Journal Logo

Original Article

LncRNA Gm4419 Regulates Myocardial Ischemia/Reperfusion Injury Through Targeting the miR-682/TRAF3 Axis

Zhao, Guixiang BA*; Hailati, Juledezi PhD; Ma, Xiaoyun MD; Bao, Zhen PhD; Bakeyi, Maerjiaen MM; Liu, Zhiqiang MD

Author Information
Journal of Cardiovascular Pharmacology: September 2020 - Volume 76 - Issue 3 - p 305-312
doi: 10.1097/FJC.0000000000000867
  • Open

Abstract

INTRODUCTION

Acute myocardial infarction (AMI) is a fatal cardiovascular disease in the world. It is characterized by interruption of blood supply in coronary arteries, resulting in myocardial injury.1,2 I/R injury incites an inflammatory response by promoting the release of cytokines3 and oxygen free radicals,4,5 which promotes apoptosis of myocardial cells and induces injury.6–8 Therefore, elucidation of key mechanisms for the prevention of myocardial I/R injury is paramount for improving the outcome of AMI.

Myocardial ischemia/reperfusion-induced tissue injury involves apoptosis-induced cell death and oxidative stress.9 In addition, studies have shown that the decreased myocardial apoptosis can alleviate myocardial ischemia/reperfusion injury and improved postischemic cardiac function.10–13 Moreover, studies have also shown that oxidative stress plays a pivotal role in ischemia/reperfusion-induced tissue injury, whereas inhibiting oxidative stress can significant reduce the ischemia/reperfusion injury.14–16 Strategies that prevent apoptosis-induced cell death and oxidative stress are effective with respect to reducing myocardial I/R injury.

Long noncoding RNAs (lncRNAs) cannot act as templates for protein synthesis because of the lack of open reading frames, but multiple lncRNAs contribute to several cardiovascular diseases.17–19 For example, lncRNA autophagy promoter has been proved to promote myocardial infarction.20 LncRNA ZFAS1 and CDR1-AS1 have been demonstrated to be dysregulated in patients with AMI.21 LncRNA KCNQ1OT1 has been identified to promote myocardial I/R injury after AMI.22 Studies have shown that the LncRNA Gm4419 level is increased in diabetic nephropathy patients' serum, and the elevated serum Gm4419 level is associated with occurrence of coronary heart disease and stroke, and poor renal function and heart function, which will contribute to the development of heart disease in patients with diabetic nephropathy.23,24 Gm4419 knockdown improved the inflammation of NF-κB/NLRP3-mediated diabetic nephropathy.23 Wen et al25 found that Gm4419 was involved in H/R injury of brain microglia through IkB phosphorylation and NF-κB activation. However, the role and potential mechanism of Gm4419 in myocardial I/R injury remains unknown.

In the current study, miRDB provided prediction that Gm4419 could target miR-682. Interestingly, miR-682 has been proven to ameliorate intestinal ischemia-reperfusion injury.26 In addition, TargetScan predicted that miR-682 could target tumor necrosis factor receptor-associated factor 3 (TRAF3). Targeting TRAF3 protects tissue damage induced by ischemia-reperfusion.27–29 This study mainly explored the effect of LncRNA Gm4419 on myocardial I/R injury through the miR-682/TRAF3 axis.

MATERIALS AND METHODS

Animals and Cell Culture

6–8-week-old SD female rats, obtained from SAGE Laboratories (St. Louis, MO), were kept in clean cages and free to water and food ad libitum. Rat cardiomyocyte H9C2, obtained from the cell bank of Shanghai Institute of Biology, Chinese Academy of Sciences, were cultured in high-glucose DMEM medium with 10% fetal bovine serum and 1% Penicillin-streptomycin, and placed in a constant temperature incubator at 37°C with 5% CO2.

Establishment of SD Rat Myocardial I/R Injury Model and H/R Cell Model

The current study was approved by the Ethics Committee of the Sixth Affiliated Hospital of Xinjiang Medical University (Approval no. 2017049). Rats were anaesthetized with 3% pentobarbital sodium (intraperitoneal injection). Rats received surgery beneath the left anterior descending branch (LAD), and were injected with saline into jugular vein before the LAD was occluded for 10 minutes. The LAD of sham control was not ligated. After reperfusion, fresh hearts were collected and cut into 1-mm slices.

Hypoxia/reoxygenation (H/R) H9C2 cell model was established by the following procedure: (1) H9C2 cells were cultured overnight in serum-free minimum medium containing 30 mM glucose and 1% fetal bovine serum. (2) The H9C2 cells were then kept for 4 hours at 37°C in a constant temperature incubator with 95% N2, 1% O2 and 5% CO2 to establish hypoxia environment. The plates were moved to the normoxic chamber for 2 hours to establish reoxygenation.

TTC Staining

The myocardium sections were first stained with 2,3,5-triphenyltetrazolium chloride (TTC; Sigma) and fixed with 4% paraformaldehyde, then the infarct size of myocardium was measured. The infarct size (white-unstained necrotic tissue) was calculated as a percentage of left ventricular area. In brief, the tissue sections were placed in bright light and photographed with a Nikon COOLPIX A900 digital camera. The infarct size (%) was calculated by the microscopic color image processing system (DpxView Pro, Korea) with the following formula: infarct sizes (%) = myocardial infarction area/left ventricular area ×100.

Cell Transfection

The sh-Gm4419, miR-682 mimics, and miR-682 inhibitor used in this study were obtained from Ribobio (Guangzhou, China). The pcDNA 3.1 vector was obtained from Invitrogen Corp (San Diego, CA). Briefly, the H9C2 cells were cultured in 6-well plates with a cell density of 1 × 104 cells/mL. After incubation for 24 hours, cells were transfected with 50 nM sh-GM4419, miR-682 mimics or miR-682 inhibitor using Lipofectamine 3000 (Invitrogen) according to the manufacture's protocols. The scrambled control shRNA (NC shRNAs), miRNA inhibitor control (NC inhibitor), and miRNA control (NC mimics) were used as negative controls.

Quantitative Real-time PCR (qPCR)

Total RNAs were extracted from cultured cells and frozen tissues using TRIzol reagent (Invitrogen, Carlsbad, CA) according to standard protocol. Reverse transcription was conducted with the SuperScript Reverse Transcriptase Kit (Vazyme, Nanjing, China). qPCR was conducted by SuperScript III Platinum SYBR Green One-Step qPCR kit (Thermo Fisher Scientific) in the Fast Real-time PCR 7300 System (Applied Biosystems, Foster City, CA). The following primers were used for the qPCR: Gm4419 forward, 5′- GGAACCAAGCAGACCGAAGAC -3′ and reverse, 5′- CCCCAACCCACAGGAACATAA -3′; β-actin forward, 5′-GACCTCTATGCCAACACAGT-3′ and reverse, 5-AGTACTTGCGCTCAGGAGG-3′. The Gm4419 expression level was calculated using the comparative Ct method and the 2−ΔΔCT method. Relative expression of GM4419 was normalized to β-actin.

Flow Cytometry Assay

H9C2 cells in each group were treated with Cisplatin at the concentration of 25 mol/mL and cultured at 37°C for 4 days. Cells were collected and a suspension with a cell density of approximately 1 × 106/mL was prepared by 1 w Annexin V Binding Solution. 100 μL suspension was mixed with 5 μL Annexin V—fluorescein isothiocyanate (FITC) and 5 μL Propidium Iodide for 15 minutes at 25°C away from light. 400 μL 1 × Annexin Vl Binding Solution was then added. The stained cells were processed by flow cytometry. Finally, BD FACSuite software was used to plot and count the number of apoptotic cells in the Q2+Q4 region.

CCK-8

The H9C2 cells were collected after culture for 48 hours. First, CCK-8 solution was diluted to 10% with medium, and then the cells were made into 1 × 106/mL cell suspension with the above solution. Then, the cells were incubated at 37°C for 1–4 hours. Finally, the light absorption value was detected at 450 nm, and the cell proliferation multiple was calculated.

ELISA

The concentration of inflammatory cytokines in serum/myocardial tissue homogenate including IL-6, IL-1β, TNF-α, and MCP-1 were assayed using commercially available ELISA kits (BD Biosciences) according to standard protocols. All sample were performed in duplicate. In addition, the absorbance was determined at 450 nm with a microplate reader. The standard curve was generated by measuring the gradient concentration of the standard product provided by the kit. The positive control and the blank control were analyzed simultaneously on the same 96-well plate.

LDH Activity Assay

The LDH activity was measured by the commercially available kit from Nanjing Jiancheng bioengineering institute (Nanjing, China) according to standard protocols.

Luciferase Activity Assay

GM4419/TRAF3 sequence containing predicted miR-682 binding site or GM4419/TRAF3 mutant sequence were amplified and inserted into pRL-TK vector, (Promega) by PCR. Then, vectors and miR-682 mimics were transfected into H9C2 cells by Lipofectamine 3000 regent alone or together. After culture for 48 hours, the luciferase activities were detected by a dual-luciferase reporter system (Promega) based on the manufacturer's protocols. Luciferase activity was normalized to Renilla activity.

Terminal Deoxynucleotidyl Transferase-Mediated dUTP Nick End-Labeling Assay

Apoptosis was detected by an In Situ Cell Death Detection Kit-POD (Roche, Germany) in myocardial tissue slices (4 μm). The slices were treated with TUNEL reagent for 60 minutes after 15 minutes protease K (10 mmol/L) treatment. Then, the slices were incubated in DAPI for 30 minutes. Finally, the images were evaluated to measure percentage of TUNEL-positive cells (apoptosis rate).

Western Blot

First, the tissues and cultured cells in each group were washed 3 times with PBS, then, cell lysis buffer containing protease inhibitor (cocktail) was added for total protein extraction. The same amount of protein samples (40 μg) was extracted and denatured at 100°C for 5 minutes. SDS-PAGE gel electrophoresis was then performed to separate proteins. Then proteins were next transferred to PVDF membrane. After blocking with 5% BSA at room temperature for 1–2 hours, the corresponding primary antibodies including: anti-TRAF3 antibody (ab36988, Abcam, Cambridge, UK; 1:1000), anti-β-actin antibody (ab228001, Abcam; 1:5000), anti-Cleaved Caspase-3 antibody (ab2302, Abcam; 1:2000), and anti-cleaved PARP1 antibody (ab32064, Abcam; 1:5000) were added and incubated for 12 hours at 4°C. Next, horseradish peroxidase-labeled secondary antibody was added after washing, incubated at room temperature for 1 hour, and then washed. Finally, the luminescent solution was added, and the exposure was taken in the gel imager, and the gray value was measured by Image J software to determine the relative expression. GAPDH was used as the reference for the loading volume and at least 3 independent experiments were conducted.

RNA Pull-Down Assay

Biotin labeled Gm4419 RNA and miR-682 RNA were obtained from RiboBio (Guangzhou, China). 50 pmol biotinylated Gm4419 RNA and miR-682 RNA were incubated with 50 μL prewashed streptavidin-agarose beads (Invitrogen) for 1 hour at 4°C. Then, RNA-bound beads were incubated with lysates from H9C2 cell cytosolic/nuclear extracts. The relative enrichment of RNA present in the pull-down material was quantified by qPCR.

Statistical Analysis

All experiments were conducted 3 times at least (n = 3). All the comparative data of this study were statistically analyzed by SPSS 17.0 software, and the one-way ANOVA analysis and Turkey's post-hoc test were used for pairwise comparison. P < 0.01 was considered statistically significant.

RESULTS

LncRNA Gm4419 Knockdown Alleviated I/R Injury in Rats

To investigate the effect of lncRNA Gm4419 in I/R injury in vivo, I/R rat model was established. In addition, Gm4419 sh-RNA (shRNA) in I/R rat were constructed. Gm4419 was significantly upregulated in the I/R rat (Fig. 1A, P < 0.01). Gm4419 was successfully knocked down by shRNA1# and shRNA2# in I/R rat model, whereas shNC showed no effect compared with the I/R group (Fig. 1A, P > 0.05). TTC staining showed that the infarction area was enlarged in the I/R group compared with control. Interestingly, the infarction area was conspicuously smaller in the shRNA1# and shRNA2# group compared with the I/R + shNC group (Fig. 1B, P < 0.01). Moreover, the LDH level was elevated in the I/R group compared with the control group, whereas significantly reduced in shRNA1# and shRNA2# compared with the I/R + shNC group (Fig. 1C, P < 0.01). Furthermore, TUNEL-positive cells (apoptotic) were increased in the I/R group compared with the control group, whereas dramatically reduced in the shRNA1# and shRNA2# group compared with the I/R + shNC group (Fig. 1D, P < 0.01). Taken together, these results suggested that Gm4419 knockdown alleviated I/R injury and Gm4419 may be a therapeutic target for I/R injury.

FIGURE 1.
FIGURE 1.:
LncRNA Gm4419 knockdown alleviated I/R injury in rats. SD rats were divided into 5 groups: (1) Sham, (2) I/R, (3) I/R +shNC, (4) I/R +shRNA1#; (5) I/R +shRNA2#; (A) The relative Gm4419 level in myocardial tissue was measured by qPCR. B, The myocardial infarction area was detected by TTC staining. C, The LDH activity was determined by a commercially available kit. D, Apoptosis in myocardial tissue was detected by TUNEL assay. **Represent P < 0.01, n = 3.

LncRNA Gm4419 Knockdown Alleviated H/R Injury in H9C2 Cells

To verify the role of lncRNA Gm4419 in I/R injury in vitro, H/R H9C2 cell model was established. Similar to in vivo results, Gm4419 was significantly upregulated in H/R H9C2 cells (Fig. 2A, P < 0.01). Gm4419 was knocked down by shRNA1# and shRNA2# in H/R H9C2 cells (Fig. 2A, P < 0.01), whereas shNC showed no change compared with the H/R group (Fig. 2A, P > 0.05). Interestingly, the CCK-8 results showed that cell viability was decreased in the H/R group compared with control, whereas shRNA1# and shRNA2# increased cell viability compared with H/R +shNC group (Fig. 2B, P < 0.01). Moreover, the LDH level was elevated in H/R group compared with control, whereas shRNA1# and shRNA2# significantly decreased the LDH level compared with the H/R +shNC group (Fig. 2C, P < 0.01). Furthermore, flow cytometry result showed that apoptosis was increased in H/R group compared with control, whereas shRNA1# and shRNA2# dramatically reduced apoptotic cells compared with the H/R +shNC group (Fig. 2D, P < 0.01). These results indicated that Gm4419 knockdown alleviated H/R injury in vitro.

FIGURE 2.
FIGURE 2.:
LncRNA Gm4419 knockdown alleviated H/R injury in H9C2 cells. H9C2 cells were divided into 5 groups: (1) Control, (2) H/R, (3) H/R +shNC, (4) H/R +shRNA1#; (5) H/R +shRNA2#; (A) The relative Gm4419 level in H9C2 cells was measured by qPCR. B, Cell viability of H9C2 cells was detected by TTC staining. C, The LDH activity of H9C2 cells was determined by commercially available kit. D, Apoptosis of H9C2 cells was analyzed by flow cytometry assay. **Represent P < 0.01, n = 3.

LncRNA Gm4419 Knockdown Alleviated Inflammation Induced by I/R

Inflammation plays an essential role in I/R injury. Therefore, we measured levels of inflammatory cytokines including IL-6, IL-1β, TNF-α and MCP-1 in rat serum and H9C2 cells. IL-6, IL-1β, TNF-α and MCP-1 levels were elevated in I/R group compared with control, whereas shRNA1# and shRNA2# significantly decreased the levels of inflammatory cytokines compared with the I/R +shNC group (Figs. 3A–D, P < 0.01). In vitro, cells showed similar results. IL-6, IL-1β, TNF-α and MCP-1 levels were elevated in in H/R group compared with control, whereas shRNA1# and shRNA2# significantly decreased the inflammatory cytokines levels compared with the H/R +shNC group (Figs. 3E–H, P < 0.01). These results indicated that Gm4419 knockdown reduced the release of pro-inflammatory cytokines.

FIGURE 3.
FIGURE 3.:
LncRNA Gm4419 knockdown alleviated inflammation induced by I/R. SD rats were divided into 5 groups: (1) Sham, (2) I/R, (3) I/R +shNC, (4) I/R +shRNA1#; (5) I/R +shRNA2#; (A–D) The concentration of IL-6, IL-1β, TNF-α, and MCP-1 in serum was determined by ELISA assay. H9C2 cells were divided into 5 groups: (1) Control, (2) H/R, (3) H/R +shNC, (4) H/R +shRNA1#; and (5) H/R +shRNA2#; (E–H) The concentration of IL-6, IL-1β, TNF-α and MCP-1 in myocardial tissue homogenate was determined by ELISA assay. **Represent P < 0.01, n = 3.

LncRNA Gm4419 Targeted miR-682

To explore the mechanism of the regulation of I/R injury by Gm4419, we used the miRDB (http://mirdb.org/) prediction website to identify the microRNA target of Gm4419. As shown in Figure 4A, wild-type Gm4419 (Gm4419wt) is complementary to the 5′ end of miR-682. Luciferase activity assay and qPCR were performed to verify the interaction between miR-682 and Gm4419. Co-transfection of Gm4419wt and miR-682 mimics significantly reduced the relative luciferase activity compared with transfection of Gm4419wt alone. On the other hand, co-transfection of Gm4419 mut and miR-682 mimics did not reduce the luciferase activity compared with transfection of Gm4419mut alone (Fig. 4B). Moreover, overexpression of Gm4419 (pc-DNA3.1 Gm4419) markedly increased the relative enrichment of miR-682 compared with pc-DNA3.1 (Fig. 4C), whereas Gm4419 knockdown (shRNA1# and shRNA2#) significantly increased the expression of miR-682 compared with H/R + shNC group (Fig. 4D, P < 0.01). Importantly, miR-682 was downregulated in H/R group compared with control (Fig. 4D, P < 0.01). Taken together, these results indicated that miR-682 may be a target of Gm4419.

FIGURE 4.
FIGURE 4.:
LncRNA Gm4419 targeted miR-682. A, Target prediction was performed in miRDB (http://mirdb.org/) prediction website. B, The target relationship between Gm4419 and miR-682 was verified by luciferase activity assay. C, H9C2 cells were grouped into: Gm4419-wt +NC mimics; Gm4419-wt +miR-682 mimics; RNA pulldown assay was conducted to determine the relative enrichment of miR-682. D, H9C2 cells were grouped into: Gm4419-mut +NC mimics; Gm4419-mut +miR-682 mimic. The relative miR-682 level was measured by qPCR. **Represent P < 0.01, n = 3.

TRAF3 was Identified as a Target Gene of miR-682

To clarify the mechanism through which Gm4419/miR-682 regulates I/R injury, we used the TargetScan website (http://www.targetscan.org/vert_71/) to predict the target gene of miR-682. As shown in Figure 5A, the 3′- end of wild-type TRAF3 (TRAF3wt) is complementary to the 5′ end of miR-682. Luciferase activity assay and qPCR were performed to verify the interaction between miR-682 and TRAF3. Co-transfection of TRAF3wt and miR-682 mimics significantly reduced the relative luciferase activity compared with transfection of TRAF3 alone. On the other hand, co-transfection of TRAF3 mut and miR-682 mimics did not reduce the luciferase activity compared with transfection of TRAF3 mut alone (Fig. 5B). Moreover, overexpression of miR-682 (miR-682 mimics) significantly reduced the mRNA expression of TRAF3 compared with NC mimics, while miR-682 inhibitor significantly increased TRAF3 mRNA expression compared with NC inhibitor (Fig. 5C, P < 0.01). In addition, miR-682 mimics significantly reduced the TRAF3 protein expression compared with NC mimics, whereas miR-682 inhibitor significantly increased TRAF3 protein expression compared with NC inhibitor (Fig. 5D, P < 0.01). Importantly, TRAF3 protein level was downregulated in shRNA2#+ NC inhibitor group compared with shNC+ NC inhibitor, whereas this downregulation induced by shRNA2# could be counteracted by miR-682 inhibitor (Fig. 5E, P < 0.01). Taken together, these results indicated that TRAF3 may be a target of miR-682.

FIGURE 5.
FIGURE 5.:
TRAF3 was identified as a target gene of miR-682. A, Target prediction was performed in TargetScan (http://www.targetscan.org/vert_71/) prediction website. B, The target relationship between miR-682 and TRAF3 was verified by luciferase activity assay. C, The relative miR-682 level was measured by qPCR. D–E, The relative TRAF3 protein level of TRAF3 was measured by western blot. **Represent P < 0.01, n = 3.

LncRNA Gm4419 regulated TRAF3 expression via miR-682, thereby regulating H/R-induced injury and inflammatory response.

As depicted in Figure 6A, cell viability was reduced by H/R, whereas shRNA2 significantly restored cell viability. TRAF3 overexpression abolished the protective role of Gm4419 shRNA. In addition, levels of LDH, TRAF3/cleaved caspase-3 and PARP, and pro-inflammatory cytokines (IL-6, IL-1β, TNF-α and MCP-1) were increased in H/R, whereas shRNA2 significantly reduced these levels (Figs. 6B–G). As expected, the combination treatment of Gm4419 shRNA and TRAF3 overexpression showed a subdued neutralizing effect. These results indicated that LncRNA Gm4419 regulated TRAF3 expression via miR-682, thereby regulating H/R-induced injury and inflammatory response.

FIGURE 6.
FIGURE 6.:
LncRNA Gm4419 regulated TRAF3 expression via miR-682, thereby regulating H/R-induced injury and inflammatory response. H9C2 cells were divided into 4 groups: (1) Control, (2) H/R, (3) H/R +shRNA2#, and (4) H/R +shRNA2#+TRAF3; (A) Cell viability of H9C2 cells was detected by CCK-8 assay. B, The LDH activity was determined by commercially available kit. C, The relative protein levels were measured by western blot. D–G, The concentration of IL-6, IL-1β, TNF-α and MCP-1 in myocardial tissue homogenate was determined by ELISA assay. **Represent P < 0.01, n = 3.

DISCUSSION

AMI is the common cause of death among cardiovascular patients worldwide.30 Myocardial reperfusion is an effective therapy for AMI patients. However, blood stream reperfusion induces I/R injury,31 thus leading to the increased mortality in AMI patients.32 In the current study, we found that LncRNA Gm4419 knockdown may contribute to reduce the myocardial I/R injury in rats and the H/R injury in H9C2 cells. As a matter of fact, the Gm4419/miR-682/TRAF3 axis modulated apoptosis and inflammation in I/R injury. We examined the markers of myocardial injury—LDH and typical inflammatory factors to further verify the contribution of Gm4419 in I/R injury.

LncRNA Gm4419 has been discovered to contribute to OGD/R-induced injury of cerebral microglial cells.25 Besides, Gm4419 was involved in H/R injury of brain microglia.25 The previous studies indicate that Gm4419 knockdown alleviates cerebral I/R injury. Therefore, we hypothesized that Gm4419 knockdown may alleviate myocardial I/R injury in rats and H/R injury in H9C2 cells. Our present study supports this hypothesis. In this study, we showed that Gm4419 was upregulated in I/R myocardial tissues and H/R H9C2 cells. Moreover, Gm4419 knockdown decreased the myocardial infarction area, apoptosis rate, and inflammatory cytokines. We also investigated the underlying mechanisms.

In PubMed, very few studies related to miR-682 were reported. One article proved that miR-682 ameliorates intestinal I/R injury in intestinal epithelial cells.26 Until now, the role of miR-682 on the regulation of myocardial I/R has not been studied well. We first found that miR-682 could interact with Gm4419. The result indicated that miR-682 has an effect inverse to the lncRNA Gm4419 as far as cardiac I/R injury is concerned, which is consistent with the previous study. lncRNA Gm4419 has also been shown to affect other miRNAs, by means of sponging, such as miR-4661 and subsequently TNF-related cell injury as detailed for traumatic brain injury.33 Similar to the previous publications26,33 investigating other targets of Gm4419, miR-682 may represent a more pertinent target with respect to cell injury.

TRAF3 has already been confirmed to be involved in various biological activities. Numerous studies have reported the contribution of TRAF3 in I/R injury including hepatic I/R injury,27 intestinal I/R injury,34 cerebral I/R injury,28 and myocardial I/R injury.29,35 These studies indicate that inhibiting the expression of TRAF3 could reduce I/R injury.

Our study first revealed the interaction both between miR-682/TRAF3 and Gm4419/miR-682. TRAF3 overexpression counteracted the effect of Gm4419 knockdown in the levels of myocardial infarction, apoptosis rate, and inflammatory cytokines. These results indicated that Gm4419 and TRAF3 may be contributors to I/R injury, whereas miR-682 may be a suppressor of I/R injury. Most importantly, Gm4419 modulated the I/R injury via targeting the miR-682/TRAF3 axis.

In summary, our study indicates that LncRNA Gm4419 regulates myocardial I/R injury through targeting the miR-682/TRAF3 axis. Our study also suggests that both LncRNA Gm4419 and TRAF3 may be therapeutic targets for AMI, whereas increasing miR-682 expression may help alleviate I/R injury.

REFERENCES

1. Boersma E, Mercado N, Poldermans D, et al. Acute myocardial infarction. Lancet. 2003;361:847–858.
2. Adameova AD, Bhullar SK, Elimban V, et al. Activation of β1-adrenoceptors may not be involved in arrhythmogenesis in ischemic heart disease. Rev Cardiovasc Med. 2018;19:97–101.
3. Manning AS, Hearse DJ. Reperfusion-induced arrhythmias: mechanisms and prevention. J Mol Cell Cardiol. 1984;16:497–518.
4. Hess ML, Manson NH. Molecular oxygen: friend and foe. The role of the oxygen free radical system in the calcium paradox, the oxygen paradox and ischemia/reperfusion injury. J Mol Cell Cardiol. 1984;16:969–985.
5. Hearse DJ, Tosaki A. Free radicals and calcium: simultaneous interacting triggers as determinants of vulnerability to reperfusion-induced arrhythmias in the rat heart. J Mol Cell Cardiol. 1988;20:213–223.
6. Wu MY, Yiang GT, Liao WT, et al. Current mechanistic concepts in ischemia and reperfusion injury. Cell Physiol Biochem. 2018;46:1650–1667.
7. Bartekova M, Jelemensky M, Dhalla NS. Emerging role of non-coding RNAs and extracellular vesicles in cardioprotection by remote ischemic conditioning of the heart. Rev Cardiovasc Med. 2019;20:59–71.
8. Tosaki A, Braquet P. DMPO and reperfusion injury: arrhythmia, heart function, electron spin resonance, and nuclear magnetic resonance studies in isolated working guinea pig hearts. Am Heart J. 1990;120:819–830.
9. Vakeva AP, Agah A, Rollins SA, et al. Myocardial infarction and apoptosis after myocardial ischemia and reperfusion: role of the terminal complement components and inhibition by anti-C5 therapy. Circulation. 1998;97:2259–2267.
10. Ma XL, Kumar S, Gao F, et al. Inhibition of p38 mitogen-activated protein kinase decreases cardiomyocyte apoptosis and improves cardiac function after myocardial ischemia and reperfusion. Circulation. 1999;99:1685–1691.
11. Mocanu MM, Baxter GF, Yellon DM. Caspase inhibition and limitation of myocardial infarct size: protection against lethal reperfusion injury. Br J Pharmacol. 2000;130:197–200.
12. Kovacs P, Bak I, Szendrei L, et al. Non-specific caspase inhibition reduces infarct size and improves post-ischaemic recovery in isolated ischaemic/reperfused rat hearts. Naunyn Schmiedebergs Arch Pharmacol. 2001;364:501–507.
13. Cheng Y, Zhu P, Yang J, et al. Ischaemic preconditioning-regulated miR-21 protects heart against ischaemia/reperfusion injury via anti-apoptosis through its target PDCD4. Cardiovasc Res. 2010;87:431–439.
14. Zhang T, Zhang Y, Cui M, et al. CaMKII is a RIP3 substrate mediating ischemia- and oxidative stress-induced myocardial necroptosis. Nat Med. 2016;22:175–182.
15. Barta T, Tosaki A, Haines D, et al. Endothelin-1-induced hypertrophic alterations and heme oxygenase-1 expression in cardiomyoblasts are counteracted by beta estradiol: in vitro and in vivo studies. Naunyn Schmiedebergs Arch Pharmacol. 2018;391:371–383.
16. Del Re DP, Amgalan D, Linkermann A, et al. Fundamental mechanisms of regulated cell death and implications for heart disease. Physiol Rev. 2019;99:1765–1817.
17. Uchida S, Dimmeler S. Long noncoding RNAs in cardiovascular diseases. Circ Res. 2015;116:737–750.
18. Bär C, Chatterjee S, Thum T. Long noncoding RNAs in cardiovascular pathology, diagnosis, and therapy. Circulation. 2016;134:1484–1499.
19. Mazidi M, Penson P, Gluba-Brzozka A, et al. Relationship between long noncoding RNAs and physiological risk factors of cardiovascular disease. J Clin Lipidol. 2017;11:617–623.
20. Wang K, Liu CY, Zhou LY, et al. APF lncRNA regulates autophagy and myocardial infarction by targeting miR-188-3p. Nat Commun. 2015;6:6779.
21. Zhang Y, Sun L, Xuan L, et al. Reciprocal changes of circulating long non-coding RNAs ZFAS1 and CDR1AS predict acute myocardial infarction. Sci Rep. 2016;6:22384.
22. Li X, Dai Y, Yan S, et al. Down-regulation of lncRNA KCNQ1OT1 protects against myocardial ischemia/reperfusion injury following acute myocardial infarction. Biochem Biophys Res Commun. 2017;491:1026–1033.
23. Yi H, Peng R, Zhang LY, et al. LincRNA-Gm4419 knockdown ameliorates NF-κB/NLRP3 inflammasome-mediated inflammation in diabetic nephropathy. Cell Death Dis. 2017;8:e2583.
24. Li H, Wu P, Sun D, et al. LncRNA-Gm4419 alleviates renal damage in rats with diabetic nephropathy through NF-κB pathway. Panminerva Med. 2020. doi: 10.23736/S20031-20808.23719.03844-23738.
25. Wen Y, Yu Y, Fu X. LncRNA Gm4419 contributes to OGD/R injury of cerebral microglial cells via IκB phosphorylation and NF-κB activation. Biochem Biophys Res Commun. 2017;487:923–929.
26. Liu Z, Jiang J, Yang Q, et al. MicroRNA-682-mediated downregulation of PTEN in intestinal epithelial cells ameliorates intestinal ischemia-reperfusion injury. Cell Death Dis. 2016;7:e2210.
27. Hu J, Zhu XH, Zhang XJ, et al. Targeting TRAF3 signaling protects against hepatic ischemia/reperfusions injury. J Hepatol. 2016;64:146–159.
28. Yao S, Tang B, Li G, et al. miR-455 inhibits neuronal cell death by targeting TRAF3 in cerebral ischemic stroke. Neuropsychiatr Dis Treat. 2016;12:3083–3092.
29. Liu X, Zhang L, Qin H, et al. Inhibition of TRAF3 expression alleviates cardiac ischemia reperfusion (IR) injury: a mechanism involving in apoptosis, inflammation and oxidative stress. Biochem Biophys Res Commun. 2018;506:298–305.
30. LEE YH, LEE DK, SHIN DH, et al. I-gel as a first-line airway device in the emergency room for patients with out-of-hospital cardiac arrest. Anaesth Intensive Care Med. 2018;14:61–65.
31. Aghaei M, Motallebnezhad M, Ghorghanlu S, et al. Targeting autophagy in cardiac ischemia/reperfusion injury: a novel therapeutic strategy. J Cell Physiol. 2019;234:16768–16778.
32. Maneechote C, Palee S, Chattipakorn SC, et al. Roles of mitochondrial dynamics modulators in cardiac ischaemia/reperfusion injury. J Cell Mol Med. 2017;21:2643–2653.
33. Yu Y, Cao F, Ran Q, et al. Long non-coding RNA Gm4419 promotes trauma-induced astrocyte apoptosis by targeting tumor necrosis factor α. Biochem Biophys Res Commun. 2017;491:478–485.
34. Dai Y, Mao Z, Han X, et al. MicroRNA-29b-3p reduces intestinal ischaemia/reperfusion injury via targeting of TNF receptor-associated factor 3. Br J Pharmacol. 2019;176:3264–3278.
35. Erikson JM, Valente AJ, Mummidi S, et al. Targeting TRAF3IP2 by genetic and interventional approaches inhibits ischemia/reperfusion-induced myocardial injury and adverse remodeling. J Biol Chem. 2017;292:2345–2358.
Keywords:

acute myocardial infarction; Gm4419; miR-682; TRAF3

Copyright © 2020 The Author(s). Published by Wolters Kluwer Health, Inc.