Upregulation of Angiotensin II-AT1 Receptors During Statin Withdrawal in Vascular Smooth Muscle Cells

Abstract

Acute discontinuation of statins induces vascular dysfunction and increases cardiovascular events. The mechanisms underlying these events are under investigation. We showed an increase in angiotensin II (AngII) signaling after acute statin withdrawal. We investigated whether AngII-AT1-receptor expression (AT1-R mRNA) and receptor protein (AT1-R) levels mediate increased AngII signaling. In rat aortic vascular smooth muscle cells (VSMC), simvastatin (0.3 to 3 μM for 24 hours) resulted in concentration-dependent inhibition of AngII-stimulated phosphorylation of extracellular-signal regulated kinase 1/2 ERK1/2 (-67 ± 5% with 3 μM; P < 0.001) and decreased AT1-R mRNA (-34 ± 8% with 3 μM; P < 0.01) and AT1-R protein (-32 ± 6% with 3 μM; P < 0.01). Removal of simvastatin led to a rebound increase in mRNA-AT1-R (+39 ± 2%, P < 0.01), AT1-R protein (+46 ± 2%; P < 0.01), and AngII-mediated phosphorylation of ERK1/2 (+36 ± 3%; P < 0.01). The increase in receptor expression was present at 1 hour and lasted for 4 hours, whereas increased AT1-R protein and AngII signaling started at 2 hours and lasted for nearly 2 hours. In summary, increased AngII signaling after statin withdrawal is most likely due to increases in AT1-R number due to increased transcription. The increase in AngII activity may contribute to the vascular dysfunction associated with statin withdrawal.

BACKGROUND

The clinical benefits of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, also known as statins, result not only from lowering systemic cholesterol levels but also from direct action on vascular cells.^1-3 Statins increase the production of vascular protective substances, such as nitric oxide, and inhibit the effects of substances that induce contraction, proliferation, and inflammation of vascular cells.^4-10 Acute discontinuation of statin treatment increases the incidence of adverse cardiac events in patients with atherosclerotic heart disease.^11-19 Inhibition of nitric oxide activity^17,18 increases in thrombin and angiotensin-II (AngII)-stimulated phosphorylation of mitogen-activated protein kinases (MAPK) and enhanced procoagulant activity follow acute statin withdrawal in vascular smooth muscle cells (VSMC).^20,21 AT1-receptor (AT1-R) is the major AngII receptor involved in the regulation of cardiovascular function in health and disease states.^22,23 We investigated whether the greater effects of AngII in VSMC observed after statin withdrawal were mediated by an increase in AT1-R levels and whether increased receptor levels may result from increased receptor expression (ie, increased mRNA-AT1-R).

MATERIALS AND METHODS

Cell Culture

Adult (250 to 300 g) male Sprague-Dawley rats (Charles River Laboratories, Wilmington, MA) were used. VSMCs were isolated from the rat's aorta by the explant technique.²⁴ Experiments were performed from passages 3 to 12. Cells were cultured in Dulbecco modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS), 100 units/mL penicillin, 100 μg/mL streptomycin, and 250 ng/mL amphotericin B at 37°C and 5% CO₂. After 48 hours in serum-free media, cultured cells were treated with 0.3 to 3 μM simvastatin or vehicle for 24 hours. Where indicated, cells were treated for 10 minutes to 1 nM AngII (EC 50%: 0.85 ± 0.1 nM). For withdrawal experiments, the cells were washed 3 times with serum-free DMEM containing 0.1% bovine serum albumin and harvested at different times (immediately and at 1, 2, 3, 4, 5, and 6 hours after washing).

Western Blot Analysis

Western blot analysis was done as described previously.²¹ Briefly, 20-μg protein samples from VSMC experiments were separated on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred onto polyvinylidene fluoride membranes (Amersham Biosciences). The membranes were first blocked in 5% nonfat dry milk and subsequently incubated with anti-phospho-specific ERK1/2 antibodies (1:5000 overnight at 4°C), anti-non-phosphorylated ERK1/2 antibodies (1:1000 overnight at 4°C), anti-AT1 receptor (1:500 for 2 hours at room temperature), and anti-β-actin (1:2000 overnight at 4°C) followed by incubation with an anti-rabbit IgG-HRP-linked (1:1000 for 1 hour at room temperature) or with a donkey anti-goat IgG-HRP (1:50,000 for 1 hour at room temperature). Immunoreactive proteins were visualized by chemiluminescence using a peroxidase enzymatic reaction (ECL Western blot detection system, Amersham). To correct for differences in protein loading, nonphosphorylated ERK1/2 and β-actin were used for phosphorylated ERK1/2 and AT1 receptor quantification, respectively.

Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)

Total cellular RNA was isolated from the VSMC using RNeasy (Qiagen, Inc, Valencia, CA). One microgram of total RNA from each preparation was reverse-transcribed using Access RT-PCR System (PROMEGA, Madison, WI) according to the manufacture's protocol. The following primers were used: AT₁ receptor (ATCTCGCCTTGGCTGACTTACCA sense/GACTTCATTGGGTGGACGAT antisense); β-actin (sense/antisense). β-actin mRNA quantification was used as an external control for the rt-PCR. Reverse transcription cycle was 42°C for 30 min followed by 5 min at 42°C. The cDNA was amplified as follows: denaturation, 30 s at 94°C; annealing, 60 s at 46°C for AT1 receptor or 54.8°C for β-actin; extension, 2 min at 68°C. PCR products were electrophoresed on a 1% agarose gel containing ethidium bromide 0.5 μg/mL. The gel was subjected to ultraviolet light and photographed. The band intensities were quantified using the National Institutes of Health imaging software, and the signals were expressed relative to the intensity of the β-actin amplicon in each sample.

Statistics

Results were expressed as either chemiluminescence arbitrary units, as change from baseline, and/or as a ratio of phosphorylated to nonphosphorylated proteins, AT1-R mRNA/β-actin or AT-1-R protein/β-actin. Values are expressed as mean ± standard error of mean. Two-sample comparison was carried out by unpaired Student t test. ANOVA was used for multiple sample comparison followed by a post-hoc Duncan test. A probability value of less than 0.05 was considered as statistically significant.

RESULTS

Effect of the Statins Treatment and Withdrawal on AngII-Stimulated Phosphorylation of ERK 1/2

Simvastatin (0.3 to 3 μM) inhibited AngII-mediated stimulation of ERK 1/2 in a concentration-dependent manner (Figure 1). Washout of simvastatin (3 μM) led to a transient and significant 36 ± 3% increase in AngII-mediated phosphorylation of ERK 1/2 above the levels of stimulation induced by AngII in control cells exposed to vehicle (P < 0.01) (Figure 2). This rebound effect started at 2 hours after drug washout and lasted approximately 2 hours. Statin withdrawal produced no significant effects on basal levels of MAPK phosphorylation and on the amount of nonphosphorylated MAPK (data not shown).

FIGURE 1: Effects of simvastatin treatment on angiotensin II (AngII)-induced ERK1/2 phosphorylation, AT1-R mRNA, and AT1-R protein levels in rat vascular smooth muscle cells (VSMC). VSMC were treated with 0.3, 1, or 3-μM simvastatin or vehicle for 24 hours (control). Cell were harvested at the end of the 24-hour incubation period and assayed for AT1-R mRNA and AT1-R protein levels. In some experiments, cells were incubated with AngII (1 nM, for 10 min) or vehicle, (10 min) and harvested at the end of the 10 min incubation period. For AT1-R mRNA and AT1-R protein values are expressed corrected for β-actin levels. AngII-stimulated phosphorylation of ERK1/2 was expressed as the ratio of AngII effects during simvastatin treatment or withdrawal/AngII effects during vehicle treatment or withdrawal. Shown are mean values ± SEM for at least 4 animals per group. *P < 0.05 and **P < 0.01.

FIGURE 2: Effects of 3 μM simvastatin treatment and withdrawal on AngII-induced ERK1/2 phosphorylation, AT1-R mRNA, and AT1- R protein levels in rat vascular smooth muscle cells (VSMC). VSMC were treated with 3 μM simvastatin or vehicle for 24 hours (control). Cells were subsequently washed with simvastatin-free media (withdrawal) and harvested hourly for the next 6 hours. For AT1-R mRNA and AT1-R protein, values are expressed corrected for β-actin levels. AngII-stimulated phosphorylation of ERK1/2 was expressed as the ratio of AngII effects during simvastatin treatment or withdrawal/AngII effects during vehicle treatment or withdrawal. Shown are mean values ± SEM for at least 4 animals per group. *P < 0.05 and **P < 0.01.

Angiotensin II AT1 Receptor mRNA Levels During Statin Treatment and Withdrawal in VSMC

Simvastatin treatment (0.3 to 3 μM for 24 hr) decreased AngII-AT1-R mRNA levels 34 ± 8% compared to levels present in cells treated for 24 hour with the drug vehicle (P < 0.001) (Figure 1 and 2). AT1 receptor expression was significantly increased after washout of cells with statin-free medium. As early as 1 hour and during the first 4 hours after the washout of simvastatin, there was a significant increase in AT1-R expression above that present in control cells. The average increase for the 4-hour period was of 39 ± 2% above controls (P < 0.001). After 4 hours, AT1-R mRNA returned to baseline values (Figure 2).

Angiotensin II AT1 Receptor Protein Levels During Statin Treatment and Withdrawal in VSMC

Simvastatin (0.3 to 3 μM for 24 hours) significantly decreased the levels of AT1-R protein. With 3 μM simvastatin, AT1-R levels were decreased by 32 ± 6% compared to levels observed in cells treated for 24 hours with drug vehicle (P < 0.001) (Figure 1 and 2). AT1-R protein levels increased after the washout of cells with statin-free medium. As early as 1 hour and during the first 4 hours after the washout of simvastatin, there were significant increases in AT1-R levels above control values. The average increase for the 5-hour period was of 46 ± 2% above controls (P < 0.001).

DISCUSSION

In patients with acute coronary syndromes, abrupt discontinuation of statins has been shown to be associated with an increased rate for adverse cardiovascular events.^11-16 Impairment in nitric oxide production by endothelial cells and diminished endothelial-dependent vasodilation has been demonstrated after abrupt discontinuation of statins.^17-19 In addition, activation of vascular deleterious mechanisms plays a role in the vascular dysfunction observed after acute statin withdrawal. Increases in NADPH oxidase activity, thrombin-induced MAPK phosphorylation and procoagulant activity,²⁰ and in AngII-mediated ERK 1/2 phosphorylation²¹ have been observed after statin withdrawal in VSMC in culture. Due to the known deleterious effects of increased AngII activity on vascular function,^22,23 the mechanisms responsible for increased AngII signaling after statin withdrawal require investigation.

Stimulation of AT1 receptors by AngII leads to activation of multiple intracellular signaling pathways.²² In VSMC, activation of MAPK signaling by AngII leads to stimulation of cell growth, apoptosis, differentiation, and contraction.^22,23,25,26 Therefore, AngII-induced phosphorylation and activation of MAPK in SMVC was employed in this study as a marker of AngII effects.^22,23,27,28 This effect of AngII is mediated by stimulation of AT1-R.^22-27 Overstimulation of the MAPK pathway is likely to lead to vascular dysfunction. Acute withdrawal of either lovastatin or simvastatin was shown to increase AngII-mediated phosphorylation of ERK1/2 and of p38 MAPK in VSMC.²¹ On the basis of our findings, the mechanism underlying this rebound increase in AngII effects appears to be due to an increased number of AT1 receptors. In this study, we demonstrated that the levels of AT1-R mRNA and of AT1-R protein were significantly increased after statin withdrawal. As early as 1 hour after washing the statin-treated cells with statin-free media, there was a 30% to 50% increase in both AT1-R mRNA, which was followed 1 hour later by increases in AT1-R protein levels and AngII signaling. We propose that the increased receptor protein results from increased transcript levels. It appears that shortly after discontinuation of a statin, the VSMCs respond with a rapid but transient increase in AT1-R mRNA, which leads to higher receptor levels, subsequently translating into greater AT1-AngII effects. The latter may participate in the vascular dysfunction reported after statin withdrawal.

Interestingly, this rebound increase in AT1-R and AngII signaling overcomes the well-known inhibitory effect of statins on AngII signaling and AT1 receptors in VSMC.^29,30 Cerivastatin, fluvastatin, atorvastatin, and simvastatin have been shown by this study and others^29-31 to reduce AT1-R messenger RNA levels and AT1-R density in VSMC. Interestingly, the percentage inhibition of AT1-R levels induced by simvastatin was less than the percentage inhibition of AngII signaling. This suggests either that simvastatin inhibits AngII signaling through an additional mechanism to reducing AT1-R levels or that decreased receptor density may not induce linear decreases in agonist effects. Recent findings suggest that statins downregulate AT1-R expression by reducing the levels of isoprenoid intermediates and of the geranylated RhoA small GTPase to attenuate the biological function of AngII.^29-31 As proposed for the rebound impairment in NO production,¹⁹ a rapid increase in isoprenoid intermediates associated with increased cytoplasmic levels of unprenylated RhoA may explain the AT1-R upregulation and signaling observed after statin withdrawal. Further studies are in progress to determine whether a similar pathway is involved in the increase in AT1-R expression and levels and on AngII signaling.

The concentrations of simvastatin employed in this study are in the high nanomolar and low micromolar range. Plasma levels in patients treated with simvastatin are commonly in the high nanomolar range; therefore, the concentrations employed in this study are not in far excess of those achieved in clinical practice. Additionally, VSMC in culture were exposed to simvastatin for 24 hours, whereas patients often receive lifetime treatment. The effects of statin withdrawal after longer exposure times have not been studied and will therefore require further work.

In summary, acute withdrawal of the statin in VSMC exposed to simvastatin induced rapid upregulation of AT1-R coupled with increased AngII signaling. AT1-R upregulation was preceded by increased mRNA-AT1-R concentrations. Further investigation is required to determine whether upregulation of AT1 receptors plays a role in the vascular dysfunction and increased rate of cardiovascular events after acute statin withdrawal in humans.