Secondary Logo

Share this article on:

The effect of intensification with raltegravir on the HIV-1 reservoir of latently infected memory CD4 T cells in suppressed patients

Vallejo, Alejandroa,*; Gutierrez, Carolinaa,*; Hernandez-Novoa, Beatriza; Diaz, Laurab; Madrid, Nadiaa; Abad-Fernandez, Maríaa; Dronda, Fernandoa; Perez-Elias, María J.a; Zamora, Javierc; Muñoz, Eduardod; Muñoz-Fernandez, María A.b; Moreno, Santiagoa

doi: 10.1097/QAD.0b013e3283584521
CLINICAL SCIENCE

Objectives: The stability of the reservoir of latently infected memory CD4+ T-cells may be associated with continuous replenishment from residual HIV-1, not completely eliminated by otherwise successful antiretroviral therapy (ART). Treatment intensification could help to control residual virus and to modify the latent reservoir. The objective of this work is to assess the effect of intensifying therapy with raltegravir on the HIV-1 cell reservoir.

Design: A pilot open-label phase-II clinical trial was performed to analyze ART intensification with raltegravir after 48 weeks in chronically HIV-1-infected patients on stable ART.

Methods: We measured the number of latently infected memory CD4+ T cells, residual viremia, 2-long terminal repeat circles, CD4+/CD8+ T-cell activation, lymphocyte subpopulations, gut homing receptor, and bacterial translocation.

Results: A significant decay of HIV-1 latent reservoir was observed after intensification in the nine patients included (P = 0.021). No variation was found in either residual viremia or 2-long terminal repeat circles, whereas CD8+ T-cell activation decreased at week 36 (P = 0.028). No differences were found in naive T-cell or effector memory cell counts, and the frequencies of gut homing receptor on activated or effector memory CD8+ T cells. Bacterial translocation was stable, with the exception of a late decrease in lipopolysaccharide levels.

Conclusions: In this pilot noncomparative trial, treatment intensification with raltegravir significantly decreased the latent cellular HIV-1 reservoir and CD8+ T-cell activation. Despite the limitations inherent to trial design, our results suggest that ART intensification should be considered as an adjuvant strategy to eradicate HIV-1 infection.

aDepartment of Infectious Diseases, Hospital Universitario Ramón y Cajal and IRYCIS

bLaboratory of Immunobiology, Hospital General Universitario Gregorio Marañón

cDepartment of Biostatistics, Hospital Universitario Ramón y Cajal, and IRYCIS, Madrid

dInstituto Maimónides de Investigación Biomédica, Department of Cellular Biology, Physiology and Immunology, University of Córdoba, Córdoba Spain.

*A.V. and C.G. contributed equally to this work.

Correspondence to Santiago Moreno, MD, PhD, Department of Infectious Diseases, Hospital Ramón y Cajal, Carretera de Colmenar, Km 9,100, 28034 Madrid, Spain. Tel: +34 91 336 8710; fax: +34 91 336 8792; e-mail: smoreno.hrc@salud.madrid.org

Received 17 May, 2012

Revised 16 July, 2012

Accepted 18 July, 2012

Back to Top | Article Outline

Introduction

Successful antiretroviral therapy (ART) can reduce plasma viremia to below the limit of detection, leading to adequate immune recovery and clinical stability in most HIV-1-infected patients [1]. However, despite its well known benefits, lifelong ART is associated with important clinical problems. First, life expectancy may not be fully restored, and morbidity and mortality arising from non-AIDS events are increasingly frequent in patients with controlled viremia [2,3]. Second, successful lifelong ART is hampered by drug toxicity, resistance mutations, adherence, and cost, as well as limited access to treatment in the most affected developing countries [4]. Consequently, major efforts are being made in the search for new strategies to eradicate or cure HIV-1.

The main barrier to eradication of HIV-1 is virus persistence despite suppressive ART, which leads to pretherapy viremia levels when ART is interrupted [5,6]. The source (or sources) of the residual virus in patients receiving ART continues to be a matter of debate. Although nobody questions the importance of the pool of latently infected memory CD4+ T cells [7,8], the possibility of ongoing viral replication resulting from incomplete inhibitory activity or penetration of ART in sanctuary sites remains controversial [9,10]. If the residual virus can replenish cell reservoirs, any attempt to eliminate these reservoirs should be preceded by complete inhibition of infection by the virus.

Intensification of treatment seems to be the most logical approach to eliminating residual HIV-1 replication. Previous studies using various drugs have shown conflicting results, possibly due to methodological differences in quantification of the latent reservoir, timing of administration of intensifying drugs (acute vs. chronic infection), baseline patient characteristics, duration of viral suppression, and sampling time. The emergence of new antiretroviral drugs with different mechanisms of action, such as integrase inhibitors and CCR5 antagonists, provide new opportunities in attempts to eradicate the latent reservoir [11–14].

We performed a pilot prospective open-label phase II clinical trial in chronically HIV-1-infected patients on suppressive ART in order to assess the effect of intensifying therapy with raltegravir on the HIV-1 cell reservoir. The main outcome measure was the number of memory CD4+ T cells that were latently infected by HIV-1 with replicative capacity. The secondary outcome measures were residual viremia, episomal 2-long terminal repeat (LTR) circles, immune activation, and bacterial translocation.

Back to Top | Article Outline

Methods

Study design and patients

We performed a pilot open-label phase II clinical trial to evaluate the effect of raltegravir (developed and provided by Merck, Sharp and Dohme, Whitehouse Station, New Jersey, USA) on the HIV-1 latent reservoir. The study was conducted at the Hospital Universitario Ramón y Cajal in Madrid, Spain between 2008 and 2010. Biochemical, immunological, and virological parameters were assessed at baseline and at weeks 12, 24, 36, and 48. Plasma viral load was measured by quantitative RT-PCR with a detection limit of 40 copies/ml (Roche Taqman HIV-1 test; Roche Molecular Systems), and T-lymphocyte counts were determined by flow cytometry.

The main inclusion criteria were as follows: HIV-1-infected adults receiving ART based on no less than three drugs for at least 2 years; undetectable plasma viral load (pVL) (below 40 copies HIV-1 RNA/ml) for at least two years; CD4+ T-cell count above 350 cells/μl; and no previous experience with raltegravir. Patients were excluded if they had experienced virological failure, received any immunosuppressive or immunomodulatory therapy, were or planned to become pregnant, or planned to interrupt treatment for any reason. A total of 300 ml of heparinized whole blood was drawn from each patient for quantification of the HIV-1 latent reservoir; 50 ml of whole blood with ethylenediaminetetraacetic acid (EDTA) was drawn for plasma and isolation of peripheral blood mononuclear cells (PBMCs).

The study was carried out according to the recommendations of the Declaration of Helsinki and current Spanish legislation on clinical trials. It was approved by the AEMPS (Spanish Agency for Medications and Health Products) and our local Independent Ethics Committee (Hospital Ramón y Cajal, Madrid, Spain). All patients provided written informed consent for participation, sample collection, and laboratory determinations.

Back to Top | Article Outline

Quantification of latently infected resting CD4 T cells carrying replication competent virus

The quantification of latently HIV-1-infected cells was determined using a previously described enhanced culture assay of highly enriched resting CD4+ T cells that represent the major long-term reservoir for the virus [15,16]. Briefly, PBMC were isolated by Ficoll density gradient centrifugation (Lymphocytes Isolation Solution; Rafer, S.L., Zaragoza, Spain) from 300 ml of heparinized whole blood. Resting CD4+ T cells were then isolated by negative selection of CD3+/CD4+/HLA-DR/CD25 cells using magnetic beads according to the manufacturer's recommendations (Miltenyi Biotec, S.L. Bergisch Gladbach, Germany). Flow cytometry was next used to test the isolated resting cells that usually yielded a purity greater than 99%. A minimum of 63 × 106 resting CD4+ T cells is needed to perform this assay. Cells were plated in duplicate five-fold serial dilution cultures from 25 × 106 cells to 320 cells. For efficient-cell activation, 10-fold allogenic irradiated PBMC from healthy donors, prepared the same day, were added to each culture in the presence of phytohemagglutinin (PHA, 1 μg/ml) and recombinant interleukin 2 (IL-2, 100 U/ml).

The limiting dilution assay with five-fold serial dilution was set up as follows: The maximum number of resting cells that were put into one well of a 6-well plate was 106. Also, 107 irradiated PBMC were added to each well. Two individual wells of a 6-well plate were labeled as 106 dilution plate. Each of these wells had complete culture media (RPMI1640, 10% heat-inactivated fetal bovine serum, 20 U/ml penicillin, 20 μg/ml streptomicin), PHA and IL-2 in a final volume of 8 ml. The 5 × 106 dilution were split into five wells with 1 × 106 cells/well and treated as a group, whereas the 25 × 106 dilution were split into 25 wells with 1 × 106 cells/well and again treated as a group. To prevent contamination of virus from one well into another, wells were separated by an empty well. Cell concentrations below 1 × 106 were cultured in 24-well tissue culture plates. Each well was set up with 2.5 × 106 irradiated PBMC and the appropriated number of resting cells, that is, 2 × 105, 4 × 104, 8 × 103, 1.6 × 103, and 320, in a final volume of 2 ml. Plates were placed at 37°C in a humidified 5% CO2 incubator. On day 2 supernatants containing PHA were removed from the wells and replaced with fresh culture media (without PHA).

Then, CD8+ T-cell-depleted PBMC from healthy donors, prepared 2–3 days before in the presence of PHA (1 μg/ml), were added once a week to each culture. Depletion of CD8+ T cells was performed using a positive selection method (CD8 positive selection; Miltenyi Biotec). These cells were obtained from different healthy donors each week and used fresh to avoid possible cell viability problems due to criopreservation. Also, these cells were tested for fully permisivity for viral infection using a mixture of NL4–3 and IIIB HIV-1 strains. A total of 6 × 106 cells were added to each well of a 6-well plate and 1 × 106 cells to each well of a 24-well plate.

On days 15 and 21, culture supernatants were tested for the presence of HIV-1 antigen using an HIV-1 p24 antigen assay kit (Innogenetics Diagnostica Iberia, S.L. Tarragona, Barcelona, Spain). Infected cell frequencies were determined using the maximum likelihood method and expressed as infectious units per million (IUPM) of resting CD4+ T cells, with a limit of detection of 0.023 IUPM [17].

Back to Top | Article Outline

Residual viremia

Residual viremia was measured using internally controlled ultrasensitive quantitative real-time RT-PCR (Single Copy Assay, SCA), as reported elsewhere [18]. Briefly, using improved nucleic acid isolation and purification techniques, as well as larger plasma volumes, the limit of detection was less than one HIV-1 RNA copy per ml, depending on the volume of plasma tested. When 5–7 ml of plasma is used the detection limit is 0.3 copies/ml. A median volume of 6.5 ml (interquartile range 4.6–7) was used for each patient; hence the limit of detection was 0.3 copies/ml in most patients.

Back to Top | Article Outline

Episomal 2-long terminal repeat circles

The presence of HIV-1 episomal 2-LTR circles was detected using in-house qualitative nested PCR. To maximize the recovery of 2-LTR circles and overcome the low sensitivity of this technique, enriched 2-LTR circles were extracted selectively from 5 × 106 PBMCs using QIAprep Spin Miniprep (Qiagen, Valencia, California, USA) following the manufacturer's protocol for low-copy-number plasmids, as previously described [19]. In the first round, 5 to 20 μl of episomal DNA were amplified in a 50 μl reaction with the following primers: forward, 5′-TAAGATGGGTGGCAAGTGGTCA; and reverse, 5′-TCTACTTGTCCATGCATGGCTT. The second round was performed using 1–2 μl of the first reaction product and primers spanning the unique junction formed by ligation of 5′ and 3′ LTR sequences, as follows: forward, 5′AATCTCTAGCAGTACTGGAAG; reverse, 5′GCGCTTCAGCAAGCCGAGTCCT. PCR products were analyzed on 1% agarose gel stained with GelRed (Biotium, Hayward, California, USA).

Back to Top | Article Outline

T-cell activation, cell subsets, and gut homing receptor

Fresh EDTA anticoagulated whole blood was used to analyze CD4+ and CD8+ T cells with the following antibody combination: CD3-allophycocyanin-Cy7 (APC-Cy7), CD4-peridinin chlorophyll protein complex (PerCP), CD8-phycoerythrin-Cy7 (PE-Cy7), CD38-phycoerythrin, HLA-DR-allophycocyanin (APC), CD45RA-phycoerythrin (PE), CCR7-allophycocyanin (APC), and β7-APC. Antibodies were from Becton Dickinson (Becton Dickinson, Franklin Lanes, New Jersey, USA), and unstained control was performed for all samples. Briefly, 100 μl of blood was lysed with Lysing Solution (Becton Dickinson) for 30 min at room temperature, incubated with the antibodies for 20 min at 4°C, washed, and resuspended in phosphate-buffered saline containing 1% azide. Cells were analyzed using a Gallios flow cytometer (Beckman Coulter, Brea, California, USA). At least 105 CD3+ T cells were collected for each sample and analyzed with Kaluza software (Beckman Coulter) by initially gating lymphocytes according to morphological parameters. Gating was always the same between the different time points. T-cell subsets (at least 20 000 events were gated) were defined as follows: naive cells, CD3+CD4+(CD8+)CD45RA+CCR7+; effector memory cells CD3+CD4+(CD8+)CD45RACCR7; central memory cells CD3+CD4+(CD8+)CD45RACCR7+; and transitional memory cells TEMRA CD3+CD4+(CD8+)CD45RA+CCR7. Cell activation levels were analyzed by the co-expression of CD38 and HLA-DR.

Back to Top | Article Outline

Bacterial translocation

Two commercial assays were used to evaluate bacterial translocation from plasma samples. Plasma bacterial lipopolysaccharide (LPS), an endotoxin of gram-negative bacteria, was measured using QCL-1000 Limulus Amebocyte Lysate (Lonza, Basel, Switzerland) according to the manufacturer's protocol. The plasma level of soluble CD14 was quantified using the Quantikine Humans CD14 Immunoassay (R&D Systems, Minneapolis, Minnesota, USA), according to the manufacturer's instructions. Samples were run in duplicate.

Back to Top | Article Outline

Statistical analysis

The frequency of latently infected cells was calculated using the parametric maximum likelihood method for limiting dilution experiments, as described elsewhere [16]. Continuous variables were expressed as median and interquartile range, and discrete variables as percentages. The t test for independent samples was used to compare normally distributed continuous variables; the Wilcoxon test was used to compare non-normally distributed continuous variables. The association between categorical variables was evaluated using the chi-square test. The Spearman correlation coefficient was used to compare nonrelated variables. Statistical analysis was performed using SPSS software 16.0 (SPSS Inc., Chicago, Illinois, USA).

Back to Top | Article Outline

Results

Patient characteristics

Nine HIV-1-infected patients under suppressive ART were included in this pilot study, and their baseline characteristics are summarized in Table 1. The patients were predominantly male with a long history of ART (median 12 years). Median CD4 cell count was 655 cells/μl and median CD8 cell count was 636 cells/μl. Only two patients were co-infected with HCV (RAL8 and RAL9, 22%). All patients were receiving nucleoside reverse transcriptase inhibitors combined with nonnucleoside reverse transcriptase inhibitors in five cases (55%) and with protease inhibitors in four cases (44%). Raltegravir was well tolerated by all the patients during the study.

Table 1

Table 1

Back to Top | Article Outline

Decreased frequency of latently HIV-1-infected cells

From each patient and time point at least 63 × 106 resting CD4+ T cells were retrieved, with the exception of patients RAL5 and RAL6 at week 24 when the amount of resting cells were not enough to perform the assay. When the amount of resting cells allowed it, more than two wells of dilutions below 1 × 106 were put into culture, that is, a total of 20 wells were put into culture in each of the five next dilutions. All patients showed detectable IUPM at baseline including two with a value equal to the limit of detection of the assay (0.023 IUPM, patients RAL6 and RAL2). As shown in Fig. 1a, six patients showed a stable decline of IUPM during the follow-up, including three with only one positive time point (patients RAL4, RAL8, and RAL6). Two of the patients, RAL5 and RAL4, had a big decay of IUPM from basal to week 12. Patients with unstable decay of IUPM during the follow-up are shown in Fig. 1b (patients RAL3 and RAL2). Finally, only one patient showed a positive result after 48 weeks of treatment intensification (1.6 IUPM, RAL1, Fig. 1c).

Fig. 1

Fig. 1

We assume that this technique has some variability in culture recovery and to try to minimize it we always performed the assay with a minimum of 63 × 106 resting cells, added more than two wells in dilutions below 1 × 106 when possible, tested the permissibility of infection of the CD8+ T-cell-depleted PBMC used to feed the cultures, and tested the viability of the cultures during the assay.

The decrease of IUPM during the follow-up was significant at week 12 [median 0.12 (0.0–0.51) IUPM, 24 median 0.0 (0.0–0.0), 36 median 0.0 (0.0–0.26), and 48 median 0.0 (0.0–0.22)] (Wilcoxon, P = 0.025, 0.028, 0.008, and 0.021, respectively). Assuming that the variation in the size of the cellular latent reservoir follows a binomial distribution, with parameter P = 0.5, the probability of such an observation, that is, spontaneous event, is as low as 0.017.

Back to Top | Article Outline

No effect of intensification on plasma residual viremia or 2-long terminal repeat circles

We measured plasma residual viremia by SCA at baseline and after 12 weeks of intensification with raltegravir. At baseline, residual viremia [median 0.4 copies RNA HIV/ml (0.3–1.4)] was detected in only three patients; at week 12, residual viremia [median 1.4 copies RNA HIV/ml (0.4–3.5)] was detected in five patients. Nevertheless, although there was a trend to an increase, it was not significant compared with baseline (P = 0.08) (Table 2).

Table 2

Table 2

Episomal 2-LTR circles were undetectable in all patients at baseline and remained undetectable after 2 weeks of intensification (table 2). Subsequently, 2-LTR circles could be transiently detected in four patients (44.5%); two at week 12, two at week 24, and one at week 36. Only one patient had detectable 2-LTR circles at two consecutive time points. 2-LTR circles were undetectable in all patients at the end of the study. This transient detection of 2-LTR circles during follow-up was not significant compared with baseline.

Back to Top | Article Outline

Decrease in CD8+ T-cell activation and no variation in T-cell subsets or gut homing receptor

CD4+ T-cell activation remained stable during intensification with raltegravir. Nevertheless, CD8+ T-cell activation decreased after intensification, the difference being statistically significant at week 36 (P = 0.028), with a clearly decreasing trend at week 48 (P = 0.093) compared with baseline. The slight waning effect at week 48 was due to the increase of cell activation in only three patients (Fig. 2a and b).

Fig. 2

Fig. 2

No differences were found in CD4 cell count (median 655, 610, 714, 755, and 703 cell/μl at baseline, 12, 24, 36, and 48 weeks, respectively) or CD8 cell count (636, 549, 522, 585, and 573 cells/μl at baseline, 12, 24, 36, and 48 weeks, respectively). The naive CD4 cell count (median 42.8, 41.8, 42.3, 38.2, and 43.2%, at baseline, 12, 24, 36, and 48 weeks, respectively) and the naive CD8 cell count (median 42.4, 36, 44.9, 42.3, and 45.9% at baseline, 12, 24, 36, and 48 weeks, respectively) were similar during the follow-up period (P > 0.05 at all time points in both cases). No significant differences were observed in the counts of either central, effector memory, or transitory CD4+ and CD8+ T cells (not shown). The proportions of activated CD8+ T cells and effector memory CD8+ T cells bearing gut homing β7 receptor did not vary significantly during the follow-up period (Fig. 2c and d, respectively). We also found no consistence differential effect between patients on nonnucleoside reverse transcriptase inhibitors vs. protease inhibitor.

Back to Top | Article Outline

Late decrease in bacterial translocation

At baseline, sCD14 and LPS levels were significantly lower than those of treatment-naive HIV-1-infected patients. Whereas sCD14 levels were stable during intensification, LPS levels decreased after 48 weeks of intensification (P = 0.008) (Fig. 3a and b).

Fig. 3

Fig. 3

Back to Top | Article Outline

Discussion

The results of this pilot clinical trial show that 48 weeks of intensification with raltegravir reduced the HIV-1 reservoir in latently infected memory CD4+ T cells. However, this reduction was not associated with a reduction in residual viremia. The only associated finding was a decrease in CD8+ T-cell activation, with no effect either on naive or memory T-cell counts or on gut homing receptor. A late decrease in a marker of bacterial translocation was observed as well.

The impact of intensifying ART on the HIV-1 latent reservoir in suppressed HIV-1-infected patients has been evaluated, and findings seem to support an effect of intensification on the latent reservoir. Only three studies, including the present one, have evaluated the impact of intensification by quantifying the number of IUPM in chronically HIV-1-infected patients using the coculture method [20,21]. All three studies revealed accelerated decay of the reservoir. As treatment was intensified with different drugs (abacavir with/without efavirenz, maraviroc, and raltegravir), the effect seems to be nonspecific and not related to a specific drug class. It must be noted that a different study showed no effect of intensification with raltegravir or efavirenz on the size of the latent reservoir [22]. However, some differences in the trial design could explain the different results. Although the enrolment criteria were similar to ours, the intensification included valproic acid either alone, or in combination with the intensifying drugs, and was administered during a shorter period of time.

The role of intensification in reducing residual replication and cell infection by the replicative virus is further supported by other findings. A comparative controlled clinical trial found a transient yet significant increase in 2-LTR circles in patients who had treatment intensification with raltegravir. This was interpreted as a clear sign of inhibition of residual replication [23]. Another study showed that intensification with raltegravir was associated with a significant decrease in proviral DNA in gut-associated lymphoid tissue (GALT) [24] and a decrease in unspliced HIV-1 RNA in CD4+ T cells obtained from the terminal ileum [25], whereas no significant effect was observed on residual viremia. The preliminary results of an ongoing study show that ART may not reach inhibitory levels in tissues (lymph node and GALT), with the result that HIV-1 can replicate and infect cells, thus, increasing the possibility of replenishing the reservoirs [26].

In contrast, results from other studies have been interpreted as evidence against ongoing viral replication. No intensification study has been able to show any significant impact on residual viremia, as measured by SCA [9,27–29]. However, we feel that the lack of this effect is not surprising and does not contradict the potential action of raltegravir on residual replication. Intensification could act at extra-plasma sites with little impact on residual viremia measured in plasma. This indicates that residual viremia might arise from several different sources. In our study, residual viremia measured by SCA did not decrease during intensification. Therefore, the significant decay in the latent reservoir observed in the present study is not associated with decreased residual viremia, thus, implicating the long-standing cell reservoir as the probable source of such residual viremia. This observation is also supported by the results of studies that show a lack of genetic evolution in the persistent virus population [30]. The increase in 2-LTR circles have not been confirmed in other studies, although timing in measurements was different and could explain the discrepancy [22]. In our study, no significant changes were observed in 2-LTR circles after intensification with raltegravir at any time point, although the small sample size could at least in part explain the results.

Additionally, no clinical study has shown the impact of intensification on proviral DNA, which has been used to measure the HIV-1 reservoir. However, proviral DNA does not necessarily reflect the size of the latent reservoir, and its usefulness and validity for this purpose remain to be established. A final argument against the decay in the latent reservoir after intensification of ART is seen in the lack of an effect in patients with both acute and chronic infection who initiated therapy [12–14,28,31]. The discrepant results may be explained by the different situations of patients who initiate therapy and of those whose viral load has been suppressed for a long time. It is possible that initiation of ART could reduce the bulk of virions in tissues and plasma and that the effect on residual virus cannot be demonstrated months/years after the initial assessment.

CD8+ T-cell activation decreased during intensification with raltegravir, as observed in other intensification studies [21]. This effect does not seem to be due to a dilutional effect as a result of cell trafficking from plasma to the gut, because T-cell counts were stable during intensification, and even T-cell subpopulations, that is, naive, central, and effector memory and transitory cells, were constant. We found no evidence of increased levels of gut homing receptor β7 in activated or memory T cells. Bacterial translocation was stable during intensification, with the exception of a late significant decrease in lipopolysaccharide levels. This finding is important, because we previously reported that intensification with maraviroc increased the levels of bacterial translocation that led to increased levels of gut homing receptor β7 in both activated CD8+ T cells and effector CD8+ T-memory cells and a subsequent decrease in CD8+ T-cell activation, probably as a result of trafficking to the gut [21]. Hence, the mechanism by which CD8+ T-cell activation decreased using either of these two drugs seems to be different.

Our study is limited by its small sample size and the lack of a control group. This trial was designed as a proof of concept study, and the absence of a control group was justified by the scarce possibilities of spontaneous decay of the reservoir, with no intervention. Apart from the frequency of infection within resting CD4+ T cells is extremely stable (or decays very slowly), so any significant decrease that could be found might be attributed to the intervention. Another limitation of this study is the lack of two measurements at baseline. Nevertheless, in a previous intensification trial that we performed with a different drug [21], two baseline measurements 3 months apart were performed. As the values obtained in the two determinations were nearly identical, we decided to perform only single measurements due to resource constraints and work overload. In fact, the probability that this decrease was a random finding is very low. As with any study aimed at evaluating eradication strategies, our results are limited by the restrictions inherent to current methodological tools and the subsequent interpretation of results.

In summary, intensification with raltegravir can reduce the cellular viral reservoir without affecting residual viremia. Intensification with raltegravir or other drugs could increase the activity of ART and enhance inhibition of residual viral replication at sites such as the gut, where replication may persist due to limited penetration or suboptimal drug levels. If there is replenishment from low-level viremia to establish the equilibrium (or slow decay) universally observed of the frequency of infection within resting CD4+ T cells, there must be loss of latently infected cells at a roughly equivalent rate, Therefore, if there is depletion of resting cell infection by a period of raltegravir intensification as seen in this study, then the return to the prior level of resting cell infection after either an equal or greater period of unintensified ART could be one of two possibilities. The other possibility is that the level of resting cell infection is so low that the immune system can establish a new lower set point. Yet, it seems unlikely that intensification can eliminate HIV-1 infection, as existing cell reservoirs need to be purged. Other strategies, such as administering HIV-1 latency antagonists, need to be investigated as part of the work involved in eliminating HIV-1 infection.

Back to Top | Article Outline

Acknowledgements

We would like to thank Carmen Page, Raquel Lorente, Ester Domínguez, and María Coronel for their excellent technical assistance. We are grateful to the Radiophysics Departments at Hospitals Ramón y Cajal and Gregorio Marañón for their help with cell irradiation and to the Regional Blood Transfusion Centers in Madrid and Albacete for generously providing buffy coats from healthy donors. We are indebted to our patients and their families for their participation in the study.

Author contributions: A.V., C.G., L.D., B.H-N, M.A.M-F, E.M. and S.P. conceived and design the experiments. C.G. and L.D. performed the quantification of latently infected memory CD4+ T-cells; A.V., L.D. and M.A-F. performed the cytometric analysis; M.A-F. performed the quantification of bacterial translocation; B.H-N and N.M. performed the detection of the 2-LTR circles. F.D., M.J.P-E and S.M. participated on the inclusion and follow up of the patients, and analyzed clinical data; C.G., A.V., L.D., B.H-N, M.A-F, N.M., J.Z. and S.M. analyzed all the data; C.G., L.D., A.V., B.H-N, N.M., M.A-F and S.M. contributed to the writing of the paper; C.G., L.D., A.V., B.H-N, M.A-F, N.M., E.M., M.A.M-F and S.M. approved the final version of the manuscript.

This work was supported by Spanish AIDS Network ‘Red Temática Investigación SIDA’ (RD06/0006); Foundation Investigation and Prevention of AIDS (FIPSE-36-0844/09).

This work has previously been presented at the 6th IAS Conference on HIV Pathogenesis, treatment and prevention 17-20 July 2011, Rome Italy.

Trial registration: ClinicalTrials.gov identifier: NCT00807443

Back to Top | Article Outline

Conflicts of interest

There are no conflicts of interest.

Back to Top | Article Outline

References

1. Wong JK, Hezareh M, Gunthard HF, Havlir DV, Ignacio CC, Spina CA, Richman DD. Recovery of replication-competent HIV despite prolonged suppression of plasma viremia. Science 1997; 278:1291–1295.
2. May M, Gompels M, Delpech V, Porter K, Post F, Johnson M, et al. Impact of late diagnosis and treatment on life expectancy in people with HIV-1: UK Collaborative HIV Cohort (UK CHIC) Study. BMJ 2011; 343:d6016.
3. Mocroft A, Reiss P, Gasiorowski J, Ledergerber B, Kowalska J, Chiesi A, et al. Serious fatal and nonfatal non-AIDS-defining illnesses in Europe. J Acquir Immune Defic Syndr 2010; 55:262–270.
4. Lewin SR, Rouzioux C. HIV cure and eradication: how will we get from the laboratory to effective clinical trials?. AIDS 2011; 25:885–897.
5. Palmer S, Maldarelli F, Wiegand A, Bernstein B, Hanna GJ, Brun SC, et al. Low-level viremia persists for at least 7 years in patients on suppressive antiretroviral therapy. Proc Natl Acad Sci USA 2008; 105:3879–3884.
6. Chun TW, Justement JS, Murray D, Hallahan CW, Maenza J, Collier AC, et al. Rebound of plasma viremia following cessation of antiretroviral therapy despite profoundly low levels of HIV reservoir: implications for eradication. AIDS 2010; 24:2803–2808.
7. Anderson JA, Archin NM, Ince W, Parker D, Wiegand A, Coffin JM, et al. Clonal sequences recovered from plasma from patients with residual HIV-1 viremia and on intensified antiretroviral therapy are identical to replicating viral RNAs recovered from circulating resting CD4+ T cells. J Virol 2011; 85:5220–5223.
8. Joos B, Fischer M, Kuster H, Pillai SK, Wong JK, Böni J, et al. HIV rebounds from latently infected cells, rather than from continuing low-level replication. Proc Natl Acad Sci U S A 2008; 105:16725–16730.
9. Chun TW, Nickle DC, Justement JS, Large D, Semerjian A, Curlin ME, et al. HIV-infected individuals receiving effective antiviral therapy for extended periods of time continually replenish their viral reservoir. J Clin Invest 2005; 115:3250–3255.
10. Havlir DV, Strain MC, Clerici M, Ignacio C, Trabattoni D, Ferrante P, Wong JK. Productive infection maintains a dynamic steady state of residual viremia in human immunodeficiency virus type 1-infected persons treated with suppressive antiretroviral therapy for five years. J Virol 2003; 77:11212–11219.
11. Hazuda DJ, Felock P, Witmer M, Wolfe A, Stillmock K, Grobler JA, et al. Inhibitors of strand transfer that prevent integration and inhibit HIV-1 replication in cells. Science 2000; 287:646–650.
12. Markowitz M, Morales-Ramirez JO, Nguyen BY, Kovacs CM, Steigbigel RT, Cooper DA, et al. Antiretroviral activity, pharmacokinetics, and tolerability of MK-0518, a novel inhibitor of HIV-1 integrase, dosed as monotherapy for 10 days in treatment-naive HIV-1-infected individuals. J Acquir Immune Defic Syndr 2006; 43:509–515.
13. Markowitz M, Nguyen BY, Gotuzzo E, Mendo F, Ratanasuwan W, Kovacs C, et al. Rapid and durable antiretroviral effect of the HIV-1 integrase inhibitor raltegravir as part of combination therapy in treatment-naive patients with HIV-1 infection: results of a 48-week controlled study. J Acquir Immune Defic Syndr 2007; 46:125–133.
14. Markowitz M, Nguyen BY, Gotuzzo E, Mendo F, Ratanasuwan W, Kovacs C, et al. Sustained antiretroviral effect of raltegravir after 96 weeks of combination therapy in treatment-naive patients with HIV-1 infection. J Acquir Immune Defic Syndr 2009; 52:350–356.
15. Siliciano JD, Kajdas J, Finzi D, Quinn TC, Chadwick K, Margolick JB, et al. Long-term follow-up studies confirm the stability of the latent reservoir for HIV-1 in resting CD4+ T cells. Nat Med 2003; 9:727–728.
16. Siliciano JD, Siliciano RF. Enhanced culture assay for detection and quantification of latently, resting CD4+ T-cells carrying replication-competent virus in HIV-1-infected individuals. Methods Mol Biol 2005; 304:3–15.
17. Myers LE, McQuay LJ, Hollinger FB. Dilution assay statistics. J Clin Microbiol 1994; 32:732–739.
18. Palmer S, Wiegand AP, Maldarelli F, Bazmi H, Mican JM, Polis M, et al. New real-time reverse transcriptase-initiated PCR assay with single-copy sensitivity for human immunodeficiency virus type 1 RNA in plasma. J Clin Microbiol 2003; 41:4531–4536.
19. Sharkey ME, Teo I, Greenough T, Sharova N, Luzuriaga K, Sullivan JL, et al. Persistence of episomal HIV-1 infection intermediates in patients on highly active antiretroviral therapy. Nat Med 2000; 6:76–81.
20. Ramratnam B, Ribeiro R, He T, Chung C, Simon V, Vanderhoeven J, et al. Intensification of antiretroviral therapy accelerates the decay of the HIV-1 latent reservoir and decreases, but does not eliminate, ongoing virus replication. J Acquir Immune Defic Syndr 2004; 35:33–37.
21. Gutiérrez C, Díaz L, Vallejo A, Hernández-Novoa B, Abad-Fernández M, Madrid N, et al. Intensification of antiretroviral therapy with a CCR5 antagonist in patients with chronic HIV-1 infection: effect on T cells latently infected. Plos One 2011; 6:e27864.
22. Archin NM, Cheema M, Parker D, Wiegand A, Bosch RJ, Coffin JM, et al. Antiretroviral intensification and valproic acid lack sustained effect on residual HIV-1 viremia or resting CD4+ cell infection. Plos One 2010; 5:ee9390.
23. Buzon MJ, Massanella M, Llibre JM, Esteve A, Dahl V, Puertas MC, et al. HIV-1 replication and immune dynamics are affected by raltegravir intensification of HAART-suppressed subjects. Nat Med 2010; 16:460–465.
24. Yukl SA, Li P, Fujimoto K, Gianella S, Lampiris H, Hare CB, et al. Effect of raltegravir-containing intensification on HIV burden and T-cell activation in multiple gut sites of HIV-positive adults on suppressive antiretroviral therapy. AIDS 2010; 24:2451–2460.
25. Koelsch KK, Boesecke C, McBride K, Gelgor L, Fahey P, Natarajan V, et al. Impact of treatment with raltegravir during primary or chronic HIV infection on RNA decay characteristics and the HIV viral reservoir. AIDS 2011; 25:2069–2078.
26. Stevenson M. Virologic analysis of lymphatic reservoirs of HIV infection. Proceedings of the fifth International Workshop on HIV persistence during therapy; 6–9 December 2011; St. Maarten, West Indies.
27. Dinoso JB, Kim SY, Wiegand AM, Palmer SE, Gange SJ, Cranmer L, et al. Treatment intensification does not reduce residual HIV-1 viremia in patients on highly active antiretroviral therapy. Proc Natl Acad Sci USA 2009; 106:9403–9408.
28. Gandhi RT, Zheng L, Bosch RJ, Chan ES, Margolis DM, Read S, et al. The effect of raltegravir intensification on low-level residual viremia in HIV-infected patients on antiretroviral therapy: a randomized controlled trial. PLoS Med 2010; 7: e1000321
29. Hatano H, Hayes TL, Dahl V, Sinclair E, Lee TH, Hoh R, et al. A randomized, controlled trial of raltegravir intensification in antiretroviral-treated, HIV-infected patients with a suboptimal CD4+ T cell response. J Infect Dis 2011; 203:960–968.
30. Bailey JR, Sedaghat AR, Kieffer T, Brennan T, Lee PK, Wind-Rotolo M, et al. Residual human immunodeficiency virus type 1 viremia in some patients on antiretroviral therapy is dominated by a small number of invariant clones rarely found in circulating CD4+ T cells. J Virol 2006; 80:6441–6457.
31. Gandhi RT, Coombs RW, Chan ES, Bosch RJ, Zheng L, Margolis DM, et al. No effect of raltegravir intensification on viral replication markers in the blood of HIV-1-infected patients receiving antiretroviral therapy. J Acquir Immune Defic Syndr 2012; 59:229–235.
Keywords:

bacterial translocation; gut-homing markers; HIV reservoir; immune activation; residual replication; treatment intensification

© 2012 Lippincott Williams & Wilkins, Inc.