Secondary Logo

Journal Logo

Preventive Effect of TRPV1 Agonists Capsaicin and Resiniferatoxin on Ischemia/Reperfusion-induced Renal Injury in Rats

Ueda, Kyoko MS*; Tsuji, Fumio PhD; Hirata, Tomoko MS*; Takaoka, Masanori PhD*; Matsumura, Yasuo PhD*

Journal of Cardiovascular Pharmacology: May 2008 - Volume 51 - Issue 5 - p 513-520
doi: 10.1097/FJC.0b013e31816f6884
Original Article
Free

We evaluated the effect of capsaicin, one of the transient receptor potential vanilloid receptor 1 (TRPV1) agonists, on ischemic acute renal failure (ARF) in rats. Ischemic ARF was induced by occlusion of the left renal artery and vein for 45 minutes followed by reperfusion, 2 weeks after contralateral nephrectomy. Renal function in vehicle-treated ARF rats markedly decreased at 24 hours after reperfusion. Treatment with capsaicin (3, 10, and 30 mg/kg, orally) 30 minutes before ischemia dose-dependently attenuated ischemia/reperfusion-induced renal dysfunction. In renal tissues exposed to ischemia/reperfusion, neutrophil infiltration, renal superoxide production, and renal tumor necrosis factor (TNF)-α mRNA expression were augmented, but these alterations were attenuated by the treatment with capsaicin. On the other hand, ischemia/reperfusion-enhanced renal interleukin (IL)-10 mRNA expression and plasma concentrations of IL-10 were augmented by treatment with capsaicin in ARF rats. In addition, resiniferatoxin (20 μg/kg, subcutaneous), a more selective and potent TRPV1 agonist, showed a renoprotective effect on ischemia/reperfusion-induced renal injury, in a qualitatively similar way to cases seen with capsaicin. These results demonstrate that TRPV1 agonists prevent ischemia/reperfusion-induced renal dysfunction. These renoprotective effects seem to be closely related to the inhibition of inflammatory response via TRPV1.

From the *Laboratory of Pathological and Molecular Pharmacology, Osaka University of Pharmaceutical Sciences, Osaka, Japan; and †Research and Development Center, Santen Pharmaceutical Co., Ltd., Nara, Japan.

Received for publication December 5, 2007; accepted February 19, 2008.

This study was supported in part by a High Technology Research Center Project for Private Universities matching fund subsidy from the Ministry of Education, Culture, Sports, Science and Technology (2002-2006 and 2007-2009).

The authors report no conflicts of interest.

Reprints: Yasuo Matsumura, PhD, Laboratory of Pathological and Molecular Pharmacology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094, Japan (e-mail: matumrh@gly.oups.ac.jp).

Back to Top | Article Outline

INTRODUCTION

Acute renal failure (ARF) is caused by ischemic and nephrotoxic insults acting alone or in combination. ARF is a common clinical complication with an uncertain outcome, ranging from complete restitution to high mortality.1 Ischemic injury is present in about 50% of patients with ARF and is thought to be responsible for much of the nonimmunologic injury that occurs in the immediate days after renal transplantation. The molecular mechanisms underlying ischemia/reperfusion-induced renal injury are not fully understood, but it has been reported that several causal factors (eg, ATP depletion, enhancement of reactive oxygen species production, tumor necrosis factor (TNF)-α mRNA expression, phospholipase activation, neutrophil infiltration, vasoactive peptides, etc.) contribute to the pathogenesis of this renal damage.2 Among them, TNF-α is released during renal ischemia/reperfusion and plays an important role in the ensuing neutrophil-mediated kidney injury.3 TNF-α upregulates neutrophil adhesion molecules, in particular intercellular adhesion molecule (ICAM)-1, after renal ischemia/reperfusion, and this molecule then plays an important role in tissue neutrophil influx. Accumulating evidence indicates that renal TNF-α is an autocrine contributor to renal dysfunction induced by ischemia/reperfusion.4 On the other hand, the antiinflammatory cytokine interleukin (IL)-10, which is a potent inhibitor of fever generation and early-phase inflammation, has many effects such as inhibition of cytokines, chemokines, and neutrophil activation.5 In addition, IL-10 has been shown recently to improve ischemic and cisplatin-induced acute renal injury, by inhibiting the maladaptive activation of genes that cause leukocyte activation and adhesion.6

The transient receptor potential vanilloid (TRPV) subfamily of transient receptor potential cation channels consists of at least six members of membrane proteins in mammalian cells.7 TRPV receptor 1 (TRPV1), one of the TRPVs, was characterized as a capsaicin receptor and cloned in 1997.8 TRPV1 is a nonselective cation channel, which can be activated by noxious heat, protons, and vanilloids such as capsaicin, as well as a range of putative endogenous mediators.9 Although the TRPV1 was originally known to be associated with nociceptive primary afferent fibers, it has been gradually revealed that it is broadly expressed in the brain, epidermis, and visceral cells.10 It is controversial that TRPV1 agonists act as aggravators of inflammation or inhibitors of it. Keeble et al11 and Szabó et al12 have demonstrated that TRPV1 plays a potential role in acute and chronic inflammation in the knee joint. In contrast, Kissin et al13 have shown that resiniferatoxin, a potent capsaicin analog, attenuates knee joint inflammation. Small doses of capsaicin are known to reduce systemic inflammatory responses in septic rats.14 Moreover, recent studies have demonstrated that lipopolysaccharide-induced systemic endotoxemia and airway inflammation were augmented in TRPV1-knockout mice, thereby suggesting the protective role of TRPV1-mediated action against the onset of sepsis after endotoxin and endotoxin-induced airway inflammation.15,16

The deficiency of TRPV1 genes in mice also has been known to impair the recovery process of ischemia/reperfusion-induced cardiac dysfunction.17 In addition, evodiamine, which activates TRPV1, exerted a protection against myocardial ischemia/reperfusion injury in rats.18 A recent study has indicated protective effects of capsaicin against cisplatin-induced ARF.19 In this study, we investigated the effects of treatment with the TRPV1 agonists capsaicin and resiniferatoxin on ischemic ARF in rats, and we evaluated the possible involvement of TNF-α and IL-10 in the above effects.

Back to Top | Article Outline

METHODS

Animals and Experimental Designs

Male Sprague-Dawley rats (10 weeks of age, Japan SLC, Shizuoka, Japan) weighing 280 to 320 g were used. The animals were housed in a light-controlled room with a 12-hour light/dark cycle and were allowed ad libitum access to food and water. Experimental protocols and animal care methods in the experiments were approved by the Experimental Animal Research Committee at Osaka University of Pharmaceutical Sciences. Two weeks before the study (at 8 weeks of age), the right kidney was removed through a small flank incision under pentobarbital anesthesia (50 mg/kg, intraperitoneal). After a 2-week recovery period, uninephrectomized rats were divided into sham-operated control, vehicle-treated ischemic ARF, and drug-treated ischemic ARF groups. All these animals abstained from food for 12 hours before ischemia. To induce ischemic ARF, the rats were anesthetized with pentobarbital (50 mg/kg, intraperitoneal), and the left kidney was exposed through a small flank incision. The left renal artery and vein were occluded with a nontraumatic clamp for 45 minutes. At the end of the ischemic period, the clamp was released for blood reperfusion. Capsaicin (3, 10, and 30 mg/kg) or its vehicle (1% methyl cellulose) was given orally 30 minutes before the start of ischemia at a volume of 5 mL/kg. Resiniferatoxin (20 μg/kg) or its vehicle (10% Tween80, 10% ethanol, and 80% saline) was administered subcutaneously 15 minutes before ischemia at a volume of 1 ml/kg. The doses of these agents were determined according to their pharmacological efficacies reported previously.19-21 In sham-operated control animals, the left kidney was treated identically, except for the clamping. All these surgical procedures were carefully done under the rectal temperature-controlled condition, using a heater. The animals exposed to 45 minutes of ischemia were housed in metabolic cages 24 hours after reperfusion; 5-hour urine samples were taken, and blood samples were drawn from the thoracic aorta at the end of the urine-collection period. The plasma was separated by centrifugation. These samples were used for measurements of renal function parameters. In separate experiments, animals were sacrificed at various time points after the start of reperfusion for measurements of superoxide (O2) production, neutrophil infiltration, mRNA expression, and plasma concentration of IL-10.

Back to Top | Article Outline

Renal Functional Parameters

Blood urea nitrogen (BUN) was determined using a commercial assay kit, the BUN-test-Wako (Wako Pure Chemicals, Osaka, Japan). Urine and plasma sodium concentrations were determined using a flame photometer (205D; Hitachi, Hitachinaka, Japan). The fractional excretion of sodium (FENa; %) was calculated from the following formula: FENa = UNaV/[PNa × Ccr] × 100, where UNaV is the urinary excretion of sodium and PNa is the plasma sodium concentration. Ccr is creatinine clearance and is calculated from the following formula: Ccr = UcrV/Pcr, where UcrV is the urinary excretion of creatinine and Pcr is the plasma creatinine concentration.

Back to Top | Article Outline

Neutrophil Infiltration

Neutrophil infiltration was evaluated using naphthol AS-D chloroacetate esterase staining (91C; Sigma-Aldrich, St. Louis, Mo)22,23 by counting the number of neutrophils present in the outer zone of the medulla of the kidneys. Neutrophils were counted in 50 randomly selected high-power fields (×400) of the outer zone of the medulla. Data were expressed as neutrophils per millimeter squared of tissue.

Back to Top | Article Outline

Measurement of Renal O2 Production

Renal O2 production was measured using a lucigenin-enhanced chemiluminescence assay.24 The whole kidney was removed from rats and cut into strips (2-mm pieces). Immediately afterward, renal tissue segments were placed in test tubes containing modified Krebs-HEPES buffer (pH 7.4, 99.01 mM NaCl, 4.69 mM KCl, 1.87 mM CaCl2, 1.20 mM MgSO4, 1.03 mM K2HPO4, 25 mM Na-HEPES, and 11.1 mM glucose) and allowed to equilibrate in the dark for 15 minutes at 37°C before measurements. After the equilibration, lucigenin (5 μM) was added to the tube, and then the luminescence was measured using a luminometer (Sirius-2; Berthold Technologies, Bad Wildbad, Germany). The relative light unit was integrated every 3 seconds for 15 minutes and averaged. The renal O2 production was expressed as relative light units per minute per milligram of dry tissue weight.

Back to Top | Article Outline

Total RNA Extraction, Reverse Transcription, and Real-Time PCR

Total RNA was isolated from the left kidney of sham-operated control, vehicle-treated ischemic ARF, and drug-treated ischemic ARF groups using a commercially available kit (Nippon Gene, Tokyo, Japan), following the manufacturer's instructions. Total RNA was then reverse transcribed, using a commercially available kit (Takara Bio, Otsu, Japan). Ten microliters of reaction mixture containing 500 ng of total RNA was incubated at 42°C for 15 minutes for reverse transcription, then reverse transcriptase was inactivated by incubation at 95°C for 2 minutes. For real-time PCR, the primers used were as follows: ribosomal protein S18 (Rps18) forward (AAGTTTCAGCACATCCTGCGAGTA); Rps18 reverse (TTGGTGAGGTCAATGTCTGCTTTC); TNF-α forward (AACTCGAGTGACAAGCCCGTAG); TNF-α reverse (GTACCACCAGTTGGTTGTCTTTGA); IL-10 forward (CAGACCCACATGCTCCGAGA); IL-10 reverse (CAAGGCTTGGCAACCCAAGTA). All primers were purchased from Takara Bio (Otsu, Japan). The PCR reactions were carried out in an ABI Prism 7000 (Applied Biosystems, Foster City, Calif). RT-PCR amplifications were performed in a volume of 50 μL. Each reaction mixture contained 2 μL of cDNA, 25 μL of SYBR Green PCR master mix (Qiagen, Hilden, Germany), and 0.5 μM of each primer. Each RT-PCR run started with 15 minutes at 95°C to activate the Taq polymerase. The amplification was done for 45 cycles. Each cycle consisted of denaturation for 15 seconds at 94°C, annealing of primers for 30 seconds at 55°C or 58°C, and elongation for 30 seconds at 72°C. The mRNA copy numbers were calculated from the Ct value, using the ABI Prism 7000 Sequence Detection System (Applied Biosystems). Results of mRNA copy numbers were normalized against Rps18 mRNA.

Back to Top | Article Outline

Measurement of IL-10 Protein

Plasma concentration of IL-10 was measured using the Bio-Plex suspension system (Biorad, Hercules, Calif).

Back to Top | Article Outline

Drug

Capsaicin, a kind gift from Maruishi Pharmaceutical Co., Ltd. (Osaka, Japan), was dissolved in 1% methyl cellulose. Resiniferatoxin (Alexis Biochemicals, San Diego, Calif) was dissolved in a mixture of 10% Tween80, 10% ethanol, and 80% saline immediately before administration.

Back to Top | Article Outline

Statistical Analysis

Values are expressed as means ± SEM. Relevant data were processed by InStat (Graph-PAD Software for Science, San Diego, Calif). For statistical analysis, we used one-way analysis of variance followed by Dunnett or Bonferroni tests for multiple comparisons. For all comparisons, differences were considered significant at P < 0.05.

Back to Top | Article Outline

RESULTS

Renal Function After Ischemia/Reperfusion and Effects of Capsaicin

The renal function of rats subjected to 45 minutes of ischemia showed a marked deterioration when measured 24 hours after reperfusion (Fig. 1). Compared with sham-operated rats, vehicle-treated ARF rats showed significant increases in BUN (144.76 ± 9.83 versus 21.75 ± 1.33 mg/dL), FENa (11.08 ± 4.38 versus 0.79 ± 0.15%), and urine flow (UF; 123 ± 11 versus 33 ± 4 μL/min per kilogram). The oral administration of capsaicin (3, 10, and 30 mg/kg) 30 minutes before ischemia produced a preventive effect against ischemia/reperfusion-induced renal dysfunction (except for changes in UF). When a higher dose of capsaicin (30 mg/kg) was given, renal function changes induced by ischemia/reperfusion were significantly improved (BUN, 90.59 ± 10.73 mg/dL; FENa, 2.16 ± 0.58%). The administration of 30 mg/kg of capsaicin to sham-operated rats produced no significant effects in their renal function (data not shown).

FIGURE 1

FIGURE 1

Back to Top | Article Outline

Neutrophil Infiltration in the Kidney After Ischemia/Reperfusion and Effects of Capsaicin

We evaluated whether treatment with capsaicin suppressed the neutrophil infiltration into the renal tissue, an event that has been known to produce O2 and that is believed to be one of the main causal factors of ischemia/reperfusion-induced ARF.25,26 As shown in Figure 2B, neutrophils were observed in the kidney of vehicle-treated ARF rats at 6 h after reperfusion. The number of infiltrating neutrophils in the vehicle-treated ARF rats was significantly increased compared with that in the sham-operated rats (Fig. 2A and D). On the other hand, neutrophil infiltration was markedly suppressed in the renal tissues of ARF rats given capsaicin (30 mg/kg) (Fig. 2C and D).

FIGURE 2

FIGURE 2

Back to Top | Article Outline

Renal O2 Production After Ischemia/Reperfusion and Effects of Capsaicin

We evaluated the effect of capsaicin on renal O2 production in ARF rats. As shown in Figure 2E, the increased level of renal O2 production at 6 hours after ischemia/reperfusion was markedly suppressed by treatment with capsaicin (30 mg/kg).

Back to Top | Article Outline

Time Courses of Renal TNF-α and IL-10 mRNA Expression After Ischemia/Reperfusion

As shown in Figure 3, renal TNF-α expression in vehicle-treated ARF rats subjected to 45 minutes of ischemia increased gradually and reached almost plateau values at 4 hours after reperfusion. On the other hand, renal IL-10 mRNA expression was rapidly and temporarily increased within 2 hours after reperfusion, and, thereafter, its expression levels decreased to those seen in sham-operated rats.

FIGURE 3

FIGURE 3

Back to Top | Article Outline

Effects of Capsaicin on Renal TNF-α and IL-10 mRNA Expression After Ischemia/Reperfusion

Experiments to examine the effect of capsaicin treatment on TNF-α and IL-10 mRNA expression were evaluated at 2 and 4 hours after reperfusion. As shown in Figure 4A, the increased level of renal TNF-α mRNA expression at 2 and 4 hours after ischemia/reperfusion revealed a slight, nonsignificant decrease by treatment with capsaicin. On the other hand, the administration of capsaicin tended to augment the level of IL-10 mRNA expression at 4 hours after ischemia/reperfusion, although these changes were also not statistically significant (Fig. 4B).

FIGURE 4

FIGURE 4

Back to Top | Article Outline

Effects of Capsaicin on Plasma IL-10 Concentration After Ischemia/Reperfusion

Figure 4C shows the effect of capsaicin on the plasma concentration of IL-10 at 2 and 4 hours after ischemia/reperfusion. Compared with sham-operated rats, vehicle-treated ARF rats showed two- to threefold increases in plasma concentration of IL-10, and the increased level was further enhanced by the capsaicin treatment.

Back to Top | Article Outline

Effects of Resiniferatoxin on Ischemia/Reperfusion-induced Renal Dysfunction

We next examined whether a selective TRPV1 agonist, resiniferaoxin, also exhibits renoprotective effects against the ischemic ARF. As shown in Figure 5, ischemia/reperfusion-induced renal dysfunction, such as increases in BUN, FENa, and UF, were significantly improved by 20 μg/kg of resiniferatoxin administered subcutaneously 15 minutes before ischemia.

FIGURE 5

FIGURE 5

Back to Top | Article Outline

Effects of Resiniferatoxin on Neutrophil Infiltration in the Kidney and Renal O2 Production After Ischemia/Reperfusion

As shown in Figure 6B, neutrophils were observed in the kidney of vehicle-treated ARF rats at 6 hours after reperfusion. The increased number of infiltrating neutrophils was markedly suppressed in the renal tissues of ARF rats given resiniferatoxin before ischemia (Fig. 6C and D), although there was a significant difference between sham-operated and resiniferatoxin-treated rats (Bonferroni test, P < 0.01). On the other hand, the increased level of renal O2 production at 6 hours after ischemia was not significantly suppressed by resiniferatoxin treatment (Fig. 6E).

FIGURE 6

FIGURE 6

Back to Top | Article Outline

Effects of Resiniferatoxin on Renal TNF-α and IL-10 mRNA Expression After Ischemia/Reperfusion

As shown in Figure 7A, the increased level of renal TNF-α expression at 2 and 4 hours after ischemia/reperfusion was markedly suppressed by treatment with resiniferatoxin. On the other hand, the level of renal IL-10 mRNA expression at 4 hours after ischemia/reperfusion was markedly elevated by resiniferatoxin administration (Fig. 7B).

FIGURE 7

FIGURE 7

Back to Top | Article Outline

Effects of Resiniferatoxin on Plasma IL-10 Concentration After Ischemia/Reperfusion

Figure 7C indicates the effect of resiniferatoxin on plasma concentration of IL-10 at 2 and 4 hours after ischemia/reperfusion. Compared with vehicle-treated ARF rats, resiniferatoxin-treated ARF rats exhibited markedly increased plasma IL-10 concentrations.

Back to Top | Article Outline

DISCUSSION

Ischemic ARF is a frequent clinical syndrome with a high morbidity and mortality.27 Reperfusion of previously ischemic renal tissue initiates a series of complex cellular events that results in injury and the eventual death of renal cells from a combination of apoptosis and necrosis.28 In this study, we found that preischemic treatment with the TRPV1 agonists capsaicin and resiniferatoxin prevented ischemia/reperfusion-induced renal dysfunction.

Numerous attempts have been made to prevent ARF using animal models of ischemia/reperfusion-induced renal injury, and various vasodilative agents, including natriuretic peptides, adenosine antagonists, dopamine receptor agonists, calcium antagonists, endothelin receptor antagonists, and acetylcysteine have been considered useful for the prevention and management of ARF,29 although it remains to be elucidated whether similar interventions are beneficial to clinical uses. TRPV1 has also been suggested to play a role in regulating vasodilatation in a variety of vascular beds.30 The activation of TRPV1 leads to the release of several neuropeptides such as substance P, calcitonin gene-related peptide (CGRP), and somatostatin.31-33 CGRP is strongly coexpressed in many TRPV1-expressing nerve fibers, including sensory fibers that innervate the dural vasculature,34 and it has been suggested to confer a beneficial counterbalance to the development of hypertension.35

To explore the possible mechanisms underlying the renoprotective effects of TRPV1 agonists against ischemia/reperfusion-induced renal injury, we first evaluated the effects of TRPV1 agonists on neutrophil infiltration, which is one of major causes for renal injury after ischemia/reperfusion. Neutrophil is implicated as a mediator of tissue-destructive events in reperfusion injury.36 The plasma membrane of the triggered neutrophil is the site of an unusual enzyme, termed the NADPH oxidase, which underlies the cell's ability to generate a family of reactive oxidizing chemicals. The superoxide radical and its metabolites play an important role in the pathogenesis of tissue injury.37 Capsaicin and resiniferatoxin attenuated neutrophil infiltration and O2 production, which may be mainly derived from the infiltrating neutrophil after ischemia/reperfusion. The inhibitory effect of capsaicin on O2 production was stronger than that of resiniferatoxin. Capsaicin is known to exhibit the radical scavenging activity, which was measured in the oxidation reaction of the methyl linoleate in vitro system.38 Such radical scavenging activity of capsaicin seems closely related to the potent inhibitory effects on O2 production in the postischemic kidney. Shimeda et al19 recently have found that the protective effect of capsaicin against cisplatin-induced ARF may be attributed to its radical scavenging activity. However, the above study did not consider the possible involvement of TRPV1-related events in the capsaicin-induced renoprotective effect.

We next investigated the possible inhibitory mechanisms of TRPV1 agonists on neutrophil infiltration observed in the renal tissues exposed to ischemia/reperfusion. Expressions of adhesion molecules (including ICAM-1) on endothelial cells are important for neutrophil infiltration. For expression of adhesion molecules, some cytokines (including TNF-α) have a critical role.39 On the other hand, the antiinflammatory cytokine IL-10 has been shown recently to inhibit ischemic and cisplatin-induced acute renal injury.6 Therefore, we investigated the effects of TRPV1 agonists on TNF-α and IL-10 expression in the postischemic kidneys, and we noted that preischemic treatment with the TRPV1 agonists capsaicin and resiniferatoxin tended to decrease TNF-α mRNA levels and to increase IL-10 mRNA and its serum protein levels. Previous studies have demonstrated that CGRP40,41 and somatostatin42,43 inhibit the LPS-induced TNF-α production in vivo and in vitro. Moreover, capsaicin administered subcutaneously is known to cause a significant decrease in the production of TNF-α in septic rats, suggesting that capsaicin-sensitive nerves might have a protective role in systemic inflammatory syndrome.14 On the other hand, in the same disease model, the plasma concentration of antiinflammatory IL-10 was increased by the capsaicin treatment.14 Most recently, we have found that orally administered capsaicin dose-dependently inhibited LPS-induced TNF-α production and increased LPS-induced IL-10 production in rats (unpublished observations). Taken together, we suggest that activation of capsaicin-sensitive afferent neurons following the release of neuropeptides occurs after the treatment of TRPV1 agonists, and released neuropeptides may modify the inflammatory reactions after ischemia/reperfusion.

In separate experiments, to confirm that the preventive effects of capsaicin and resiniferatoxin on ischemia/reperfusion-induced renal injury are mediated by TRPV1, we attempted to use TRPV1 antagonist capsazepine. However, because capsazepine itself affected ischemia/reperfusion-induced renal injury, we could not evaluate its antagonizing activity on TRPV1 agonist-induced renoprotective effects (unpublished observations). Capsazepine is not only a TRPV1 antagonist; it also inhibits voltage-activated calcium channels and nicotinic acetylcholine receptors,44,45 which suggests that capsazepine is not appropriate for antagonizing study in an ischemia/reperfusion-induced renal injury model. Another TRPV1 antagonist, iodo-resiniferatoxin, is also reported to be inadequate for TRPV1 antagonizing study in vivo.46 In a preliminary experiment, we noted that iodo-resiniferatoxin inhibited LPS-induced TNF-α production in rats. Thus, further studies using TRPV1 antagonists with better pharmaceutical properties or TRPV1-knockout animals are required to elucidate the TRPV1-mediated renoprotective effect and its precise mechanisms.

TRPV1 agonists such as capsaicin and resiniferatoxin have been known to exhibit hypothermic effects in rodents.47,48 On the other hand, reductions in body temperature have been shown to protect the kidney from ischemic injury.49 Thus, decreases in body temperature in response to capsaicin and resiniferatoxin treatments may be involved in the renoprotective effects of these agents. In the present study, surgical procedures including ischemia/reperfusion were carefully done under the body temperature-controlled condition, but there was a gradual and small decrease of rectal temperature after the start of anesthesia and during 45 minutes of ischemia in all experimental groups. Therefore, changes in rectal temperature before and after the anesthesia plus ischemia were checked in some rats (n = 3) from each group (mean values were as follows: sham, 37.8-35.8°C; vehicle-treated ARF, 37.2-35.1°C; capsaicin (3 mg/kg)-treated ARF, 37.9-35.4°C; capsaicin 30 (mg/kg)-treated ARF, 37.6-35.1°C; resiniferatoxin-treated ARF, 37.3-35.6°C). However, no significant differences were observed between TRPV1 agonists-treated and untreated animals, which suggests that the renoprotective effects of TRPV1 agonists are independent of their hypothermic characteristics.

In conclusion, preischemic treatment with capsaicin and resiniferatoxin prevents ischemia/reperfusion-induced renal injury, probably via TRPV1-mediated mechanisms, which are closely related to the inhibition of inflammatory responses. This renoprotective effect may be useful to preserve renal function in patients with ARF after cardiac and vascular surgery. Because ARF cannot be predicted in many clinical cases, however, further studies are required to evaluate whether TRPV1 agonists can reverse ischemia/reperfusion-induced renal dysfunction and degeneration when given after reperfusion.

Back to Top | Article Outline

ACKNOWLEDGMENTS

The authors are grateful to Ms. Keiko Mizutani for her excellent technical assistance and Ms. Yaeko Tsukahara for supporting this work.

Back to Top | Article Outline

REFERENCES

1. Kelly KJ, Molitoris BA. Acute renal failure in the new millennium: time to consider combination therapy. Semin Nephrol. 2000;20:4-19.
2. Edelstein CL, Ling H, Schrier RW. The nature of renal cell injury. Kidney Int. 1997;51:1341-1351.
3. Donnahoo KK, Meng X, Ayala A, et al. Early kidney TNF-α expression mediates neutrophil infiltration and injury after renal ischemia-reperfusion. Am J Physiol. 1999;277:R922-R929.
4. Ramesh G, Reeves WB. Inflammatory cytokines in acute renal failure. Kidney Int. 2004;66:S56-S61.
5. De Vries JE. Immunosuppressive and anti-inflammatory properties of interleukin 10. Ann Med. 1995;27:537-541.
6. Deng J, Kohda Y, Chiao H, et al. Interleukin-10 inhibits ischemic and cisplatin-induced acute renal injury. Kidney Int. 2001;60:2118-2128.
7. Gunthorpe MJ, Benham CD, Randall A, et al. The diversity in the vanilloid (TRPV) receptor family of ion channels. Trends Pharmacol Sci. 2002;23:183-191.
8. Caterina MJ, Schumacher MA, Tominaga M, et al. The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature. 1997;389:816-824.
9. van der Stelt M, Di Marzo V. Endovanilloids: putative endogenous ligands of transient receptor potential vanilloid 1 channels. Eur J Biochem. 2004;271:1827-1834.
10. Nagy I, Sántha P, Jancsó G, et al. The role of the vanilloid (capsaicin) receptor (TRPV1) in physiology and pathology. Eur J Pharmacol. 2004;500:351-369.
11. Keeble J, Russell F, Curtis B, et al. Involvement of transient receptor potential vanilloid 1 in the vascular and hyperalgesic components of joint inflammation. Arthritis Rheum. 2005;52:3248-3256.
12. Szabó Á, Helyes Z, Sándor K, et al. Role of transient receptor potential vanilloid 1 receptors in adjuvant-induced chronic arthritis: in vivo study using gene-deficient mice. J Pharmacol Exp Ther. 2005;314:111-119.
13. Kissin EY, Freitas CF, Kissin I. The effects of intraarticular resiniferatoxin in experimental knee-joint arthritis. Anesth Analg. 2005;101:1433-1439.
14. Demirbilek S, Ersoy MO, Demirbilek S, et al. Small-dose-capsaicin reduces systemic inflammatory responses in septic rats. Anesth Analg. 2004;99:1501-1507.
15. Clark N, Keeble J, Fernandes ES, et al. The transient receptor potential vanilloid 1 (TRPV1) receptor protects against the onset of sepsis after endotoxin. FASEB J. 2007;21:3747-3755.
16. Helyes Z, Elekes K, Németh J, et al. Role of transient receptor potential vanilloid 1 receptors in endotoxin-induced airway inflammation in the mouse. Am J Physiol. 2007;292:L1173-L1181.
17. Wang L, Wang DH. TRPV1 gene knockout impairs postischemic recovery in isolated perfused heart in mice. Circulation. 2005;112:3617-3623.
18. Rang WQ, Du YH, Hu CP, et al. Protective effects of evodiamine on myocardial ischemia-reperfusion injury in rats. Planta Med. 2004;70:1140-1143.
19. Shimeda Y, Hirotani Y, Akimoto Y, et al. Protective effects of capsaicin against cisplatin-induced nephrotoxicity in rats. Biol Pharm Bull. 2005;28:1635-1638.
20. Demirbilek S, Ersov MO, Demirbilek S, et al. Small-dose capsaicin reduces systemic inflammatory responses in septic rats. Anesth Analg. 2004;99:1501-1507.
21. Helyes Z, Szabó A, Németh J, et al. Antiinflammatory and analgesic effects of somatostatin released from capsaicin-sensitive sensory nerve terminals in a Freund's adjuvant-induced chronic arthritis model in the rat. Arthritis Rheum. 2004;50:1677-1685.
22. Moloney WC, McPherson K, Fliegelman L. Esterase activity in leukocytes demonstrated by the use of naphthol AS-D chloroacetate substrate. J Histochem Cytochem. 1960;8:200-207.
23. Chiao H, Kohda Y, McLeroy P, et al. α-Melanocyte-stimulating hormone protects against renal injury after ischemia in mice and rats. J Clin Invest. 1997;99:1165-1172.
24. Skatchkov MP, Sperling D, Hink U, et al. Validation of lucigenin as a chemiluminescent probe to monitor vascular superoxide as well as basal vascular nitric oxide production. Biochem Biophys Res Commun. 1999;254:319-324.
25. Clancy RM, Leszczynska-Piziak J, Abramson SB. Nitric oxide, an endothelial cell relaxation factor, inhibits neutrophil superoxide anion production via a direct action on the NADPH oxidase. J Clin Invest. 1992;90:1116-1121.
26. Linas SL, Whittenburg D, Parsons PE, et al. Mild renal ischemia activates primed neutrophil to cause acute renal failure. Kidney Int. 1992;42:610-616.
27. Thadhani R, Pascual M, Bonventre JV. Acute renal failure. N Engl J Med. 1996;334:1448-1460.
28. Lieberthal W, Levine JS. Mechanisms of apoptosis and its potential role in renal tubular epithelial cell injury. Am J Physiol. 1996;271:F477-F488.
29. Venkataraman R, Kellum JA. Novel approaches to the treatment of acute renal failure. Expert Opin Investig Drugs. 2003;12:1353-1366.
30. Wang DH. The vanilloid receptor and hypertension. Acta Pharmacol Sin. 2005;26:286-294.
31. Buck SH, Burks TF. The neuropharmacology of capsaicin: review of some recent observations. Pharmacol Rev. 1986;38:179-226.
32. Diez Guerra FJ, Zaidi M, Bevis P, et al. Evidence for release of calcitonin gene-related peptide and neurokinin A from sensory nerve endings in vivo. Neuroscience. 1988;25:839-846.
33. Helyes Z, Nemeth J, Than M, et al. Inhibitory effect of anandamide on resiniferatoxin-induced sensory neuropeptide release in vivo and neuropathic hyperalgesia in the rat. Life Sci. 2003;73:2345-2353.
34. Dux M, Sántha P, Jancsó G. Capsaicin-sensitive neurogenic sensory vasodilation in the dura mater of the rat. J Physiol. 2003;552:859-867.
35. Marquez-Rodas I, Longo F, Rothlin RP, et al. Pathophysiology and therapeutic possibilities of calcitonin gene-related peptide in hypertension. J Physiol Biochem. 2006;62:45-56.
36. Weiss SJ. Tissue destruction by neutrophils. N Engl J Med. 1989;320:365-376.
37. Hirota M, Inoue M, Ando Y. Inhibition of stress-induced gastric mucosal injury by a long acting superoxide dismutase that circulates bound to albumin. Arch Biochem Biophys. 1990;280:269-273.
38. Okada Y, Okajima H. Antioxidant effct of capsaicin on lipid peroxidation in homogeneous solution, micelle dispersions and liposomal membranes. Redox Rep. 2001;6:117-122.
39. Springer TA. Adhesion receptors of the immune system. Nature. 1990;346:425-434.
40. Feng Y, Tang Y, Guo J. Inhibition of LPS-induced TNF-α production by calcitonin gene-related peptide (CGRP) in cultured mouse peritoneal macrophages. Life Sci. 1997;61:PL-281-PL-287.
41. Gomes RN, Castro-Faria-Neto HC, Bozza PT, et al. Calcitonin gene-related peptide inhibits local acute inflammation and protects mice against lethal endotoxemia. Shock. 2005;24:590-594.
42. Landa JI, Alvarez Sanchez J, Grau M, et al. Somatostatin reduces the levels of tumor necrosis factor alpha in a rat model of endotoxemia induced by lipopolysaccharide. Res Exp Med. 1995;195:317-325.
43. Peluso G, Petillo O, Melone MAB, et al. Modulation of cytokine production in activated human monocytes by somatostatin. Neuropeptides. 1996;30:443-451.
44. Docherty RJ, Yeats JC, Piper AS. Capsazepine block of voltage-activated calcium channels in adult rat dorsal root ganglion neurons in culture. Br J Pharmacol. 1997;121:1461-1467.
45. Liu L, Simon SA. Capsazepine, a vanilloid receptor antagonist, inhibits nicotic acetylcholine receptors in rat trigeminal ganglia. Neurosci Lett. 1997;228:29-32.
46. Seabrook GR, Sutton KG, Jarolimek W, et al. Functional properties of the high-affinity TRPV1 (VR1) vanilloid receptor antagonist (4-hydroxy-5-iodo-3-methoxyphenylacetate ester) iode-resiniferatoxin. J Pharmacol Exp Ther. 2002;303:1052-1060.
47. Ding Z, Cowan A, Rawls SM. Capsaicin evokes hypothermia independent of cannabinoid CB1 and CB2 receptors. Brain Res. 2005;1065:147-151.
48. Shimizu I, Iida T, Horiuchi N, et al. 5-Iodoresiniferatoxin evokes hypothermia in mice and is a partial transient receptor potential vanilloid 1 agonist in vitro. J Pharmacol Exp Ther. 2005;314:1378-1385.
49. Zager RA, Altschuld R. Body temperature: an important determinant of severity of ischemic renal injury. Am J Physiol. 1986;251:F87-F93.
Keywords:

TRPV1; capsaicin; resiniferatoxin; ischemia/reperfusion; acute renal failure

© 2008 Lippincott Williams & Wilkins, Inc.