fibrosis in the infrapatellar fat pad before and after anterior cruciate ligament reconstruction. Am J Sports Med 25:29–34, 1997.
45. Murakami S, Muneta T, Furuya K, et al: Immunohistologic analysis of synovium in infrapatellar fat pad after anterior cruciate ligament injury. Am J Sports Med 23:763–768, 1995.
46. Nakahara H, Bruder SP, Goldberg VM, Caplan AI: In vivo osteochondrogenic potential of cultured cells derived from the periosteum. Clin Orthop 259:223–232, 1990.
47. Nakahara H, Bruder SP, Haynesworth SE, et al: Bone and cartilage formation in diffusion chambers by subcultured cells derived from the periosteum. Bone 11:181–188, 1990.
48. Nakahara H, Dennis JE, Bruder SP, et al: In vitro differentiation of bone and hypertrophic cartilage from periosteal-derived cells. Exp Cell Res 195:492–503, 1991.
49. Nishida S, Endo N, Yamagiwa H, et al: Number of osteoprogenitor cells in human bone marrow markedly decreases after skeletal maturation. J Bone Miner Metab 17:171–177, 1999.
50. Nuttall ME, Gimble JM: Is there a therapeutic opportunity to either prevent or treat osteopenic disorders by inhibiting marrow adipogenesis? Bone 27:177–184, 2000.
51. Nuttall ME, Patton AJ, Olivera DL, et al: Human trabecular bone cells are able to express both osteoblastic and adipocytic phenotype: Implications for osteopenic disorders. J Bone Miner Res 13:371–382, 1998.
52. Oreffo RO, Triffitt JT: Future potentials for using osteogenic stem cells and biomaterials in orthopedics. Bone 25:5S–9S, 1999.
53. Owen M: Marrow stromal stem cells. J Cell Sci 10(Suppl):63–76, 1988.
54. Park SR, Oreffo RO, Triffitt JT: Interconversion potential of cloned human marrow adipocytes in vitro. Bone 24:549–554, 1999.
55. Pittenger MF, Mackay AM, Beck SC, et al: Multilineage potential of adult human mesenchymal stem cells. Science 284:143–147, 1999.
56. Pittenger MF, Mosca JD, McIntosh KR: Human mesenchymal stem cells: Progenitor cells for cartilage, bone, fat and stroma. Curr Top Microbiol Immunol 251:3–11, 2000.
57. Rahfoth B, Weisser J, Sternkopf F, et al: Transplantation of allograft chondrocytes embedded in agarose gel into cartilage defects of rabbits. Osteoarthritis Cartilage 6:50–65, 1998.
58. Richmond JC, al Assal M: Arthroscopic management of arthrofibrosis of the knee, including infrapatellar contraction syndrome. Arthroscopy 7:144–147, 1991.
59. Ries MD, Badalamente M: Arthrofibrosis after total knee arthroplasty. Clin Orthop 380:177–183, 2000.
60. Saladin R, Fajas L, Dana S, et al: Differential regulation of peroxisome proliferator activated receptor gamma1 (PPARgamma1) and PPARgamma2 messenger RNA expression in the early stages of adipogenesis. Cell Growth Differ 10:43–48, 1999.
61. Sen A, Lea-Currie YR, Sujkowska D, et al: Adipogenic potential of human adipose derived stromal cells from multiple donors is heterogeneous. J Cell Biochem 81:312–319, 2001.
62. Sledge SL: Microfracture techniques in the treatment of osteochondral injuries. Clin Sports Med 20:365–377, 2001.
63. Steadman JR, Rodkey WG, Rodrigo JJ: Microfracture: Surgical technique and rehabilitation to treat chondral defects. Clin Orthop 391(Suppl):S362–S369, 2001.
64. Vescovi AL, Galli R, Gritti A: The neural stem cells and their transdifferentiation capacity. Biomed Pharmacother 55:201–205, 2001.
65. Wakitani S, Goto T, Pineda SJ, et al: Mesenchymal cell-based repair of large, full-thickness defects of articular cartilage. J Bone Joint Surg 76A:579–592, 1994.
66. Wakitani S, Goto T, Young RG, et al: Repair of large full-thickness articular cartilage defects with allograft articular chondrocytes embedded in a collagen gel. Tissue Eng 4:429–444, 1998.
67. Walsh CJ, Goodman D, Caplan AI, Goldberg VM: Meniscus regeneration in a rabbit partial meniscectomy model. Tissue Eng 5:327–337, 1999.
68. Yoo JU, Barthel TS, Nishimura K, et al: The chondrogenic potential of human bone-marrow-derived mesenchymal progenitor cells. J Bone Joint Surg 80A:1745–1757, 1998.
69. Young HE, Mancini ML, Wright RP, et al: Mesenchymal stem cells reside within the connective tissues of many organs. Dev Dyn 202:137–144, 1995.
70. Young HE, Steele TA, Bray RA, et al: Human reserve pluripotent mesenchymal stem cells are present in the connective tissues of skeletal muscle and dermis derived from fetal, adult, and geriatric donors. Anat Rec 264:51–62, 2001.
71. Young RG, Butler DL, Weber W, et al: Use of mesenchymal stem cells in a collagen matrix for Achilles tendon repair. J Orthop Res 16:406–413, 1998.
72. Zuk PA, Zhu M, Mizuno H, et al: Multilineage cells from human adipose tissue: Implications for cell-based therapies. Tissue Eng 7:211–228, 2001.
© 2003 Lippincott Williams & Wilkins, Inc.