Secondary Logo

Journal Logo

Critical Care, Trauma, and Resuscitation: Research Reports

Low Tidal Volume and High Positive End-Expiratory Pressure Mechanical Ventilation Results in Increased Inflammation and Ventilator-Associated Lung Injury in Normal Lungs

Hong, Caron M. MD; Xu, Da-Zhong MD, PhD; Lu, Qi MD; Cheng, Yunhui PhD; Pisarenko, Vadim MD; Doucet, Danielle MD; Brown, Margaret MSN; Aisner, Seena MD; Zhang, Chunxiang MD, PhD; Deitch, Edwin A. MD; Delphin, Ellise MD, MPH

Author Information
doi: 10.1213/ANE.0b013e3181cfc416

Protective mechanical ventilation with low tidal volume (VT) and low plateau pressure has been shown to reduce mortality and decrease the length of mechanical ventilation in patients with acute respiratory distress syndrome (ARDS) compared with traditional high VT ventilation.1 Prospectively, the ARDS Network database revealed beneficial effects of decreasing VT from 12 mL/kg predicted body weight (PBW) to 6 mL/kg PBW regardless of plateau pressures.1 The efficacy of protective ventilation in acute lung injury (ALI) and ARDS has resulted in a progressive decrease in VT used by clinicians during surgery in patients with normal lungs. This practice has developed without evidence-based support. In a review, Schultz et al.2 recommended the use of VT <10 mL/kg, plateau pressure <15 to 20 cm H2O, and positive end-expiratory pressure (PEEP) >5 cm H2O to ventilate patients with normal lungs, based on expert opinion and currently available evidence.

Ventilator-induced lung injury (VILI) has been described after ventilation with high volume and pressure (barotrauma) and low volume secondary to cyclic opening and closure of peripheral airways.3,4 Ex vivo models of normal rodent lungs ventilated with physiologic VT caused functional alterations, histologic injury, and release of proinflammatory cytokines.5,6 Subsequent in vivo studies in normal anesthetized rabbits ventilated at low VTs revealed histologic injury and increases in airway resistance.7 Extensive histologic damage with airway closure results in cytokine release.8 Small-animal studies have demonstrated increases in cytokines, tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, and IL-8 with large VT and long-duration mechanical ventilation.5,6,9,10 Human prospective studies comparing mechanical ventilation strategies have had inconsistent results.1113 Studies of short-duration mechanical ventilation have found no differences in release of mediators. Others have demonstrated increased levels of inflammatory mediators and poorer outcomes in patients ventilated with large VTs for longer periods of time.1417

The ability to provide mechanical ventilation that will not injure and may protect normal lungs during major surgical procedures of long duration may improve postoperative outcomes and decrease morbidity and mortality. Our hypothesis was that low-VT/high-PEEP short-term (8 hours) “protective” ventilation would produce less pulmonary inflammation and injury than ventilation with high-VT or low-PEEP strategies in noninjured lungs. An in vivo animal study was performed that compared high- and low-VT ventilation strategies with different PEEP values.

METHODS

The study was approved by the New Jersey Medical School Animal Care and Use Committee. Female Yorkshire pigs (Animal Biotech Industries, Danboro, PA) weighing approximately 30 kg were acclimatized over a period of 5 to 7 days before procedures. The study strictly abided by the guidelines of the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Animal Preparation

Female pigs were anesthetized with ketamine (20 mg/kg, IM) and xylazine (2.0 mg/kg, IM) and placed in the supine position. Each animal was intubated with an endotracheal tube and end-tidal CO2 was verified. Anesthesia was maintained with 2 minimal alveolar concentration isoflurane. The femoral artery was cannulated with a 22-gauge catheter and used for continuous arterial blood pressure monitoring. The right carotid artery was cannulated with a 20-gauge catheter. This catheter tip was at the junction of the aortic arch and was verified postmortem. The internal jugular vein was cannulated with an 8F sheath. A pulmonary artery catheter (Swan-Ganz) was inserted, and pulmonary artery pressures were continuously monitored. These procedures were completed within 1 hour of intubation (Fig. 1).

F1-23
Figure 1:
Outline of the study. VT = tidal volume; PEEP = positive end-expiratory pressure.

Experimental Protocol

Vital signs including temperature, heart rate, arterial blood pressure, and oxygen saturation were continuously monitored and recorded every 15 minutes. Heart rate was maintained between 120 and 140 bpm, mean arterial blood pressures at 70 to 72 mm Hg, and pulmonary artery pressures (systolic) at 20 to 23 mm Hg (Table 1). Temperature was maintained at 99 to 103°F using an appropriate warming or cooling apparatus (i.e., forced-air warmer/ cooler) and oxygen saturation at 98% to 100%. Normal saline (0.9%) was administered as maintenance fluid at a rate of 4 to 8 mL/kg/h, with all animals receiving similar amounts of total IV fluids over 8 hours. Hypotension, as defined by a mean arterial blood pressure <50, was treated with fluid boluses of 250 mL of normal saline (0.9%). Mean airway pressure and peak inspiratory pressure (PIP) were monitored continuously and recorded every 30 minutes.

T1-23
Table 1:
Parameters and Variables for Ventilation Strategies (8 h of Mechanical Ventilation)

Arterial blood gas samples were obtained hourly. Pre- and postpulmonary blood samples were obtained from the pulmonary artery and aortic catheters, respectively, hourly for 8 hours after intubation.

At the completion of 8 hours of mechanical ventilation, a bronchoalveolar lavage (BAL) was performed. All animals were then humanely euthanized. Tissue samples from the right upper lobes (RULs) and right lower lobes (RLLs) of the lung were harvested and stored at −80°C under sterile conditions. Samples of each tissue were immediately fixed for histologic analysis.

Ventilation Protocol

Animals were randomized into 3 groups and their lungs ventilated with volume control using a Drager Narkomed 4 ventilator (Drager). Group H-VT/3 (n = 6) was ventilated with a VT of 15 mL/kg and 3 cm H2O PEEP. Group L-VT/3 (n = 6) was ventilated with a VT of 6 mL/kg and 3 cm H2O PEEP. Group L-VT/10 (n = 6) was ventilated with a VT of 6 mL/kg and 10 cm H2O PEEP. Respiratory rate was adjusted to maintain PaCO2 at 35 to 50 mm Hg and pH at 7.35 to 7.5. The inspiratory/expiratory ratio was 1:2. The fraction of inspired oxygen (FIO2) was maintained at 50% throughout the procedure for all animals. Arterial blood gas samples were taken hourly to verify adequate oxygenation, ventilation, and acid-base status.

Bronchoalveolar Lavage

BAL was performed after the completion of 8 hours of mechanical ventilation before euthanization. Twenty milliliters of sterile normal saline was used for the lavage. The volume of return was recorded and the samples were centrifuged for 15 minutes at 2500g. The supernatant was aliquoted and stored at −80°C until the time of assays. BAL protein concentration was determined using a refractometer (TS400, Reichert, Depew, NY).

Cytokine Measurements

Ten milliliters of serum from each sample was collected in 15-mL nonpyrogenic, sterile falcon tubes prelung (pulmonary artery) and postlung (aortic arch). Each sample was centrifuged at 2500g for 15 minutes at 4°C to remove cellular components, and the supernatant was aliquoted and immediately stored at −80°C until the time of assays.

BAL and plasma concentrations of TNF-α, IL-1β, IL-6, IL-8, IL-10, and IL-12 were measured using commercially available enzyme-linked immunosorbent assay kits (R&D Systems, Minneapolis, MN) that contained respective standards for production of standard curves and controls. All enzyme-linked immunosorbent assays were performed by a single researcher following the guidelines from the manufacturer and were analyzed at 450 nm using SOFTmax PRO 4.3 LS software (Molecular Devices, Sunnyvale, CA). Background absorbency of blank wells was subtracted from standards and unknown samples before determining concentrations. The detection limits for these kits were 3.7 pg/mL for TNF-α, 10 pg/mL for IL-1β, and IL-6, 4.6 pg/mL for IL-8, 3.5 pg/mL for IL-10, and 9 pg/mL for IL-12.

mRNA Analysis by Quantitative Real-Time Reverse Transcription Polymerase Chain Reaction

RLL lung tissues previously stored at −80°C were homogenized, and total RNA was extracted using the TRIzol Isolation Kit (Invitrogen Life Technologies, Carlsbad, CA) according to the manufacturer's protocol. Purified RNA 200 ng was reverse transcribed, generating cDNA by using the manufacturer's protocol for the Retroscript Detection Kit (Ambion, Austin, TX). Amplification and detection of specific products were performed using the ABI PRISM 7700 Sequence Detection System with the cycle profile according to the protocol for the ABsolute SYBR Green ROX Mix Kit (ABgene, Rockford, IL). As an internal control, glyceraldehyde-3-phosphate dehydrogenase primers were used for RNA template normalization. Fluorescent signals were normalized to an internal reference, and the threshold cycle (Ct) was set within the exponential phase of the polymerase chain reaction (PCR). The target PCR Ct values were normalized by subtracting the glyceraldehyde-3-phosphate dehydrogenase Ct value (ΔCt). The relative expression level between treatments was then calculated using the following equation: relative gene expression − 2−(ΔCt sample − ΔCt control). Each sample was tested in triplicate. The primers (5′-3′) used for each cytokine were ([S]-sense and [AS]-antisense):

  • TNF-α: [S] GCAACCTGGGACATCTGGAATG/[AS] GGTGAAATCTTCTCAAGGAATGTTCTG
  • IL-1β: [S] CCCTACCCTCTCTAGCCAGTCTAC/[AS] TGTTGTCACCATTGTTAGCCATCAC
  • IL-6: [S] ATGAACTCCCTCTCCACAAGCG/[AS] GCATCACCTTTGGCATCTTCTTCC
  • IL-8: [S] GGACCAGAGCCAGGAAGAGAC/[AS] GGGTGGAAAGGTGTGGAATGC
  • IL-10: [S] TTTCTTTCAAACGAAGGACCAGATG/[AS] GCAACCCAGGTAACCCTTAAAGTC
  • IL-12: [S] CTGAAGTCTCTCCTAACCTTAAAGTC/[AS] CCCAGTTCCTAACCCATACCC

Histology

The lungs harvested from the pigs were immediately fixed in 10% buffered formalin. Samples from the most dorsal portion of the RLL and the most ventral portion of the RUL were selected and fixed. After fixation, the tissue samples were dehydrated and embedded in paraffin blocks. The sections were cut to 4-μm thickness and stained with hematoxylin and eosin (H&E). A surgical pathologist, blinded to the study variables, evaluated each sample histologically to determine a lung injury score. Our definition of lung injury score was a quantitative measurement to determine the extent of lung inflammation and damage in each animal and to stratify the level of injury by the totals. Five random fields were analyzed using light microscopy at 100× magnification. Each lung section was analyzed using a histologic grading scale based on the work of Claridge et al.18 This histologic grading scale scored inflammation (0–3), interstitial edema (0–3), congestion (0–3), atelectasis (0–3), alveolar integrity (0–3), acute inflammation (0–3), and interstitial thickening (0–3). The total lung injury score ranged from 0 to 21, 0 representing minimal to no damage and 21 the worst damage possible.

Statistical Analysis

All data were statistically analyzed using SPSS version 15.0 (SPSS, Chicago, IL). The 3 groups were compared using 1-way analysis of variance with appropriate use of post hoc analysis to isolate significant between-group differences. Results were expressed as mean ± SEM. P values <0.05 were considered significant.

RESULTS

Effects of Different Ventilator Strategies on Hemodynamics and Gas Exchange

All hemodynamic variables were similar within all 3 groups and maintained within the ranges noted in the Methods section. All animals requiring fluid boluses responded appropriately and no other intervention was necessary to maintain hemodynamic variables.

pH was between 7.35 and 7.5 during the protocol in all animals. There was a significant difference in pH between the high- and low-VT strategies. Group H-VT/3 had significantly higher pH (7.5 ± 0.008) than group L-VT/3 (7.44 ± 0.008) and group L-VT/10 (7.39 ± 0.03) (Table 1).

PaCO2 was between 33 and 55 mm Hg in all groups. Group H-VT/3 maintained significantly lower PaCO2 from hour 1 through hour 8. Both low-VT strategies had significantly higher PaCO2 than H-VT/3 after 1 hour of mechanical ventilation (Fig. 2A). Partial pressure of arterial oxygen (PaO2) was similar in all 3 groups (Fig. 2B).

F2-23
Figure 2:
Effects of different ventilation strategies on PaCO2 and PaO2. A, PaCO2 over 8 hours of mechanical ventilation. *P < 0.05, group H-VT/3 versus groups L-VT/3 and L-VT/10. #P < 0.001, group L-VT/3 versus group L-VT/10 at hour 1. B, PaO2 over 8 hours of mechanical ventilation.

Respiratory rate was significantly different between the high- and low-VT strategies because it was adjusted to maintain a PaCO2 <55 mm Hg in all groups. There were no differences in respiratory rate between the 2 low-VT strategy groups.

Effects of Different Ventilation Strategies on Respiratory Mechanics

Mean airway pressures were highest in group L-VT/10 (14.7 ± 0.7 cm H2O) versus groups H-VT/3 (9.3 ± 0.3 cm H2O, P < 0.001) and L-VT/3 (6.9 ± 0.4 cm H2O, P < 0.001). Group H-VT/3 had significantly higher mean airway pressures than group L-VT/3 after hour 3 (Fig. 3A).

F3-23
Figure 3:
Effects of different ventilator strategies on airway mechanics. A, Average mean airway pressure mean ± SEM over 8 hours of mechanical ventilation. *P < 0.002, group H-VT/3 versus group L-VT/3 after hour 3. **P < 0.001, group L-VT/10 versus other groups. B, Average peak inspiratory pressures mean ± SEM over 8 hours of mechanical ventilation. *P < 0.005, group H-VT/3 versus group L-VT/3. **P < 0.005, group L-VT/3 versus other groups. ***P < 0.01, group L-VT/10 versus group H-VT/3 after hour 6.

PIP was higher in both groups H-VT/3 (26.4 ± 0.87 cm H2O) and L-VT/10 (23.6 ± 0.70 cm H2O, P < 0.005) compared with group L-VT/3 (17.7 ± 1.28 cm H2O, P < 0.005). After hour 6, group L-VT/10 had significantly lower PIP than group H-VT/3 (P < 0.01) (Fig. 3B).

Effects of Different Ventilation Strategies on Cytokine Production

Bronchoalveolar Lavage

BAL was done at the completion of 8 hours of mechanical ventilation. Lavages were performed with 20 mL sterile normal saline with return volumes of 8 to 10 mL in all animals. Group L-VT/10 had significantly increased BAL levels of TNF-α, IL-1β, IL-6, and IL-8 compared with both groups H-VT/3 and L-VT/3 (P < 0.001) (Fig. 4A). There were no differences in BAL cytokine IL-10 and IL-12 levels among the 3 groups (Fig. 4A).

F4-23
Figure 4:
Effects of 8 hours of mechanical ventilation on bronchoalveolar lavage (BAL). A, Significant cytokine levels in BAL mean ± SEM. *P < 0.001, group L-VT/10 versus other groups. B, BAL protein concentration mean ± SEM. *P < 0.001, group H-VT/3 versus other groups. **P < 0.001, group L-VT/3 versus other groups. ***P < 0.001, group L-VT/10 versus other groups. C, mRNA of right lower lobe lung tissue mean ± SEM. *P < 0.05, group L-VT/10 versus other groups.

BAL protein concentrations were higher in group L-VT/10 (14.3 ± 0.8 mg/mL, P < 0.001) versus group H-VT/3 (1.2 ± 0.07 mg/mL, P < 0.001) and group L-VT/3 (8.3 ± 0.8 mg/mL, both P < 0.001). Group L-VT/3 had an intermediate protein level significantly lower than group L-VT/10 but higher than group H-VT/3 (P < 0.001) (Fig. 4B).

Quantitative reverse transcription PCR analysis (mRNA) of the RLL lung tissue revealed correlating data with significantly higher levels of TNF-α, IL-1β, IL-6, and IL-8 in group L-VT/10 versus the other 2 groups (P < 0.05) (Fig. 4C).

Serum

We assayed cytokines TNF-α, IL-1β, IL-6, IL-8, IL-10, and IL-12 in prelung blood via pulmonary artery catheter and postlung blood via aortic catheter. There were no significant differences in any cytokines within each group prelung and postlung. There were also no differences among the 3 groups.

Effects of Different Ventilation Strategies on Lung Injury

H&E stains were done for each animal in each ventilation group for the RLL and the RUL. Gross histologic evaluation of the RLL demonstrated that group H-VT/3 showed inflammatory cell migration and vascular congestion with alveolar and perivascular edema. The majority of alveoli remained intact, with minimal gross alveolar collapse and no alveolar hemorrhage (Fig. 5A). Group L-VT/3 showed a segmental histology within the RLL, more profound than the other groups. Portions were similar to the histology in group H-VT/3. Unique to this group, there were other areas of gross alveolar hemorrhage with early thrombi formation and a high level of vascular congestion (Fig. 5B). Group L-VT/10 showed an increase in alveolar and perivascular edema compared with group H-VT/3. Vascular congestion and alveolar collapse were found with gross invasion of macrophages and polymorphonuclear leukocytes. Of the 3 groups, group L-VT/10 had the greatest global level of edema and congestion. No alveolar hemorrhage was seen in group L-VT/10 (Fig. 5C). The histologic descriptions above were of areas with the highest level of lung injury in each group. All animals within each group demonstrated the unique findings depicted with each representative histologic slide. The RUL was similar histologically, revealing a range of inflammatory cell migration, vascular congestion, and alveolar and perivascular edema with minimal alveolar collapse, with no alveolar hemorrhage in any group.

F5-23
Figure 5:
Representative hematoxylin and eosin stains of the right lower lobe from animals ventilated with H-VT/3 (A) with intact alveoli, minimal vascular congestion, mild edema, and inflammatory cell migration. Group L-VT/3 (B) with alveolar hemorrhage and global alveolar edema and vascular congestion. Group L-VT/10 (C) with increased alveolar and perivascular edema, increased vascular congestion, and inflammatory cell migration.

Evaluation by a blinded surgical pathologist revealed an RLL total lung injury score range of 2 to 12.5 and an RUL range of 2 to 10. The ranges of lung injury scores reflect a nonuniform picture of injury within each group. Although the H&E slides depict unique findings in each group, there were areas that lacked high levels of injury. Group H-VT/3 had significantly lower lung injury scores in both the RLL and RUL compared with the low-VT groups (P < 0.02) (Fig. 6). There were no significant differences between the low-VT groups, L-VT/3 and L-VT/10 (Fig. 6).

F6-23
Figure 6:
Average lung injury score with 3 different ventilation strategies. Right lower lobe: *P < 0.02, group H-VT/3 versus other groups. Right upper lobe: **P < 0.04, group H-VT/3 versus other groups.

DISCUSSION

This study was designed to evaluate the effects of 3 different ventilator strategies on the inflammatory response and lung injury in anesthetized animals with noninjured lungs. We have evidence that ventilation with low VT/high PEEP is associated with increased levels of inflammatory mediators compared with ventilation with high VT/low PEEP. This is contrary to current data demonstrating that ventilation with high VT and low or zero PEEP results in the development of greater local and systemic inflammatory responses.6,9,10,1922 Therefore, this study questions whether the variables of mechanical ventilation beneficial in ARDS can be extrapolated to result in similar effects in noninjured lungs.

Mechanical ventilation is associated with adverse effects, including atelectasis and VILI. Atelectasis occurs in 90% of patients undergoing general anesthesia.23 The result is decreased compliance, impaired oxygenation, and potentially, lung injury. Acute extreme lung stretching and high airway pressures have been found to contribute to severe parenchymal changes increasing permeability of the alveolar-capillary barrier, resulting in pulmonary edema, parenchymal damage, increased inflammation, and ultimately, VILI.3 Modification of the ventilator strategy may reduce lung injury in acutely injured lungs. Whether these strategies can be used with similar results in noninjured lungs is unknown.

The large, multicenter, prospective ARDS Network clinical trial unambiguously confirmed that mechanical ventilation with lower VTs (6 mL/kg PBW), rather than traditional VTs (12 mL/kg PBW), and low plateau pressures (<30 cm H2O) resulted in a significant increase in ventilator-free days and a reduction in mortality.24 These variables maximize alveolar recruitment and aeration with minimal shearing stresses and pulmonary strain. The efficacy of protective ventilation in ALI has encouraged its use in the operating room for patients with normal lungs. Yet, this practice is controversial and lacks evidence-based support.

To limit sources of inflammation, our study animals did not undergo a surgical procedure. The association of surgery and activation of acute-phase inflammatory and immunologic factors has been well established. Both duration of surgery and the amount of blood loss are associated with higher levels of inflammation.25,26 There may be a similar increase in inflammatory response with prolonged mechanical ventilation alone. Our study has uniquely investigated the effects of mechanical ventilation within normal physiologic variables with minimal surgical stimulation and 8 hours of ventilation.

We demonstrate that increased continuous airway pressure associated with high PEEP increases the pulmonary inflammatory response. Our data agree with data of Chu et al.27 showing that overdistention and stretch of the pulmonary epithelium result in an increase in inflammatory cytokine production and is therefore more injurious to normal lungs. This is not consistent with the clinical study by Wolthuis et al.,21 who demonstrated that low VT with 10 cm H2O PEEP may limit pulmonary inflammation in noninjured mechanically ventilated patients. The differences in airway pressures in our study may contribute to our experimental results.

Our study suggests there may be upper and lower airway pressures in noninjured lungs above or below which lung injury may occur. Beyond these limits, there may be substantial barotrauma from overdistention, a greater degree of atelectasis, and mechanical injury caused by cyclic opening and closing of alveoli. In normal animal lungs, our study demonstrated that higher PEEP resulted in increased lung injury. Few studies have been done that effectively determine airway pressures that induce injury in normal lungs. Further studies should determine airway pressures that will minimize inflammation, barotrauma, and mechanical sheer injury.

Mechanical ventilation itself promotes inflammation. Our results demonstrate that ventilation strategies differ in inflammatory response. Ventilation with low VT/high PEEP demonstrated the greatest increase in inflammatory cytokines. Tremblay et al.,5 in contrast, demonstrated in an ex vivo animal model that high VT with no PEEP increased the in situ inflammatory response. However, this ex vivo rodent model ventilated animals with extremely large VT that lie outside the variables used in normal human subjects. Our study, which used more conventional VT, demonstrated significantly less inflammation with low PEEP ventilation. This inflammatory response was identified in BAL with a 6-fold increase in the proinflammatory cytokines TNF-α, IL-1β and IL-6, and chemotaxic cytokine IL-8 with low VT/high PEEP. These cytokine findings were a direct result of inflammation within the lung parenchyma with no changes systemically. This may be attributed to direct transcriptional upregulation of cytokine production by the pulmonary epithelium stimulated by overdistention, such as IL-8.2831 Other cellular components within the lungs (i.e., alveolar macrophages) may contribute to this acute inflammatory response to mechanical ventilation.

This study correlated molecular inflammation with histologic lung injury. We demonstrated that ventilation with high VT/low PEEP was associated with the least lung injury. Although all groups had equivalent oxygenation, there were histologic findings that were unique to each group. Our histologic findings correlate with the ex vivo small-animal study that demonstrated that ventilation with low VT/no PEEP resulted in increased inflammation caused by cyclic opening and closing of alveoli.27 The nonuniform appearance of the low VT/low PEEP group, with regions of less inflammation and injury, may be attributable to mechanical injury only in certain regions. Therefore, this injury may have been dependent on other factors, such as size of the alveoli and amount of surfactant, because alveoli in other sections remained intact. Despite this mechanical injury, ventilation with low VT/low PEEP did not result in as dramatic increases in inflammatory mediators as did ventilation with low VT/high PEEP. This demonstrates that higher PEEP may play a significant role in inducing inflammation during mechanical ventilation. Ventilation with high VT/low PEEP demonstrated the least lung injury. However, whether these histologic findings contribute to differences in overall lung function, postoperative recuperation, and morbidity is still unclear.

Despite the range of inflammation and histologic injury, our results demonstrated that all animals in all groups had adequate gas exchange and equivalent oxygenation. Many researchers, including Wolthuis et al.,21 demonstrated significant differences in PaCO2 among ventilation groups. In our study, there was a significant difference in PCO2 (PaCO2) and pH between high- and low-VT strategies. Although the 2 low-VT strategies had higher PaCO2, there was no resultant acidosis and therefore no physiologic alterations because of this significant increase. To further validate our findings, the 2 low-VT groups had similar PaCO2 levels and dramatic differences in BAL cytokine findings and histology. Tolerated increased PaCO2 (permissive hypercapnia) has been shown to be beneficial in the treatment of ARDS and ALI. Hypercapnic acidosis has protective effects, associated with improved pulmonary edema, decreased lung stiffness, and markedly decreased levels of cytokines, particularly TNF-α and IL-6.32 One could postulate that increase in PaCO2, similar to that found in our low-VT strategies, may have a decreased inflammatory response, but this is not the case. We have demonstrated that ventilation with low VT/high PEEP is associated with greater pulmonary inflammatory response and parenchymal injury.

Although this study revealed significant findings regarding different ventilation strategies in normal lungs, there were limitations. The study was performed in a limited number of animals. Normal pig lungs may react differently than adult human lungs ventilated similarly. Differences in chest wall anatomy between pigs and humans may cause differences in the injury caused by mechanical ventilation. The study was performed on a small number of young swine. Their lungs may react differently than those of older animals or humans ventilated similarly. Because of the ventilator used, we were unable to measure plateau pressure, auto-PEEP, or pressure volume loops. Our inability to measure end-inspiratory pressure limits the ability to determine whether the results were caused by PEEP or by tidal overdistention due to high-end pressure. Future studies should be done to correlate the relationship between high PEEP ventilation and plateau pressures. We performed a single BAL at the end of 8 hours of mechanical ventilation rather than at multiple time points during the protocol. We were unable to distinguish whether each cytokine increased at different time points or constantly throughout ventilation. The BAL samples were taken before euthanasia to eliminate any effects from the physiologic changes caused by euthanasia in the samples (i.e., decreased cardiac output and hypoxia). Finally, our 3 ventilation strategies used a PEEP of either 3 or 10 cm H2O. Additional research is needed to determine the effects of PEEP within this range (i.e., PEEP of 5 or 8 cm H2O). It would be valuable to determine a level of PEEP above which lung injury occurs.

CONCLUSIONS

We demonstrated that mechanical ventilation with high PEEP associated with high mean airway pressures resulted in increased pulmonary inflammation. Low PEEP resulted in lower levels of inflammatory markers. High VT (15 mL/kg PBW), low PEEP (3 cm H2O), and low mean airway pressure resulted in less pulmonary inflammation and parenchymal damage in normal, noninjured animal lungs compared with other low-VT mechanical ventilation strategies. These findings support the use of larger VTs and PEEP <10 cm H2O to ventilate patients with normal lungs. Pulmonary physiology is dramatically different between ARDS and noninjured lungs. We have demonstrated that ventilation strategies used in patients with ARDS may not be appropriate for patients with noninjured lungs. We believe that the question of which ventilatory strategy will “protect” normal human lungs remains unanswered. Large human clinical trials with outcome analysis remain necessary to elucidate the best strategy for ventilation of uninjured lungs to improve postoperative recuperation and morbidity.

REFERENCES

1. Amato MBP, Barbas CSV, Medeiros DM, Magaldi RB, Schettino GP, Lorenzi-Filho G, Kairalla RA, Deheinzelin D, Munoz C, Oliveira R, Takagaki TY, Carvalho CRC. Effect of protective-ventilation strategy on mortality in the acute respiratory distress syndrome. N Engl J Med 1998;338:347–54
2. Schultz MJ, Haitsma JJ, Slutsky AS, Gajic O. What tidal volumes should be used in patients without acute lung injury? Anesthesiology 2007;106:1226–31
3. Dreyfuss D, Saumon G. Ventilator-induced lung injury: lessons from experimental studies. Am J Respir Crit Care Med 1998;157:294–323
4. D'Angelo E, Pecchiari M, Della Valle P, Koutsoukou A, Milic-Emili J. Effects of mechanical ventilation at low lung volume on respiratory mechanics and nitric oxide exhalation in normal rabbits. J Appl Physiol 2005;99:433–44
5. Tremblay LN, Miatto D, Hamid Q, Govindarajan A, Slutsky AS. Injurious ventilation induces widespread pulmonary epithelial expression of tumor necrosis factor-alpha and interleukin-6 messenger RNA. Crit Care Med 2002; 30:1693–700
6. Tremblay L, Valenza F, Ribeiro SP, Li J, Slutsky AS. Injurious ventilatory strategies increase cytokines and c-fos m-RNA expression in an isolated rat lung model. J Clin Invest 1997;99:944–52
7. D'Angelo E, Pecchiari M, Baragge P, Saetta M, Balestro E, Milic-Emili J. Low volume ventilation causes peripheral airway injury and increased airway resistance in normal rabbits. J Appl Physiol 2002;92:949–56
8. D'Angelo E, Koutsoukou A, Della Valle P, Gentile G, Pecchiari M. Cytokine release, small airway injury, and parenchymal damage during mechanical ventilation in normal open-chest rats. J Appl Physiol 2008;104:41–9
9. Pugin J, Dunn I, Jolliet P, Tassaux D, Magnenat J, Nicod LP, Chevrolet J. Activation of human macrophages by mechanical ventilation in vitro. Am J Physiol 1998;275:1040–50
10. Von Bethmann AN, Brasch F, Nusing R, Vogt K, Volk HD, Muller KM, Wendel A, Uhlig S. Hyperventilation induces release of cytokines from perfused mouse lung. Am J Respir Crit Care Med 1998;175:263–72
11. Koner O, Celebi S, Balci H, Cetin G, Karaoglu K, Cakar N. Effects of protective and conventional mechanical ventilation on pulmonary function and systemic cytokine release after cardiopulmonary bypass. Intensive Care Med 2004;30:620–6
12. Wrigge H, Zinserling J, Stuber F, von Spiegel T, Hering R, Wetegrove S, Hoeft A, Putensen C. Effects of mechanical ventilation on release of cytokines into systemic circulation in patients with normal pulmonary function. Anesthesiology 2000;93:1413–7
13. Wrigge H, Uhlig U, Zinserling J, Behrends-Callsen E, Ottersbach G, Fischer M, Uhling S, Putensen C. The effects of different ventilatory settings on pulmonary and systemic inflammatory responses during major surgery. Anesth Analg 2004;98:775–81
14. Choi GC, Wolthuis EK, Bresser P, Levi M, van der Poll T, Dzoljic M, Vroom MB, Schultz MJ. Mechanical ventilation with lower tidal volumes and positive end-expiratory pressure prevents alveolar coagulation in patients without lung injury. Anesthesiology 2006;105:689–95
15. Zupancich E, Paparella D, Turani F, Munch C, Rossi A, Masseccesi S, Ranieri M. Mechanical ventilation affects inflammatory mediators in patients undergoing cardiopulmonary bypass for cardiac surgery: a randomized clinical trial. J Thorac Cardiovasc Surg 2005;130:378–83
16. Lee PC, Helsmoortel CM, Cohn SM, Fink MP. Are low tidal volumes safe? Chest 1990;97:425–9
17. Wrigge H, Uhlig U, Baumgarten G, Menzenbach J, Zinserling J, Ernst M, Dromann D, Welz A, Uhlig S, Putensen C. Mechanical ventilation strategies and inflammatory responses to cardiac surgery: a prospective randomized clinical trial. Intensive Care Med 2005;31:1379–87
18. Claridge JA, Enelow RI, Young JS. Hemorrhage and resuscitation induced delayed inflammation and pulmonary dysfunction in mice. J Surg Res 2000;92:206–13
19. Michelet P, D'Journo XB, Roch A, Doddoli C, Marin V, Papazian L, Decamps I, Bregeon F, Thomas P, Auffray JP. Protective ventilation influences systemic inflammation after esophagectomy. Anesthesiology 2006;105:911–9
20. Vlahakis NE, Schroeder MA, Limper AH, Hubmayr RD. Stretch induces cytokine release by alveolar epithelial cells in vitro. Am J Physiol 1999;277:L167–73
21. Wolthuis EK, Choi G, Dessing MC, Bresser P, Lutter R, Dzoljic M, van der Poll T, Vroom MB, Hollmann M, Schultz MJ. Mechanical ventilation with lower tidal volumes and positive end-expiratory pressure prevents pulmonary inflammation in patients without preexisting lung injury. Anesthesiology 2008;108:46–54
22. Ranieri VM, Suter PM, Tortorella C, De Tullio R, Dayer JM, Brienza A, Bruno F, Slutsky AS. Effect of mechanical ventilation on inflammatory mediators in patients with acute respiratory distress syndrome. A randomized controlled trial. JAMA 1999;281:54–61
23. Duggan M, Kavanagh P. Atelectasis in the perioperative patient. Curr Opin Anesthesiol 2007;20:37–42
24. The Acute Respiratory Distress Syndrome Network. Ventilation with lower tidal volumes as compared with traditional tidal volumes for acute lung injury and the acute respiratory distress syndrome. N Engl J Med 2000;342:1301–8
25. Yamada T, Hisanaga M, Nakajima Y, Kanehiro H, Watanabe A, Ohyama T, Nishio K, Sho M, Nagao M, Harada A, Matsushima K, Nakano H. Serum interleukin-6, interleukin-8, hepatocyte growth factor, and nitric oxide changes during thoracic surgery. World J Surg 1998;23:783–90
26. Yim APC, Wan S, Lee TW, Arifi AA. VATS lobectomy reduces cytokine responses compared with conventional surgery. Ann Thorac Surg 2000;70:243–7
27. Chu EK, Whitehead T, Slutsky AS. Effects of cyclic opening and closing at low- and high-volume ventilation on bronchoalveolar lavage cytokines. Crit Care Med 2004;32:168–74
28. Hammerschmidt S, Kuhn H, Sack U, Schlenska A, Gessner C, Gillissen A, Wirtz H. Mechanical stretch alters alveolar type II cell mediator release toward a proinflammatory pattern. Am J Respir Cell Mol Biol 2005;33:203–10
29. Pugin J. Molecular mechanisms of lung cell activation induced by cyclic stretch. Crit Care Med 2003;31:S200–6
30. Halbertsma FJJ, Vaneker M, Scheffer GJ, van der Hoeven JG. Cytokines and biotrauma in ventilator-induced lung injury: a critical review of the literature. Neth J Med 2005;63:382–92
31. Lang CJ, Barnett EK, Doyle IR. Stretch and CO2 modulate the inflammatory response of alveolar macrophages through independent changes in metabolic activity. Cytokine 2006; 33:346–51
32. De Smet HR, Bersten AD, Barr HA, Doyle IR. Hypercapnic acidosis modulates inflammation lung mechanics, and edema in the isolated perfused lung. J Crit Care 2007;22:305–13
© 2010 International Anesthesia Research Society