Secondary Logo

Journal Logo

Pain and Analgesic Mechanisms: Research Report

Electroacupuncture Relieves Nerve Injury–Induced Pain Hypersensitivity via the Inhibition of Spinal P2X7 Receptor–Positive Microglia

Xu, Jin MD; Chen, Xue-Mei MD; Zheng, Bei-Jie MD; Wang, Xiang-Rui MD, PhD

Author Information
doi: 10.1213/ANE.0000000000001097

Neuropathic pain induced by peripheral nerve injury remains a prevalent and severe problem that affects millions of individuals. Electroacupuncture (EA) has been identified as a viable therapeutic approach for treating tactile allodynia and thermal hyperalgesia, which are 2 symptoms of neuropathic pain1,2; however, the underlying mechanisms of the effects of EA on neuropathic pain remain unclear.

Spinal microglia are immediately activated after nerve injury and play a pivotal role in neuropathic pain initiation and maintenance.3 Emerging evidence indicates that spinal microglia are an important target of EA in the analgesic effects related to both tactile allodynia and thermal hyperalgesia.4,5 Furthermore, our previous study indicated that the inhibition of spinal P2X4 receptor–positive microglia (P2X4R+), a subgroup of microglia that expresses the purinergic receptor P2X4, mediated the analgesic effect of EA on tactile allodynia in rats who underwent chronic constriction injury (CCI).6 However, no evidence has suggested whether P2X4R leads to thermal hyperalgesia.7,8 Thus, other receptors expressed on microglia may be responsible for the therapeutic effect of EA on thermal hyperalgesia after nerve injury.

Previous studies have indicated that the P2X7 receptor (P2X7R), another subtype of purinergic receptor expressed on microglia, was also up-regulated in the spinal cord after nerve injury.9,10 Pharmacologic blockade or genetic knockout of P2X7R dramatically reduced not only tactile allodynia but also thermal hyperalgesia in neuropathic pain models.10–12 Given the significant effect of EA on thermal hyperalgesia, it would be of considerable interest to examine whether EA exerts its therapeutic effect via the inhibition of spinal P2X7R-positive microglia (P2X7R+ microglia) activation.

The question arises as to how the inhibited spinal P2X7R+ microglia mediate the relief of pain hypersensitivity. P2X7R+ microglia have been demonstrated to play a critical role in interleukin (IL)-1β and/or IL-18 expression in numerous models.13–16 Both IL-1β and IL-18, which belong to the same gene family, are increased in the spinal cord after nerve injury and have been demonstrated to be involved in the pathogenesis of pain hypersensitivity.17–21 In particular, IL-1 knockout mice recovered faster than wild-type mice in neuropathic and inflammatory pain models22; however, the antihyperalgesic activity of a selective P2X7R antagonist on these mice was lost.23 These findings suggest that IL-1β and/or IL-18 may be crucial factors in the downstream pathway of spinal P2X7R+ microglia–mediated neuropathic pain.

EA relieved both tactile allodynia and thermal hyperalgesia after nerve injury, whereas the inhibition of spinal P2X4R+ microglia only mediated therapeutic effect of EA on tactile allodynia. Thus, we hypothesized that EA treatment relieves nerve injury–induced thermal hyperalgesia through the inhibition of spinal P2X7R+ microglia–mediated IL-1β and/or IL-18 overexpression. We identified changes in P2X7R, IL-1β, and IL-18 in the spinal dorsal horn in a CCI rat model after EA treatment. The selective P2X7R antagonist A-438079 and the P2X7R agonist 3′-O-(4-benzoylbenzoyl) adenosine 5′-triphosphate (BzATP) were also used to investigate the underlying mechanisms.

METHODS

Animals

Five hundred fifty-eight adult male Sprague-Dawley rats that weighed 200 to 250 g were purchased from SLAC Laboratory Animal Co., Ltd. (Shanghai, China). For the behavioral tests, each group comprised 12 rats. For the other experiments, each group comprised 6 rats. The rats were housed in a temperature-controlled (22°C –24°C) room with a 12/12-hour light–dark cycle and ad libitum access to food and water. Before the experiment, rats were allowed to acclimate to the housing facilities and were handled daily for at least 3 days. The animals were killed using an air-tight carbon dioxide chamber after completion of the experiment. All experimental protocols were approved by the Animal Care Committee of Shanghai Jiao Tong University (Shanghai, China) and were conducted in accordance with the policies issued by the National Institutes of Health and the International Association for the Study of Pain.

Surgical Procedures

Rats were subjected to CCI surgery as described previously.24 Briefly, rats were anesthetized with 2.5% isoflurane. The right common sciatic nerve was exposed at the mid-thigh level. Four 4-0 chromic gut sutures were tied loosely around the nerve at approximately 1-mm intervals. This approach ensured circulation through the epineural vasculature was preserved. The sham group underwent surgery; however, no catgut ties were administered after sciatic nerve exposure.

For intrathecal drug administration, catheterization of the lumbar enlargement was performed accordance with a previously described method.25 After anesthesia, rats were implanted with a 32-gauge intrathecal catheter (ReCathCo, Allison Park, PA). After 7 days of recovery, rats were intrathecally administered lipopolysaccharide (LPS; Escherichia coli 0111:B4; 2 μg/rat; Sigma-Aldrich, St. Louis, MO),16 the selective P2X7R antagonist A-438079 (35 μg/rat; Abcam, Cambridge, UK),26 the P2X7R agonist BzATP (0.5 μg/rat; Sigma-Aldrich),26 or artificial cerebrospinal fluid (in millimolar: 126 NaCl, 2.5 KCl, 1.25 NaH2PO4 H2O, 26 NaHCO3, 25 dextrose, 2 MgSO4, and 2 CaCl2) using a 25-μL Hamilton syringe.

EA Treatment

The equivalent of the human acupoint Huantiao (GB30) was used in this study, which is located at the lateral 1/3 and medial 2/3 of the distance between the sacral hiatus and the greater trochanter of femur.4–6 Stainless steel needles were bilaterally inserted into the Huantiao point at a depth of approximately 7 mm. A 2-Hz frequency and a 2-mA intensity were applied using an electrical stimulation device (HANS LH-202, Huawei Co. Beijing, China) for 30 minutes per day.6 Treatment was initiated on the day after CCI surgery or BzATP intrathecal injection and lasted for 14 days.

Microglia Culture

Primary cultured microglia cells were prepared as described previously.27 Briefly, a mixed glial culture was prepared from the cerebral cortex of neonatal Sprague-Dawley rats and maintained in Dulbecco’s Modified Eagle’s Medium with 10% fetal bovine serum; the medium was changed every 3 days. After 10 to 16 days, microglial cells were isolated from the mixed glial culture as floating cells through a gentle shake of the culture flasks. The resulting cell suspension was transferred to plastic dishes and allowed to adhere. For cell culture treatments, 1 μg/mL of LPS was first added to the microglia for 2 hours, and the medium was then removed and discarded.14 A-438079 (100 μM) was subsequently applied to the microglia followed 15 minutes later by a BzATP (300 μM) challenge.14,28 The plates were incubated for 30 minutes, and the supernatants were subsequently collected to analyze IL-1β and IL-18 levels using the Rat IL-1β Quantikine ELISA kit (R&D Systems, Minneapolis, MN) and the Rat IL-18 Quantikine ELISA kit (MyBioSource, San Diego, CA). ASCF was administered as a control for LPS, BzATP, or A-438079.

Behavioral Tests

Paw withdrawal threshold (PWT) was evaluated using a von Frey test as described previously.6 After 3 days of acclimation to the test chambers, a calibrated series of von Frey hairs in ascending order (0.6, 1, 1.4, 2, 4, 6, 8, 10, 15, and 26 g) was applied to the central region of the plantar surface of the right hindpaw. Each rat received 5 consecutive applications, and 3 withdrawals were considered responsive. The interstimulus interval for each trial was at least 5 seconds. The PWT was ultimately defined as the lowest hair force that produced withdrawal responses.

Paw withdrawal latency (PWL) was evaluated using a Hargreaves’ test with an Analgesy-meter (UgoBasile, Comerio VA, Italy) following the manufacturer’s instructions. Radiant heat was applied to the hindpaw after acclimation, and the time for the rats to remove their hindpaws was defined as the PWL. Each heat stimulus was applied 3 times at 5-minute intervals. A cutoff time of 20 seconds was applied in these experiments to prevent potential tissue damage. Both behavioral tests were conducted 30 minutes after EA treatments or A-438079 intrathecal injection.

Quantitative Real-Time Polymerase Chain Reaction

Total RNA was isolated from the L4-L5 spinal cord segments. Processing for quantitative real-time polymerase chain reaction (PCR) was conducted as described previously.29 The primers for PCR were obtained from Invitrogen (Carlsbad, CA): P2X7R, sense AATGAGTCCCTGTTCCCTGGCTAC, antisense CAGTTCCAAGAAGTCCGTCTGG; IL-1β, sense GGAAGGCAGTGTCACTCATTGTG, antisense G G T C C T C A T C C T G G A A G C T C C; IL-18, sense G G C A G A C T T C A C T G T A C A A C C G CA, antisense T G TC C T C G A A C A C A G G C G G GT; and glyce raldehyde-3-phos phate dehydro genase, sense CC C C C A A T G T A T C C G T T G T G, antisense TAGC C C A G G A T G C C C T T T A GT.

Western Blot Analysis

The spinal sample preparation was performed as described previously.9 The protein concentration extracted from the L4-L5 spinal cord segments was determined using the DC protein assay (Bio-Rad, Hercules, CA). Equivalent proteins were subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and electrophoretically transferred onto nitrocellulose membranes. The membranes were blocked with 1% bovine serum albumin and then incubated with anti-rat P2X7R polyclonal antibody (1:2,000; Alomone) or β-actin polyclonal antibody (1:4,000; Sigma-Aldrich) overnight at 4°C. The next day, membranes were incubated with horse-radish peroxidase–conjugated secondary antibody (1:8,000; Sigma-Aldrich). The blots were then visualized using the chemiluminescence method (ECL system, GE Healthcare, Chalfont St. Giles, UK) and exposed to radiography films. Immunoreactive density was analyzed using ImageJ (National Institutes of Health, Bethesda, MD). The specific bands were normalized against the loading control (β-actin).

Enzyme-Linked Immunosorbent Assay

The spinal sample preparation was performed as described previously.6,30 After predefined survival times, the L4-L5 spinal cord segments were rapidly removed and homogenized in 250 μL of 0.01 M phosphate-buffered saline (pH 7.4) that contained complete protease inhibitor cocktail (Roche Diagnostics, Basel, Switzerland). After incubation on ice for 5 minutes, the homogenate was centrifuged at 10,000 g for 10 minutes. The protein concentration of each extract was determined by a DC protein assay. Enzyme-linked immunosorbent assay (ELISA) was performed using the Rat IL-1β Quantikine ELISA kit (R&D Systems) and the Rat IL-18 Quantikine ELISA kit (MyBioSource) following the manufacturer’s instructions.

Immunofluorescence Staining

The rats were deeply anaesthetized and transcardially perfused with 0.9% saline solution followed by 4% paraformaldehyde and 4% sucrose in 0.1 M phosphate buffer (pH 7.4). The L4-L5 segments of the spinal cord were then immediately removed, postfixed in the same perfusion fixative for 4 hours, and cryoprotected in 30% sucrose in phosphate buffer for 24 to 48 hours at 4°C. Transverse sections (14 μm) were cut on a cryostat, blocked with 10% normal goat serum in 0.01 M phosphate-buffered saline (pH 7.4) with 0.3% Triton-X-100 for 1 hour at room temperature, and incubated for 48 hours at 4°C with a mixture of rabbit anti-P2X7R (1:200; Alomone) and mouse anti-OX42 for microglia cells (1:100; Millipore, Billerica, MA). The sections were subsequently incubated for 2 hours at room temperature with Alexa Fluor TM 488-conjugated goat anti-rabbit IgG (1:500; Molecular Probes, Carlsbad, CA), Alexa Fluor TM 594-conjugated goat anti-mouse IgG (1:500; Molecular Probes), and DAPI (1:1,000; Sigma-Aldrich). Omission of the primary antibody served as a negative control. Stained sections were examined with a fluorescence microscope (Nikon ECLIPSE 80i, Tokyo, Japan).

Statistical Analysis

The data are presented as the mean and SEM. Both the pre-CCI and pre-BzATP treatment baseline measurements for PWT and PWL were analyzed using 1-way analysis of variance (ANOVA). The posttreatment time course measures for PWT and PWL results were analyzed using repeated measures ANOVA followed by Bonferroni post hoc tests. Posttreatment time course measures for real-time PCR, Western blot, and ELISA results were analyzed using 2-way ANOVA (treatment × time) followed by Bonferroni post hoc tests. A difference was considered significant if P < 0.01.

RESULTS

EA Treatment Relieved CCI-Induced Tactile Allodynia and Thermal Hyperalgesia

F1-35
Figure 1:
Electroacupuncture (EA) treatment relieved chronic constriction injury (CCI)–induced tactile allodynia and thermal hyperalgesia. The paw withdrawal threshold (A) was significantly increased by EA treatment starting on day 5 compared with the CCI rats. The increase was amplified on days 7, 10, and 14 (n = 12). Mean (SEM); **P < 0.01 (EA versus CCI, P = 0.0011 on day 5, P = 0.0009 on day 7), ***P < 0.0001. The paw withdrawal latency (B) was significantly increased by EA treatment starting on day 7 compared with the CCI rats. The increase was amplified on days 10 and 14 (n = 12). Mean (SEM); *P < 0.05 (EA versus CCI, P = 0.0113 on day 5); **P < 0.01 (EA versus CCI, P = 0.0016 on day 7, P = 0.0003 on day 10); ***P < 0.0001.

Baseline PWT and PWL measures on the hindpaws were not significantly different among the groups before CCI surgery. The PWT and PWL of the sham group remained stable for 14 days. Animals with sciatic nerve constriction exhibited evident tactile allodynia and thermal hyperalgesia in the ipsilateral hindpaw within 1 day, and these conditions persisted for 14 days (n = 12, F(2,231) = 68.68, P < 0.0001 for PWT and n = 12, F(2,231) = 19.36, P < 0.0001 for PWL; denominator for Bonferroni correction = 3, CCI versus Sham, P < 0.0001 for PWT and P < 0.0001 for PWL; Mauchly test for sphericity, P = 0.0054 for PWT and P < 0.0001 for PWL; Fig. 1, A and B). Repeated measures ANOVA revealed significant interactions between time and treatment (F(14,231) = 7.48, P < 0.0001 for PWT and F(14,231) = 11.29, P < 0.0001 for PWL; Fig. 1, A and B). EA treatment at the Huantiao acupoint increased PWT and PWL; this difference was significant compared with CCI rats starting on day 5 for PWT and starting on day 7 for PWL (denominator for Bonferroni correction = 3, EA versus CCI, P < 0.0001 for PWT and P = 0.0089 for PWL; Fig. 1, A and B).

EA Treatment Inhibited Spinal P2X7R+ Microglia Activation in CCI Rats, Which Was Accompanied by Reductions in Spinal IL-1β and IL-18

The ipsilateral L4-L5 spinal cord of each group was extracted after behavioral tests. Real-time PCR indicated that EA decreased P2X7R expression starting on day 3 and persisted until day 14 compared with CCI rats (n = 6, F(2,45) = 39.51, P < 0.0001; denominator for Bonferroni correction = 3, EA versus CCI, P < 0.0001; interaction between time and treatment, F(4,45)=0.78, P=0.5448; Fig. 2A). Western blot analysis indicated a decrease in the P2X7R protein level after EA treatment (n = 6, F(2,45) = 27.22, P < 0.0001; denominator for Bonferroni correction = 3, EA versus CCI, P = 0.0001; interaction between time and treatment, F(4,45) = 0.81, P = 0.5227; Fig. 2B). Similar to the results of a previous study,9 P2X7R was significantly expressed on microglia, and marked activation of the P2X7R+ microglia was demonstrated to exclusively locate on the ipsilateral spinal dorsal horn of CCI rats on day 7 (Supplemental Digital Content 1, Supplemental Figure 1, https://links.lww.com/AA/B314). Prominent suppression of the P2X7R+ microglia in the ipsilateral spinal cord after EA treatment was also identified by immunofluorescence staining on day 7 (Fig. 2C).

F2-35
Figure 2:
Electroacupuncture (EA) treatment inhibited spinal P2X7 receptor–positive (P2X7R+) microglia activation in chronic constriction injury (CCI) rats. (A) Real-time polymerase chain reaction indicated that the P2X7R mRNA level in the spinal cord ipsilateral to the injured nerve postsurgery was decreased by EA treatment compared with the CCI rats (n = 6). Mean (SEM), **P < 0.01 (EA versus CCI, P = 0.0016 on day 3, P = 0.0008 on day 7, and P = 0.0093 on day 14). (B) Western blot analysis indicated that EA treatment decreased the P2X7R protein level in the ipsilateral spinal cord induced by CCI (n = 6). Mean (SEM), EA versus CCI, P = 0.1274 (99% Bonferroni-adjusted confidence interval, −0.7587 to 0.1685) on day 14; *P < 0.05 (EA versus CCI, P = 0.0214 on day 3, P = 0.0363 on day 7); **P < 0.01. (C) Immunofluorescence staining of the ipsilateral spinal dorsal horn indicated that EA treatment significantly inhibited the P2X7R+ microglia activation induced by CCI on day 7. P2X7R (green), OX42 (red), and 4',6-diamidino-2-phenylindole (DAPI; blue).
F3-35
Figure 3:
Electroacupuncture (EA) treatment attenuated chronic constriction injury (CCI)–induced interleukin (IL)-1β and IL-18 overexpression. Real-time polymerase chain reaction demonstrated that the IL-1β (A) and IL-18 (B) mRNA levels in the spinal cord ipsilateral to the injured nerve postsurgery were decreased by EA treatment compared with the CCI rats. Mean (SEM); *P < 0.05 (EA versus CCI, P = 0.0471 on day 7 and P = 0.0182 on day 14 for IL-1β, P = 0.0113 on day 7 and P = 0.0246 on day 14 for IL-18); **P < 0.01; ***P < 0.0001. Enzyme-linked immunosorbent assay indicated that EA treatment decreased the IL-1β (C) and IL-18 (D) protein levels in the ipsilateral spinal cord induced by CCI (n = 6). Mean (SEM); EA versus CCI, P = 0.0721 (99% Bonferroni-adjusted confidence interval, −16.7352 to 2.7198) on day 3 for IL-18; **P < 0.01 (EA versus CCI, P = 0.0002 on day 7 and P = 0.0002 on day 14 for IL-1β, P = 0.0002 on day 7 for IL-18); ***P < 0.0001.

IL-1β and IL-18 are potential downstream effectors of spinal P2X7R+ microglia; thus, we examined the effects of EA on spinal IL-1β and IL-18 expression levels. Real-time PCR data indicated that both the increase of IL-1β and IL-18 in the spinal cord of the CCI rats peaked on day 7 and persisted until day 14 (n = 6, F(2,45) = 30.64, P < 0.0001 for IL-1β and n = 6, F(2,45) = 30.12, P < 0.0001 for IL-18; denominator for Bonferroni correction = 3, CCI versus Sham, P < 0.0001 for IL-1β and P < 0.0001 for IL-18; interaction between time and treatment, F(4,45) = 1.37, P = 0.2598 for IL-1β and F(4,45) = 0.99, P = 0.4207 for IL-18; Fig. 3, A and B). ELISA data exhibited a similar increase at the protein level (n = 6, F(2,45) = 117.70, P < 0.0001 for IL-1β and n = 6, F(2,45) = 54.33, P < 0.0001 for IL-18; denominator for Bonferroni correction = 3, CCI versus Sham, P < 0.0001 for IL-1β and P < 0.0001 for IL-18; Fig. 3, C and D). Two-way ANOVA indicated significant interactions between time and treatment (F(4,45) =4.79, P = 0.0026 for IL-1β and F(4,45) = 4.89, P = 0.0023 for IL-18; Fig. 3, C and D). Daily EA treatment significantly suppressed mRNA IL-1β and IL-18 levels (denominator for Bonferroni correction = 3, EA versus CCI, P = 0.0011 for IL-1β and P < 0.0001 for IL-18; Fig. 3, A and B); similar results were also demonstrated at the protein level. The decrease was exhibited on day 7 and 14 for IL-1β and was exhibited on day 7 for IL-18 (denominator for Bonferroni correction = 3, EA versus CCI, P < 0.0001 for IL-1β and P < 0.0001 for IL-18; Fig. 3, C and D).

Spinal P2X7R+ Microglia–Dependent Release of IL-1β Played a Crucial Role in the CCI-Induced Tactile Allodynia and Thermal Hyperalgesia

To investigate the functional relevance of activated P2X7R+ microglia in nerve injury–induced pain hypersensitivity, A-438079, a selective P2X7R antagonist, was intrathecally administered. Daily injection of A-438079 (35 μg/rat) was initiated the day after CCI surgery and maintained for 14 days.26 Intrathecal administration of A-438079 in CCI rats increased PWT and PWL, respectively, from day 3 and day 7 and gradually exhibited significant differences compared with CCI rats administered ASCF as the vehicle control (n = 12, F(3,308) = 68.38, P < 0.0001 for PWT and n = 12, F(3,308) = 27.58, P < 0.0001 for PWL; denominator for Bonferroni correction = 6, CCI + A-43 versus CCI, P < 0.0001 for PWT and P = 0.0006 for PWL; Mauchly test for sphericity, P < 0.0001 for PWT and P = 0.0139 for PWL; Fig. 4, A and B). Repeated measures ANOVA revealed significant interactions between time and treatment (F(21,308) = 4.18, P < 0.0001 for PWT and F(21,308) = 12.53, P < 0.0001 for PWL; Fig. 4, A and B). Compared with control rats administered ASCF, intrathecal injection of A-438079 in control rats did not change PWT or PWL on either testing day.

F4-35
Figure 4:
Intrathecal injection of A-438079 significantly relieved the pain hypersensitivity and inhibited the interleukin (IL)-1β expression induced by chronic constriction injury (CCI). Intrathecal A-438079 administration in CCI rats began to increase the paw withdrawal threshold (PWT; A) and paw withdrawal latency (PWL; B), respectively, on day 7 and day 3, and these levels gradually exhibited a significant difference compared with the CCI rats administered artificial cerebrospinal fluid (n = 12). Mean (SEM); CCI + A-43 versus CCI, P = 0.0603 (99% Bonferroni-adjusted confidence interval, −0.8088 to 7.4088) on day 3 for PWT; *P < 0.05 (CCI + A-43 versus CCI, P = 0.0158 on day 5 for PWT); **P < 0.01 (CCI + A-43 versus CCI, P = 0.0066 on day 7, P = 0.0013 on day 10, and P = 0.0001 on day 14 for PWT; P = 0.0007 on day 3, P = 0.0010 on day 5, and P = 0.0002 on day 7 for PWL); ***P < 0.0001. Real-time polymerase chain reaction demonstrated that the IL-1β (C) and IL-18 (D) mRNA levels in the spinal cord ipsilateral to the injured nerve postsurgery were only minimally decreased by A-438079 administration compared with the CCI rats (n = 6). Mean (SEM); CCI + A-43 versus CCI, P = 0.1295 (99% Bonferroni-adjusted confidence interval, −1.4281 to 0.2655) on day 14 for IL-1β; *P < 0.05 (CCI + A-43 versus CCI, P = 0.0342 on day 14 for IL-18); **P < 0.01; ***P < 0.0001. Enzyme-linked immunosorbent assay results indicated that intrathecal A-438079 administration decreased the protein level of IL-1β (E) but not IL-18 (F) in the ipsilateral spinal cord induced by CCI (n = 6). Mean (SEM); CCI + A-43 versus CCI, P = 0.0539 (99% Bonferroni-adjusted confidence interval, −12.2321 to 1.3814) on day 7 for IL-18; **P < 0.01 (CCI + A-43 versus CCI, P = 0.0007 on day 3 for IL-1β); ***P < 0.0001.

We subsequently examined whether P2X7R+ microglia caused tactile allodynia and thermal hyperalgesia through overexpression of IL-1β and IL-18. We demonstrated that intrathecal administration of A-438079 in CCI rats significantly suppressed the IL-1β protein level from day 3, an effect which persisted on days 7 and 14, compared with CCI rats administered ASCF (n = 6, F(3,60) = 125.07, P < 0.0001 for IL-1β and n = 6, F(3,60) = 56.98, P < 0.0001 for IL-18; denominator for Bonferroni correction = 6, CCI + A-43 versus CCI, P < 0.0001 for IL-1β and P = 0.0993, 99% Bonferroni-adjusted confidence interval, −8.5248 to 1.2240 for IL-18; interaction between time and treatment, F(6,60) = 2.74, P = 0.0203 for IL-1β and F(6,60) = 3.22, P = 0.0084 for IL-18; Fig. 4, E and F). However, A-438079 had little effect on the mRNA level of IL-1β (n = 6, F(3,60) = 51.78, P < 0.0001 for IL-1β and n = 6, F(3,60) = 23.91, P < 0.0001 for IL-18; denominator for Bonferroni correction = 6, CCI + A-43 versus CCI, P = 0.3341 for IL-1β and P = 0.1241, 99% Bonferroni-adjusted confidence interval, −0.6981 to 0.1128 for IL-18; interaction between time and treatment, F(6,60) = 2.84, P = 0.0168 for IL-1β and F(6,60) = 0.99, P = 0.4414 for IL-18; Fig. 4, C and D). Real-time PCR and ELISA results also indicated that intrathecal injection of A-438079 in control rats had no effect on expression levels of IL-1β and IL-18 compared with control rats administered ASCF.

Selective P2X7R Antagonist Significantly Attenuated the IL-1β Expression Induced by LPS and BzATP Stimulation Both In Vitro and In Vivo

Primary cultured microglial cells were used to further explore the involvement of P2X7R+ microglia in the processing and release of IL-1β and IL-18. A single dose of 300 μM of the P2X7R agonist BzATP14 to microglial cells was demonstrated to lead to the release of both IL-1β and IL-18. After the cells were primed with a small dose of LPS (1 μg/mL),14 IL-1β and IL-18 release induced by BzATP was significantly increased compared with cells primed with LPS alone. In addition, the preapplication of 100 μM A-43807928 attenuated the increased IL-1β level in the supernatant induced by both BzATP alone (n = 6, F(7,40) = 824.39, P < 0.0001; denominator for Bonferroni correction = 28, BzATP + A-43 versus BzATP, P < 0.0001) and BzATP primed with LPS (denominator for Bonferroni correction = 28, LPS + BzATP + A-43 versus LPS + BzATP, P < 0.0001; Supplemental Digital Content 2, Supplemental Figure 2A, https://links.lww.com/AA/B315), without alterations in baseline levels. However, A-438079 pretreatment had little effect on IL-18 (Supplemental Digital Content 2, Supplemental Figure 2B, https://links.lww.com/AA/B315).

A single administration of BzATP (0.5 μg/rat) was intrathecally (Supplemental Digital Content 2, Supplemental Figure 2B, https://links.lww.com/AA/B315) injected into control rats.26 In this study, LPS significantly enhanced the effect of BzATP on the processing of IL-1β in cultured microglial cells; thus, 24 hours before BzATP injection, a small dose of LPS (2 μg/rat) was intrathecally injected.16 Furthermore, A-438079 (35 μg/rat) was administered 30 minutes before the BzATP injection to further examine whether the P2X7R antagonist could reverse pain hypersensitivity and excessive release of IL-1β and IL-18 induced by BzATP after priming with LPS.26

F5-35
Figure 5:
Intrathecal preinjection of A-438079 blocked the tactile allodynia and thermal hyperalgesia induced by lipopolysaccharide (LPS) combined with 3′-O-(4-benzoylbenzoyl) adenosine 5′-triphosphate (BzATP) administration, whereas daily electroacupuncture (EA) treatment gradually relieved the pain hypersensitivity and P2X7 receptor (P2X7R) overexpression. The decreases in the paw withdrawal threshold (PWT; A) and paw withdrawal latency (PWL; B) induced by LPS and BzATP were dramatically suppressed by A-438079 or EA treatment (n = 12). Mean (SEM); *P < 0.05 (BzATP + LPS + EA versus BzATP + LPS, P = 0.0305 on day 5, P = 0.0240 on day 7, and P = 0.0122 on day 14 for PWT, P = 0.0195 on day 5, P = 0.0250 on day 7, P = 0.0197 on day 10, and P = 0.0166 on day 14 for PWL); **P < 0.01 (BzATP + LPS + EA versus BzATP + LPS, P = 0.0085 on day 10 for PWT). EA treatment also inhibited the spinal P2X7R-positive (P2X7R+) microglia activation induced by LPS and BzATP administration. Real-time polymerase chain reaction (PCR) (C) and western blot analysis (D) indicated that EA treatment decreased the spinal P2X7R mRNA and protein levels (n = 6). L + B = LPS + BzATP; L + B + E = LPS + BzATP + EA. Mean (SEM); *P < 0.05 (BzATP + LPS + EA versus BzATP + LPS, P = 0.0359 on day 3 for PCR, P = 0.0118 on day 7 for Western blot); **P < 0.01 (BzATP + LPS + EA versus BzATP + LPS, P = 0.0050 on day 7 for PCR, P = 0.0066 on day 3 for Western blot).
F6-35
Figure 6:
Intrathecal preinjection of A-438079 suppressed the lipopolysaccharide (LPS) combined with 3′-O-(4-benzoylbenzoyl) adenosine 5′-triphosphate (BzATP) administration–induced increase in the interleukin (IL)-1β protein level, whereas daily electroacupuncture (EA) treatment inhibited both IL-1β and IL-18 expressions induced by LPS and BzATP administration. Real-time polymerase chain reaction indicated that the IL-1β (A) and IL-18 (B) mRNA levels were decreased by EA treatment (n = 6). Mean (SEM); BzATP + LPS + EA versus BzATP + LPS, P = 0.0513 (99% Bonferroni-adjusted confidence interval, −1.1562 to 0.1262) on day 7 for IL-1β; *P < 0.05 (BzATP + LPS + EA versus BzATP + LPS, P = 0.0302 on day 14 for IL-1β, P = 0.0266 on day 3 for IL-18); **P < 0.01. Enzyme-linked immunosorbent assay results indicated that the IL-1β (C) protein level was inhibited by A-438079 or EA treatment, whereas the IL-18 (D) protein level was decreased by EA treatment (n = 6). Mean (SEM); BzATP + LPS + EA versus BzATP + LPS, P = 0.1406 (99% Bonferroni-adjusted confidence interval, −22.9198 to 4.4334) on day 7 for IL-18; *P < 0.05 (BzATP + LPS + EA versus BzATP + LPS, P = 0.0100 on day 14 for IL-18); **P < 0.01 (BzATP + LPS + EA versus BzATP + LPS, P = 0.0016 on day 3, P = 0.0055 on day 7, and P = 0.0002 on day 14 for IL-1β); ***P < 0.0001.

The results demonstrated that intrathecal injection of BzATP after priming with LPS induced marked and long-lasting tactile allodynia and thermal hyperalgesia. PWT and PWL applied to the hindpaw progressively decreased within 1 day, and this effect persisted for at least 14 days after drug administration (n = 12, F(3,308) = 72.16, P < 0.0001 for PWT and n = 12, F(3,308) = 25.07, P < 0.0001 for PWL; denominator for Bonferroni correction = 6, LPS + BzATP versus Sham, P < 0.0001 for PWT and P < 0.0001 for PWL; Mauchly test for sphericity, P = 0.0525 for PWT and P < 0.0001 for PWL; Fig. 5, A and B). Repeated measures ANOVA revealed significant interactions between time and treatment (F(21,308) = 4.50, P < 0.0001 for PWT and F(21,308) = 11.16, P < 0.0001 for PWL; Fig. 5, A and B). These changes in the behavioral tests were dramatically suppressed by intrathecal pretreatment of A-438079 (denominator for Bonferroni correction = 6, LPS + BzATP + A-43 versus LPS + BzATP, P < 0.0001 for PWT and P < 0.0001 for PWL; Fig. 5, A and B). In accordance with the development of tactile allodynia and thermal hyperalgesia after LPS and BzATP administration, increases in IL-1β and IL-18 mRNA and protein levels were identified starting on day 3 and persisted for at least 10 days compared with vehicle administration. Consistent with the effect of A-438079 in cultured microglia, pretreatment with A-438079 significantly suppressed the increased IL-1β protein level (n = 6, F(3,60) = 16.20, P < 0.0001 for real-time PCR and n = 6, F(3,60) = 72.66, P < 0.0001 for ELISA; denominator for Bonferroni correction = 6, LPS + BzATP + A-43 versus LPS + BzATP, P = 0.1360, 99% Bonferroni-adjusted confidence interval, −0.6060 to 0.1026 for real-time PCR and P < 0.0001 for ELISA; interaction between time and treatment, F(6,60) = 0.30, P = 0.9351 for real-time PCR and F(6,60) = 1.89, P = 0.0975 for ELISA; Fig. 6, A and C). However, A-438079 had little effect on IL-18 expression at the mRNA and protein levels (n = 6, F(3,60) = 12.33, P < 0.0001 for real-time PCR and n = 6, F(3,60) = 30.51, P < 0.0001 for ELISA; denominator for Bonferroni correction = 6, LPS + BzATP + A-43 versus LPS + BzATP, P = 1.0000 for real-time PCR and P = 0.6631 for ELISA; interaction between time and treatment, F(6,60) = 0.68, P = 0.6643 for real-time PCR and F(6,60) = 2.07, P = 0.0705 for ELISA; Fig. 6, B and D).

EA-Induced Analgesia Was Also Achieved in Naive Rats with Intrathecal Injection of LPS and BzATP

To confirm whether EA treatment exerted an analgesic effect through the modulation of P2X7R+ microglia, EA treatment was initiated on the day after intrathecal LPS and BzATP administration and administered once per day for 14 days. Daily EA treatment significantly increased PWT induced by LPS and BzATP (denominator for Bonferroni correction = 6, LPS + BzATP + EA versus LPS + BzATP, P = 0.0007 for PWT and P = 0.0605, 99% Bonferroni-adjusted confidence interval, −0.4340 to 3.9673 for PWL; Fig. 5, A and B). Real-time PCR data demonstrated that LPS and BzATP administration increased spinal P2X7R expression from day 7, and this effect could be suppressed by EA treatment (n = 6, F(2,45) = 18.42, P < 0.0001; denominator for Bonferroni correction = 3, LPS + BzATP + EA versus LPS + BzATP, P < 0.0001; interaction between time and treatment, F(4,45) = 0.93, P = 0.4579; Fig. 5C). Western blot analysis indicated that the spinal P2X7R protein level was inhibited by EA treatment compared with rats administered LPS and BzATP (n = 6, F(2,45) = 31.20, P < 0.0001; denominator for Bonferroni correction = 3, LPS + BzATP + EA versus LPS + BzATP, P < 0.0001; interaction between time and treatment, F(4,45) = 1.24, P = 0.3090; Fig. 5D). Daily EA treatment also reduced enhanced IL-1β expression induced by LPS and BzATP (denominator for Bonferroni correction = 6, LPS + BzATP + EA versus LPS + BzATP, P < 0.0001 for real-time PCR and P < 0.0001 for ELISA; Fig. 6, A and C). Consistent with the effect of EA on CCI rats, EA also reduced release of IL-18 induced by LPS and BzATP (denominator for Bonferroni correction = 6, LPS + BzATP + EA versus LPS + BzATP, P = 0.0021 for real-time PCR and P < 0.0001 for ELISA; Fig. 6, B and D).

DISCUSSION

The current findings demonstrated that EA treatment relieved nerve injury–induced tactile allodynia and thermal hyperalgesia through inhibition of spinal P2X7R+ microglia–mediated IL-1β overexpression. These findings indicate the underlying mechanisms of EA’s therapeutic effect on thermal hyperalgesia as it pertains to purinergic receptor family modulation.

Spinal microglia were immediately activated after nerve injury and were necessary for pain hypersensitivity initiation and maintenance.3 As ATP receptors, to date, only 2 ionotropic P2X receptors, P2X4R and P2X7R, have been demonstrated to be predominately expressed on microglia in the spinal cord.9,10,16,27 After binding with its ligand ATP, microglial ionotropic P2X receptors led to a more substantial degree of microglia activation, which eventually exaggerated the pain states. Our previous study has demonstrated a crucial role of spinal P2X4R+ microglia in the analgesic effect of EA on tactile allodynia in CCI rats.6 However, inhibition of spinal P2X4R+ microglia only significantly relieved tactile allodynia induced by nerve injury, but not thermal hyperalgesia.7 Furthermore, P2X4R knockout increased the sensitivity to thermal hyperalgesia in an inflammatory mouse model.8 Spinal P2X7R+ microglia exhibited a pivotal role in both thermal hyperalgesia and tactile allodynia. The blockade of P2X7R with an antagonist or the genetic knockout of P2X7R inhibited tactile allodynia and thermal hyperalgesia induced by nerve injury, whereas normal nociceptive processing was preserved.10–12 Thus, we provided compelling evidence that P2X7R+ microglia activation was also suppressed by EA treatment and mediated EA’s therapeutic effect on thermal hyperalgesia.

We also addressed the question of how P2X7R+ microglia inhibition mediates EA’s therapeutic effect on neuropathic pain. When P2X7R+ microglia bind to the extracellular ligand ATP, various cellular responses are evoked, as well as the subsequent production of cytokines.13,14 In the spinal cord, IL-1β and IL-18 are mainly released by microglia15,16 and are increased after nerve injury.17,18 Functional inhibition of IL-1β and IL-18 signaling pathways suppressed nerve injury–induced pain hypersensitivity. In contrast, intrathecal injection of IL-1β and IL-18 induced behavioral and biochemical changes similar to changes observed after nerve injury.17–21 In this study, we demonstrated that EA treatment significantly reduced the increased release of IL-1β and IL-18 in CCI rats.

Notably, pharmacologic inhibition of spinal P2X7R+ microglia with A-438079 suppressed up-regulation of the IL-1β protein level; however, it had little effect on the mRNA level. This finding might be interpreted according to the previous studies that regarded the release of IL-1β from microglia as a 2-step process. The first step required IL-1β gene transcription and pro-IL-1β accumulation in response to inflammatory stimuli, whereas the second step involved maturation of IL-1β in preparation for its release. P2X7R+ microglia activation by ATP only played a critical role in this posttranslational processing.16,31,32 EA treatment attenuated IL-1β mRNA overexpression; thus, EA treatment may exert a specific effect on the first step of IL-1β processing through other mechanisms. Moreover, because LPS has been demonstrated to be necessary for the first step,32 in this study, the rats were administered a small dose of LPS to prime the microglia before intrathecal injection of BzATP.

Although it is generally accepted that IL-1β and IL-18 are siblings with structural homology and share the IL-1β-converting enzyme, whether IL-18 is released by P2X7R+ microglia remains controversial. Chen et al.15 provided evidence that P2X7R+ microglia mediated IL-18 secretion in the spinal cord, whereas an in vitro experiment conducted by Hanamsagar et al.33 demonstrated that microglial IL-18 secretion occurred independent of P2X7R. In this study, we demonstrated that overexpression of IL-18 was significantly suppressed by EA treatment in CCI- or BzATP-treated rats. In contrast, IL-18 was only minimally inhibited by A-438079 either in vitro or in vivo. Because BzATP is not a selective agonist of P2X7R, it seemed that EA treatment–induced IL-18 suppression may occur through a distinct mechanism.

In addition to the excessive release of IL-1β and IL-18, we also identified spinal P2X7R up-regulation in rats treated with LPS and BzATP. According to the previous studies,34,35 the up-regulation of P2X7R could be induced by LPS or positive feedback of BzATP-dependent IL-1β release. Furthermore, we determined that daily EA treatment could also suppress P2X7R+ microglia activation in LPS- and BzATP-injected rats, which further suggested that EA treatment relieved pain hypersensitivity and decreased IL-1β overexpression through P2X7R+ microglia inhibition.

Several limitations of this study should be considered in the interpretation of these findings. First, the acupoint used in this study is the equivalent of human acupoint Huantiao (GB30), which has been identified as a viable therapeutic acupoint for pain hypersensitivity.4–6 Acupoint specificity is the basis for elucidating the actions of acupoints in clinical practice36; thus, whether EA at other acupoints relieves nerve injury–induced pain hypersensitivity through inhibition of P2X7R+ microglia remains to be further explored. Second, the underlying mechanisms by which EA treatment modulates P2X7R+ microglia remain unclear. EA has been demonstrated to regulate P2X4R+ microglia in an immunomodulation manner in which spinal interferon-γ release is inhibited.6 Further investigation is required to determine whether EA treatments regulate P2X7R+ microglia through similar mechanisms.

Taken together, the results of this study demonstrated that EA treatment relieved nerve injury–induced tactile allodynia and thermal hyperalgesia through inhibition of spinal P2X7R+ microglia–mediated IL-1β overexpression. Thus, spinal P2X7R+ microglia could be an important target for EA’s therapeutic effect on tactile allodynia and thermal hyperalgesia.

DISCLOSURES

Name: Jin Xu, MD.

Contribution: This author helped conduct the study and analyze the data.

Attestation: Jin Xu has seen the original study data, reviewed the analysis of the data, approved the final manuscript, and is the author responsible for archiving the study files.

Name: Xue-Mei Chen, MD.

Contribution: This author helped design the study and conduct the study.

Attestation: Xue-Mei Chen has seen the original study data, reviewed the analysis of the data, and approved the final manuscript.

Name: Bei-Jie Zheng, MD.

Contribution: This author helped analyze the data.

Attestation: Bei-Jie Zheng has seen the original study data, reviewed the analysis of the data, and approved the final manuscript.

Name: Xiang-Rui Wang, MD, PhD.

Contribution: This author helped design the study and write the manuscript.

Attestation: Xiang-Rui Wang has seen the original study data, reviewed the analysis of the data, and approved the final manuscript.

This manuscript was handled by: Jianren Mao, MD, PhD.

REFERENCES

1. Gim GT, Lee JH, Park E, Sung YH, Kim CJ, Hwang WW, Chu JP, Min BI. Electroacupuncture attenuates mechanical and warm allodynia through suppression of spinal glial activation in a rat model of neuropathic pain. Brain Res Bull. 2011;86:403–11
2. Yu J, Zhao C, Luo X. The effects of electroacupuncture on the extracellular signal-regulated kinase 1/2/P2X3 signal pathway in the spinal cord of rats with chronic constriction injury. Anesth Analg. 2013;116:239–46
3. Inoue K, Tsuda M. Microglia and neuropathic pain. Glia. 2009;57:1469–79
4. Sun S, Mao Ying QL, Cao H, Li TT, Han M, Pan H, Wang YQ, Zhao ZQ, Zhang YQ. Is functional state of spinal microglia involved in the anti-allodynic and anti-hyperalgesic effects of electroacupuncture in rat model of monoarthritis? Neurobiol Dis. 2007;26:558–68
5. Sun S, Cao H, Han M, Li TT, Zhao ZQ, Zhang YQ. Evidence for suppression of electroacupuncture on spinal glial activation and behavioral hypersensitivity in a rat model of monoarthritis. Brain Res Bull. 2008;75:83–93
6. Chen XM, Xu J, Song JG, Zheng BJ, Wang XR. Electroacupuncture inhibits excessive interferon-γ evoked up-regulation of P2X4 receptor in spinal microglia in a CCI rat model for neuropathic pain. Br J Anaesth. 2015;114:150–7
7. Biber K, Tsuda M, Tozaki-Saitoh H, Tsukamoto K, Toyomitsu E, Masuda T, Boddeke H, Inoue K. Neuronal CCL21 up-regulates microglia P2X4 expression and initiates neuropathic pain development. EMBO J. 2011;30:1864–73
8. Ulmann L, Hirbec H, Rassendren F. P2X4 receptors mediate PGE2 release by tissue-resident macrophages and initiate inflammatory pain. EMBO J. 2010;29:2290–300
9. He WJ, Cui J, Du L, Zhao YD, Burnstock G, Zhou HD, Ruan HZ. Spinal P2X(7) receptor mediates microglia activation-induced neuropathic pain in the sciatic nerve injury rat model. Behav Brain Res. 2012;226:163–70
10. Kobayashi K, Takahashi E, Miyagawa Y, Yamanaka H, Noguchi K. Induction of the P2X7 receptor in spinal microglia in a neuropathic pain model. Neurosci Lett. 2011;504:57–61
11. Honore P, Donnelly-Roberts D, Namovic MT, Hsieh G, Zhu CZ, Mikusa JP, Hernandez G, Zhong C, Gauvin DM, Chandran P, Harris R, Medrano AP, Carroll W, Marsh K, Sullivan JP, Faltynek CR, Jarvis MF. A-740003 [N-(1-{[(cyanoimino)(5-quinolinylamino) methyl]amino}-2,2-dimethylpropyl)-2-(3,4-dimethoxyphenyl)acetamide], a novel and selective P2X7 receptor antagonist, dose-dependently reduces neuropathic pain in the rat. J Pharmacol Exp Ther. 2006;319:1376–85
12. Chessell IP, Hatcher JP, Bountra C, Michel AD, Hughes JP, Green P, Egerton J, Murfin M, Richardson J, Peck WL, Grahames CB, Casula MA, Yiangou Y, Birch R, Anand P, Buell GN. Disruption of the P2X7 purinoceptor gene abolishes chronic inflammatory and neuropathic pain. Pain. 2005;114:386–96
13. Chakfe Y, Seguin R, Antel JP, Morissette C, Malo D, Henderson D, Séguéla P. ADP and AMP induce interleukin-1beta release from microglial cells through activation of ATP-primed P2X7 receptor channels. J Neurosci. 2002;22:3061–9
14. Rampe D, Wang L, Ringheim GE. P2X7 receptor modulation of beta-amyloid- and LPS-induced cytokine secretion from human macrophages and microglia. J Neuroimmunol. 2004;147:56–61
15. Chen ML, Cao H, Chu YX, Cheng LZ, Liang LL, Zhang YQ, Zhao ZQ. Role of P2X7 receptor-mediated IL-18/IL-18R signaling in morphine tolerance: multiple glial-neuronal dialogues in the rat spinal cord. J Pain. 2012;13:945–58
16. Clark AK, Staniland AA, Marchand F, Kaan TK, McMahon SB, Malcangio M. P2X7-dependent release of interleukin-1beta and nociception in the spinal cord following lipopolysaccharide. J Neurosci. 2010;30:573–82
17. Kim D, You B, Jo EK, Han SK, Simon MI, Lee SJ. NADPH oxidase 2-derived reactive oxygen species in spinal cord microglia contribute to peripheral nerve injury-induced neuropathic pain. Proc Natl Acad Sci USA. 2010;107:14851–6
18. Miyoshi K, Obata K, Kondo T, Okamura H, Noguchi K. Interleukin-18-mediated microglia/astrocyte interaction in the spinal cord enhances neuropathic pain processing after nerve injury. J Neurosci. 2008;28:12775–87
19. Sung CS, Wen ZH, Chang WK, Chan KH, Ho ST, Tsai SK, Chang YC, Wong CS. Inhibition of p38 mitogen-activated protein kinase attenuates interleukin-1beta-induced thermal hyperalgesia and inducible nitric oxide synthase expression in the spinal cord. J Neurochem. 2005;94:742–52
20. Sung CS, Wong CS. Cellular mechanisms of neuroinflammatory pain: the role of interleukin-1beta. Acta Anaesthesiol Taiwan. 2007;45:103–9
21. Sung CS, Cherng CH, Wen ZH, Chang WK, Huang SY, Lin SL, Chan KH, Wong CS. Minocycline and fluorocitrate suppress spinal nociceptive signaling in intrathecal IL-1β-induced thermal hyperalgesic rats. Glia. 2012;60:2004–17
22. Honore P, Wade CL, Zhong C, Harris RR, Wu C, Ghayur T, Iwakura Y, Decker MW, Faltynek C, Sullivan J, Jarvis MF. Interleukin-1alphabeta gene-deficient mice show reduced nociceptive sensitivity in models of inflammatory and neuropathic pain but not post-operative pain. Behav Brain Res. 2006;167:355–64
23. Honore P, Donnelly-Roberts D, Namovic M, Zhong C, Wade C, Chandran P, Zhu C, Carroll W, Perez-Medrano A, Iwakura Y, Jarvis MF. The antihyperalgesic activity of a selective P2X7 receptor antagonist, A-839977, is lost in IL-1alphabeta knockout mice. Behav Brain Res. 2009;204:77–81
24. Bennett GJ, Xie YK. A peripheral mononeuropathy in rat that produces disorders of pain sensation like those seen in man. Pain. 1988;33:87–107
25. Tian J, Gu Y, Su D, Wu Y, Wang X. Effects of intrathecal lidocaine on hyperalgesia and allodynia following chronic constriction injury in rats. Eur J Pain. 2009;13:130–7
26. Ito G, Suekawa Y, Watanabe M, Takahashi K, Inubushi T, Murasaki K, Hirose N, Hiyama S, Uchida T, Tanne K. P2X7 receptor in the trigeminal sensory nuclear complex contributes to tactile allodynia/hyperalgesia following trigeminal nerve injury. Eur J Pain. 2013;17:185–99
27. Tsuda M, Shigemoto-Mogami Y, Koizumi S, Mizokoshi A, Kohsaka S, Salter MW, Inoue K. P2X4 receptors induced in spinal microglia gate tactile allodynia after nerve injury. Nature. 2003;424:778–83
28. Gulinelli S, Salaro E, Vuerich M, Bozzato D, Pizzirani C, Bolognesi G, Idzko M, Di Virgilio F, Ferrari D. IL-18 associates to microvesicles shed from human macrophages by a LPS/TLR-4 independent mechanism in response to P2X receptor stimulation. Eur J Immunol. 2012;42:3334–45
29. Dijkstra IM, de Haas AH, Brouwer N, Boddeke HW, Biber K. Challenge with innate and protein antigens induces CCR7 expression by microglia in vitro and in vivo. Glia. 2006;54:861–72
30. Lin W, Bailey SL, Ho H, Harding HP, Ron D, Miller SD, Popko B. The integrated stress response prevents demyelination by protecting oligodendrocytes against immune-mediated damage. J Clin Invest. 2007;117:448–56
31. Sanz JM, Di Virgilio F. Kinetics and mechanism of ATP-dependent IL-1 beta release from microglial cells. J Immunol. 2000;164:4893–8
32. Takenouchi T, Sugama S, Iwamaru Y, Hashimoto M, Kitani H. Modulation of the ATP-lnduced release and processing of IL-1beta in microglial cells. Crit Rev Immunol. 2009;29:335–45
33. Hanamsagar R, Torres V, Kielian T. Inflammasome activation and IL-1β/IL-18 processing are influenced by distinct pathways in microglia. J Neurochem. 2011;119:736–48
34. Choi HB, Ryu JK, Kim SU, McLarnon JG. Modulation of the purinergic P2X7 receptor attenuates lipopolysaccharide-mediated microglial activation and neuronal damage in inflamed brain. J Neurosci. 2007;27:4957–68
35. Narcisse L, Scemes E, Zhao Y, Lee SC, Brosnan CF. The cytokine IL-1beta transiently enhances P2X7 receptor expression and function in human astrocytes. Glia. 2005;49:245–58
36. Zhao L, Chen J, Liu CZ, Li Y, Cai DJ, Tang Y, Yang J, Liang FR. A review of acupoint specificity research in china: status quo and prospects. Evid Based Complement Alternat Med. 2012;2012:543943

Supplemental Digital Content

© 2016 International Anesthesia Research Society