Secondary Logo

A common anti-cytomegalovirus drug, ganciclovir, inhibits HIV-1 replication in human tissues ex vivo

Vanpouille, Christophea,*; Bernatchez, Jean A.b,*,‡; Lisco, Andreaa,†; Arakelyan, Anusha; Saba, Elisaa; Götte, Matthiasb,c; Margolis, Leonida

doi: 10.1097/QAD.0000000000001532
BASIC SCIENCE
Free
SDC

Background: Cytomegalovirus (CMV) is a common HIV-1 copathogen. Since CMV infection is an important contributor to immune activation, the driving force of HIV disease, an anti-CMV strategy might be beneficial to HIV-infected patients. Shin et al. (J Acquir Immune Defic Syndr 2014; 65:251–258) reported that anti-CMV therapy with valganciclovir in coinfected individuals results in a decrease of HIV viral load that is not accompanied by a decrease of immune activation. This suggests an alternative mechanism for HIV inhibition other than suppression of CMV-mediated inflammation.

Method: We evaluated the anti-HIV activity of ganciclovir (GCV), the active form of valganciclovir, on HIV replication in human tissues ex vivo.

Results: We show that GCV has a direct suppressive activity on HIV replication in human tissues ex vivo, including laboratory strains, drug-resistant and primate HIV-1 isolates. We deciphered the mechanism of this inhibition and showed that GCV-TP is incorporated in the nascent DNA chain and acts as a delayed chain terminator.

Conclusion: Our results suggest that anti-CMV strategy using valganciclovir in HIV-1-infected individuals may reduce HIV-1 viral load not only indirectly by decreasing CMV-mediated immune activation but also directly by inhibiting HIV-1 reverse transcriptase.

Supplemental Digital Content is available in the text

aEunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland

bDepartment of Biochemistry, McGill University, Montreal, Quebec

cDepartment of Medical Microbiology and Immunology, Faculty of Medicine and Dentistry, Katz Group Centre for Health Research, University of Alberta, Edmonton, Alberta, Canada.

*Christophe Vanpouille and Jean A. Bernatchez contributed equally to this article.

Current address: National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland, USA.

Current address: Skaggs School of Pharmacy and Pharmaceutical Sciences, University of California, San Diego, 9500 Gilman Drive, La Jolla, CA.

Correspondence to Leonid Margolis, Eunice Kennedy Shriver National Institute of Child Health and Human Development, 10 Center Drive, MSC 1855, Building 10, Room 9D58, Bethesda, MD 20892, USA. Tel: +1 301 594 2476; e-mail: margolis@helix.nih.gov

Received 10 December, 2016

Revised 19 April, 2017

Accepted 24 April, 2017

Supplemental digital content is available for this article. Direct URL citations appear in the printed text and are provided in the HTML and PDF versions of this article on the journal's Website (http://www.AIDSonline.com).

Back to Top | Article Outline

Introduction

Human cytomegalovirus (CMV) is a β human herpesvirus (HHV) with high prevalence in both the general population (∼65%) and in HIV-infected individuals (∼90%) [1,2]. Like herpes simplex virus (HSV)-2 and other sexually transmitted copathogens such as Neisseria gonorrhea, Chlamydia trachomatis, Treponema pallidum, and Trichomonas vaginalis, CMV has been considered a cofactor in HIV transmission [3–8]. In particular, the compartmentalized reactivation of CMV in genital mucosa has been associated with recruitment of immune cells [9–12], local changes in chemokine spectra [13,14], and mucosal inflammation that is associated with increased HIV-1 viral loads in cervicovaginal secretion and semen [13,15–19]. More recent data have shown that CMV infection may also contribute to systemic immunoactivation in HIV-infected individuals whether they are treated or not. This immunoactivation contributes to the prevalence of cardiovascular disease, cancer, fragility, and general aging [20,21]. These findings generated interest in evaluating the possible clinical benefits of anti-CMV strategies for prevention of both HIV infection and HIV comorbidities.

Towards this goal, Shin et al.[22] assessed the effect of CMV therapy on HIV genital levels by evaluating the impact of valganciclovir [a valine ester prodrug of ganciclovir (GCV)] on HIV-infected, antiretroviral therapy (ART)-naive men in an open label observational study. Valganciclovir treatment resulted in the reduction not only of CMV but also of HIV-1 viral load in blood and in semen. The decrease in the semen HIV viral load was not associated with immune parameters (activated T cells and inflammatory cytokines), suggesting that the reduced HIV viral load in semen could not be solely explained by the suppression of immune activation but rather by alternative mechanisms, as hypothesized by the authors [22]. Here, we describe such a mechanism: we showed that GCV has a direct suppressive effect on HIV-1 replication in human lymphoid and cervical tissues ex vivo. The molecular mechanism of this suppression involves GCV-triphosphate (GCV-TP), the active form of GCV, being incorporated into the nascent DNA chain by HIV-1 reverse transcriptase and then acting as a delayed chain terminator.

Back to Top | Article Outline

Materials and methods

Tissue culture and viral infection

Tonsillar tissues were obtained from the Children's National Medical Center (Washington, District of Columbia, USA) and infected with HIVLAI.04. Cervicovaginal tissues were obtained through the National Disease Research Interchange (Philadelphia, Pennsylvania, USA) and infected with HIVBaL.

Primary isolates (HIV-197USNG30, HIV-196USNN20, and HIV-1ME1), azidothymidine-resistant virus, nevirapine-resistant virus (HIV-1N119), fusion inhibitor-resistant virus (HIV-1pNL4-3 gp41(36G)/V38A/N42D), protease inhibitor-resistant virus (HIV-1L10R/M46I/L63P/V82T/I84 V and HIV-1M46I/L63P/V82T/I84 V), and multinucleoside reverse transcriptase inhibitor (NRTI)-resistant viruses (HIV-17324-4, HIV-17303-3) were obtained through the NIH AIDS Research and Reference Reagent Program [23–27].

All tissues were obtained according to Institutional review board-approved protocols. Tissues were dissected into 2-mm blocks and cultured as described earlier [28]. Tissue inoculations with HIV-1 and CMV were performed as described earlier [29,30]. GCV (Bedford Laboratories, Bedford, Ohio, USA) was present during the entire period of culture and was replenished with each medium change (every 3 days).

Back to Top | Article Outline

Cytokines/chemokines quantification

Concentrations of 32 cytokines/chemokines were measured in supernatants of tissue cultures using a multiplex bead array assay [31] (See supplementary data for details, http://links.lww.com/QAD/B101).

Back to Top | Article Outline

Viability assay in human lymphoid tissue

Cell viability in human tonsillar tissues treated with GCV (5 or 50 μmol/l) was assessed as [32] (See supplementary data for details, http://links.lww.com/QAD/B101).

Back to Top | Article Outline

Exogenous template reverse transcriptase assay

HIV-1 reverse transcriptase was expressed and purified as described previously [33]. T50A (CCAATATTCACCATCAAGGCTTGACGTGACTTCACTCCACTATACCACTC) and T50A6 (CCAATATTCACCATCAAGGCTTGATGAAACTTCACTCCACTATACCACTC) were used as templates for DNA synthesis. P1 (GAGTGGTATAGTGGAGTGAA), P1a (GAGTGGTATAGTGGAGTGAAGT), and P1f (GAGTGGTATAGTGGAGTGAAGTTT) were used as primers. We performed synthesis of oligonucleotides containing internal GCV-monophosphate residues enzymatically using HIV-1 reverse transcriptase in a standard primer extension reaction [34]. Samples were subsequently resolved via 12% denaturing PAGE, and the final DNA product was excised and eluted from the gel matrix in 0.5 mol/l ammonium acetate and 0.1% SDS. Full-length DNA synthesis by HIV-1 reverse transcriptase and steady-state kinetics of single nucleotide incorporation by reverse transcriptase were performed as described in the supplementary file, http://links.lww.com/QAD/B101.

Back to Top | Article Outline

Results

Ganciclovir suppresses C-C chemokine receptor 5 and C-X-C chemokine receptor 4-tropic HIV-1 infection in human tissues ex vivo

To test the effect of GCV on HIV replication, we used tonsillar and cervicovaginal tissues, cultured as described earlier [28]. Briefly, 27 human tissue blocks for each experimental condition from each of three donors were infected with a prototypic C-X-C chemokine receptor 4 (CXCR4) or C-C chemokine receptor 5 (CCR5)-tropic variant of HIV, respectively X4LAI.04 or R5BaL, and incubated with GCV for 12 days. Culture medium was changed and GCV was replenished every 3 days. Donor-matched infected tissues not treated with GCV were used as controls. We found that GCV significantly (P < 0.01) suppressed HIV-1 replication, evaluated as p24gag accumulation in culture medium. On average, GCV treatment of ex-vivo human tonsils reduced production of p24gag in culture medium from 10 600 ± 4400 pg/ml to 1430 ± 409 pg/ml and in ex-vivo human cervicovaginal tissues from 2057 ± 445 pg/ml to 174 ± 39 pg/ml (n = 3; Fig. 1a and b). To account for donor-to-donor variability, we normalized these data by calculating the relative suppression of HIV replication in each donor tissue. On average, in tonsils infected with X4LAI.04, GCV suppressed replication by 83.9 ± 5.8%, and in cervicovaginal tissues infected with R5BaL by 90.0 ± 4.03% (n = 3).

Fig. 1

Fig. 1

Fig. 1

Fig. 1

Although both cellular viral kinases encoded by endogenous HHVs, which are reactivated during the culture of human tissues ex vivo, are able to phosphorylate nucleotide analogs [30]; here, we decided to infect tissues with CMV, as GCV is specifically activated by UL97-encoded kinase expressed by CMV. To investigate whether exogenous CMV would confer better anti-HIV activity of GCV, we compared the HIV-inhibitory effect of GCV in tonsillar tissues that we infected with CMV and HIV and in donor-matched controls that were infected with HIV only. We found that the suppression of HIV-1 replication was dose dependent and not statistically different whether we coinfected HIV-infected tissues with CMV or not. The 50% effective concentrations of GCV in tonsillar tissue blocks were, respectively 4.7 μmol/l (95% confidence interval: 0.9–24.9) in HIV-1-singly infected tissues and 5.4 μmol/l (95% confidence interval: 1.5–19.0) in CMV-coinfected tissues (Fig. 1c).

Back to Top | Article Outline

Ganciclovir suppresses infection of HIV-1 of clades A, B, and C in human tissues ex vivo

We evaluated the susceptibility of three primary isolates to GCV: HIV-197USNG30 of clade C, HIV-196USNN20 of clade A, and HIV-1ME1 of clade B. Primary isolate HIV-196USNN20 has a broad coreceptor utilization, including CCR2B, CCR3, CCR4, CCR5, CXCR4, Bob and Bonzo, whereas HIV-197USNG30 and HIV-1ME1 are exclusively CCR5 tropic. Human lymphoid tissues (27 tissue blocks per experimental condition) were inoculated with each of these three isolates and then treated for the entire culture period with 5 or 50 μmol/l GCV (which is, respectively, the 50% effective concentration and a concentration that completely suppresses X4LAI.04 replication in this system). We found that GCV suppressed replication of all the three tested primary isolates and this suppression was not significantly different from that of laboratory isolate X4LAI.04 at both 5 and 50 μmol/l GCV (P > 0.05; Fig. 1d).

Back to Top | Article Outline

Ganciclovir suppresses replication of drug-resistant HIV-1 in human tissues ex vivo

First, we investigated the sensitivity of NRTI-resistant virus to GCV (5 and 50 μmol/l) in human tissue ex vivo. In particular, we evaluated the sensitivity to GCV of a azidothymidine-resistant HIV [35] and two NRTI-multidrug-resistant molecular clones (clones 10076-4 and 7303-3). The molecular clones belong to a panel of six prototypical infectious multi-NRTI-resistant HIV-1 molecular clones that carry several prototypical mutations conferring resistance to at least two of the following NRTIs: abacavir, zidovudine, stavudine, zalcitabine, didanosine, tenofovir, and lamivudine [36]. The replication of azidothymidine-resistant virus, and of 10076-4 and 7303-3 molecular clones was, respectively, suppressed by 48.6 ± 21, 80.6 ± 12.2, 46.4 ± 14% at GCV concentration of 5 μmol/l and by 68.5 ± 3.9, 92.4 ± 4.3, and 73.5 ± 1.9% at GCV concentration of 50 μmol/l. No statistical difference between the inhibition of azidothymidine-resistant HIV-1 or multi NRTI-resistant molecular clones and the inhibition of the laboratory strain X4LAI.04 was observed (P > 0.05; Fig. 1d).

In a second set of experiments, we tested the sensitivity to GCV of the nNRTI-resistant HIV-1N119 (resistant to nevirapine), of a fusion inhibitor-resistant HIV [HIV-1pNL4-3 gp41(36G)/V38A/N42D; resistant to enfuvirtide (T-20)], and of two proteases inhibitor-resistant HIV-1 (HIV-1L10R/M46I/L63P/V82T/I84 V and HIV-1M46I/L63P/V82T/I84 V), which are resistant to the structurally diverse protease inhibitors MK-639, XM323, A-80897, Ro31-8959, VX-478, and SC-52151 [23]. The replication of HIV-1N119, HIV-1pNL4-3 gp41(36G)/V38A/N42D, HIV-1L10R/M46I/L63P/V82T/I84 V, and HIV-1M46I/L63P/V82T/I84 V was, respectively, suppressed by 47.9 ± 4.9, 52.5 ± 23.3, 38.2 ± 16.6, and 36.2 ± 18.1% at GCV concentration of 5 μmol/l and by 88.3 ± 3.2, 96.1 ± 2.1, 86.1 ± 1.7, and 80.6 ± 4.5% at GCV concentration of 50 μmol/l (Fig. 1d).

Back to Top | Article Outline

Incorporation of ganciclovir triphosphate by HIV-1 reverse transcriptase results in downstream DNA synthesis inhibition

We hypothesized that GCV-TP interferes with the activity of HIV-1 reverse transcriptase and directly suppresses HIV-1 replication. To test this hypothesis, we evaluated the ability of GCV-TP to suppress HIV-1 reverse transcriptase by measuring the polymerizing activity of purified recombinant enzyme using an exogenously added primer-template hybrid (Fig. 2a). In particular, we assessed the extension of a GCV-monophosphate-terminated primer using a multiple nucleotide incorporation assay. Pausing in DNA synthesis was observed at positions n + 1 and n + 3 for HIV-1 reverse transcriptase when GCV monophosphate was located at position n. These pausing sites were overcome with increasing concentrations of nucleotides, suggesting that either compromised nucleotide binding following these pausing sites or hybrid dissociation was caused by GCV monophosphate that was located in the primer strand.

Fig. 2

Fig. 2

Back to Top | Article Outline

Kinetic comparison of ganciclovir triphosphate and dGTP incorporation for HIV-1 reverse transcriptase

To probe the structural determinants governing the efficiency of GCV-TP incorporation, we employed a steady-state kinetic approach to compare GCV-TP incorporation with that of the natural dGTP substrate (Table 1). For reverse transcriptase, the rate of GCV-TP incorporation (denoted by kcat) was similar to that for the natural dGTP substrate; however, HIV-1 reverse transcriptase displayed marked increases in Km values for GCV-TP compared with dGTP (HIV-1 reverse transcriptase: 0.058 μmol/l for dGTP and 4.4 μmol/l for GCV-TP) [37].

Table 1

Table 1

Back to Top | Article Outline

Difference in efficiency of nucleotide incorporation downstream of ganciclovir monophosphate in the primer strand

In an effort to analyze the pattern of inhibition by GCV-TP, a steady-state kinetic analysis of single nucleotide incorporation by HIV reverse transcriptase was conducted; the positions for nucleotide incorporation selected were those immediately following the pausing sites seen in the full-length DNA synthesis experiment for HIV-1 reverse transcriptase (Fig. 2b), namely positions n + 2 and n + 4. The kinetic analysis for these two primer systems with internal GCV-monophosphate residues was compared with the control primer system having the natural dGMP located at position n. The results (Table 2) point to a distinct mechanism of inhibition for HIV-1 reverse transcriptase. Although nucleotide incorporation is 27-fold less efficient at position n + 2 when GCV monophosphate is located at position n than the control with dGMP at position n, the efficiency of nucleotide incorporation is over 1000-fold less efficient at position n + 4 when GCV monophosphate is found at position n, as compared with the control.

Table 2

Table 2

Back to Top | Article Outline

Ganciclovir does not decrease inflammation/activation in human tissues ex vivo

Although the data above indicates that GCV acts directly on HIV, we investigated alternative potential mechanisms of such an inhibition: the decrease of general inflammation of the tissue and the decrease of the activation status of tonsillar cells, in particular of CD4+ T cells. We addressed these two possibilities in two different sets of experiments.

First, we measured the levels of 32 cytokines/chemokines in the supernatants of human tissues treated or not with GCV. Tissues were treated with 5 μmol/l GCV (50% effective concentrations of X4LAI.04) or 50 μmol/l GCV (10-fold higher than 50% effective concentrations). Among the 22 cytokines/chemokines detectable in tonsillar tissue cultures, none were significantly different in tissues treated with GCV (whether tissues were treated with 5 μmol/l or 50 μmol/ GCV) compared to their counterparts in untreated tissue cultures (Table 3).

Table 3

Table 3

In the second set of experiments, we specifically investigated whether GCV affected the viability of tissue cells, in particular the viability of HIV target cells (CD4+ T cells expressing CXCR4 or CCR5) including activated T cells (CD25+ or CD38+; Fig. 1d). After 12 days in culture, we isolated cells from tissue blocks treated with 5 or 50 μmol/l GCV and from donor-matched untreated tissue and stained them for CD3, CD4+, CD8, CXCR4, CCR5, CD25, and CD38. We evaluated the cytopathicity of GCV by comparing the number of cells in GCV-treated tissues with those in matched untreated tissues using a novocyte flow cytometer, which allowed us to acquire a similar volume for each experimental condition. To account for size differences in tissue blocks, we normalized the data by the weight of the tissues. Figure 1e showed that GCV, even at the concentration of 50 μmol/l, did not deplete any cell subset, including activated CD4+ T cells that are primary targets for HIV.

Back to Top | Article Outline

Discussion

It is commonly accepted that persistent immune activation is a driving force of HIV disease. In HIV-1-infected individuals, CMV prevalence is around 90%, and a growing body of evidence suggests that asymptomatic replication of CMV, a member of the HHV family, may be an important contributor to this persistent immune activation (reviewed in [8,21]) accelerating the development of HIV-triggered immunological abnormalities [8,38–41]. In particular, CMV shedding in the genital tract has been associated with increased T-cell immune activation and proliferation in peripheral blood [9–11,40], higher HIV-1 shedding in semen [13,15–17,19], and higher risk of HIV-1 transmission [3,6,7]. Both CMV and HIV are associated with inflammation-related morbidities [21]. Several studies have suggested that both direct and indirect interactions between CMV and HIV could influence their replication and the resulting disease pathogenesis. Freeman et al.[21] reported on several of such interactions making the contribution of CMV to HIV pathogenesis and vice versa difficult to tease apart.

ART has affected the course of HIV infection in a revolutionary way, dramatically decreasing the mortality of HIV-1-infected individuals, and reducing complications associated with opportunistic infections. However, even with sustained suppression of HIV replication, abnormal immune activation persists in most of these individuals. This immune activation is associated with subsequent morbidity and earlier mortality [42]. It has been suggested that CMV contributes to immune activation even when ART has suppressed HIV replication [10,19,43–46].

These observations suggested that treating asymptomatic CMV coinfection may be beneficial by suppressing general T-cell activation, and ultimately decreasing HIV-1 viral load, as well as delaying HIV disease progression [10,22]. In this context, Shin et al.[22] investigated the effect of anti-CMV therapy using valganciclovir on immune activation and HIV-1 viral load in semen. They found that GCV did indeed reduce HIV-1 viral load. However, this reduction was surprisingly not associated with decreases in T-cell activation and in production of inflammatory cytokines.

On the basis of GCV-mediated reduction of HIV-1 genital viral load in the absence of significant genital changes in immunoactivation, we hypothesized along with Shin et al.[22] that GCV has a direct effect on HIV replication provided it is phosphorylated by cellular or HHV TK.

Here, we tested this hypothesis in human tissues ex vivo. These are adequate models for preclinical drug testing, as they support productive HIV infection without exogenous activation and stimulation. Moreover, ex vivo tissues retain cytoarchitecture as well as the pattern of expression of key cell-surface molecules relevant to HIV infection [28]. First, we tested the sensitivity of two laboratory isolates of HIV-1, of CXCR4-tropicX4LAI.04 and of CCR5-tropic R5BaL. We demonstrated that GCV inhibited HIV-1 in both lymphoid and cervicovaginal tissues ex vivo and that GCV inhibited both X4 and R5 HIV-1. HIV-1 inhibition was not limited to laboratory isolates as three HIV-1 primary isolates of different subtypes (A, B, and C) were also suppressed by GCV. Also, GCV sensitivity was not limited to the wild-type HIV-1 as NRTI, nNRTI, fusion inhibitor, and protease inhibitor-resistant viruses were all sensitive to GCV.

To investigate whether HIV inhibition by GCV was the result of a direct inhibition on the virus itself rather than the result of a GCV-mediated decrease of inflammation of the tissue, we measured the levels of 32 cytokines/chemokines (including but not limited to inflammatory cytokines) in the supernatants of tonsillar tissues treated or not with GCV. No significant difference in any levels of cytokines/chemokines was found between treated and untreated tissues. Neither did we find that GCV affected the viability or the number of tonsillar cells, in particular of CD4+ T cells, which are the primary target cells for HIV infection. Thus, it seems that GCV inhibited HIV-1 replication by directly affecting the virus and not by decreasing inflammation or activation of the tissue.

GCV is a synthetic purine nucleoside analogue of guanine and also has to undergo triphosphorylation to become active, with the initial monophosphorylation catalyzed more efficiently by HHV-encoded kinase than by cellular kinases. HHVs seem to be necessary to inhibit HIV-1, as GCV did not inhibit HIV-1 in MT-4 cell cultures (data not shown), which are free of endogenous HHVs [30]. Moreover, we showed here that the 50% effective concentrations of GCV for HIV-1 was approximately 5 μmol/l, whether human tissues were exogenously coinfected with CMV or not. Thus, it seems that kinases expressed by endogenous HHVs activate GCV by adding the first phosphate. HHV-6 U69-encoded kinase is one such enzyme that has been shown to phosphorylate ganciclovir [47].

Both the multisite incorporation assay and the steady-state kinetic analysis suggest that GCV monophosphate inhibits HIV-1 reverse transcriptase by acting as a delayed chain terminator. It is possible that the inhibitor's interaction with reverse transcriptase is more strongly compromised by the lack of the sugar ring stacking with the enzyme that is seen with the natural dGTP substrate.

Using a steady-state kinetic approach, we found that the major mechanism of inhibition of HIV-1 reverse transcriptase by GCV was through a block in nucleotide incorporation at position n+4, as the efficiency of nucleotide incorporation was over 1000-fold less efficient at position n+4 when GCV-monophosphate is found at position n. In comparison, the efficiency of nucleotide incorporation was over 27-fold less efficient at position n+2 when GCV monophosphate was found at position n.

GCV is not the first delayed chain terminator to be described, as entecavir has been shown to block DNA synthesis through inhibition at positions n + 1 (minor) and n + 4 (major) in HIV-1 reverse transcriptase [48]. However, both the chemical structures and the mechanisms of action of GCV and entecavir are different, indicating that diverse mechanisms of delayed chain termination can be obtained from chemical modification of the inhibitor.

The effect of GCV on HIV viral load in CMV-coinfected tissues resembles that of acyclovir (ACV) in HSV-2-coinfected individuals. As with the inhibition of HIV by GCV, the inhibition of HIV by ACV was thought to proceed exclusively via an indirect mechanism. Indeed, the effect of ACV on HIV viral load was initially attributed to the suppression of HSV-2 replication followed by the suppression of HSV-2-triggered inflammation [49,50]. However, we and others [30,51,52] have found that ACV also has a direct effect on HIV-1 after the drug is phosphorylated by HHV. The direct inhibitory effect of ACV on HIV viral load observed ex vivo was recently confirmed in vivo in a double-blind crossover clinical trial [53]. In this trial, we showed that valacyclovir (a prodrug of ACV) suppresses HIV-1 viral load in HIV-1-infected HSV-2 seronegative persons, proving that the effects of valacyclovir on HIV-1 are consistent with a direct effect of ACV on HIV-1 replication [53].

As with what we previously described for ACV/valACV, here, we found that GCV inhibited HIV in human tissues ex vivo but not in cell lines. Indeed, no anti-HIV effect of GCV was observed here in MT-4 cell lines or in H9 cells as reported by Medina et al.[54]. The anti HIV activity of GCV may be directly related to endogenous HHVs present in tissues [30] but not in cell lines [30]. Indeed, HHVs are ubiquitous in the tonsillar tissues. Earlier we found that 96% of tonsillar tissues (received from the same hospital as in the current study) were positive for one or several HHVs. In particular, real-time PCR analysis revealed CMV in 15% of tissues; EBV in 52%; HHV-7 in 89%; and HHV-6 in 96% of tissues.

The anti-HIV activity of the GCV occurs at clinically relevant concentrations. Indeed, although GCV penetration efficiency and drug clearance were unknown for ex-vivo tissues, the calculated 50% effective concentrations of 4.7 μmol/l is in the range of what has been reported in vivo[55]. For a dose of 900 mg of oral valganciclovir per day, the maximum mean plasma concentration is 26.3 μmol/l with a mean Area under the curve0–24 of 51.2 μgh/ml, and plasmatic concentrations remain higher than 4.9 μmol/l for the first 15 h after drug administration [55].

In conclusion, our results suggest that an anti-CMV strategy using valganciclovir in HIV-1-infected individuals may reduce HIV-1 viral load directly by inhibiting HIV-1 reverse transcriptase. Given the potential impact of CMV in immune activation and the potential role of CMV in various human pathologies, in particular in cardiovascular disease, T-cell senescence, and aging, strategies to reduce CMV replication in HIV-infected individuals may turn out to be beneficial.

Back to Top | Article Outline

Acknowledgements

We thank the entire staff of the Department of Pathology of Children's National Medical Center for their generous assistance in obtaining human tonsillar tissues. The work of C.V., A.L., A.A., E.S., and L.M. was supported by the Intramural Research Program of the Eunice Kennedy Shriver National Institute of Child Health and Human Development, NIH. The work of J.A.B. and M.G. was supported by grants from the Canadian Institutes of Health Research (CIHR). M.G. is the recipient of a career award from the FRSQ. J.A.B. is the recipient of a Doctoral Training Scholarship from the Fonds de la recherche en santé du Québec (FRSQ) and a Chemical Biology Training Program Scholarship from the CIHR.

C.V., A.L., A.A., E.S., and L.M. designed ex-vivo experiments performed by C.V., A.L., A.A., and E.S. J.A.B., and M.G. designed and performed the experiments on GCV-TP incorporation by HIV RT. C.V. and J.A.B. wrote the paper and L.M. edited it. All authors reviewed the manuscript.

Back to Top | Article Outline

Conflicts of interest

There are no conflicts of interest.

Back to Top | Article Outline

References

1. Vancikova Z, Dvorak P. Cytomegalovirus infection in immunocompetent and immunocompromised individuals: a review. Curr Drug Targets Immune Endocr Metabol Disord 2001; 1:179–187.
2. Stone SF, Price P, French MA. Cytomegalovirus (CMV)-specific CD8+ T cells in individuals with HIV infection: correlation with protection from CMV disease. J Antimicrob Chemother 2006; 57:585–588.
3. Griffiths PD. CMV as a cofactor enhancing progression of AIDS. J Clin Virol 2006; 35:489–492.
4. Galvin SR, Cohen MS. The role of sexually transmitted diseases in HIV transmission. Nat Rev Microbiol 2004; 2:33–42.
5. Lisco A, Vanpouille C, Margolis L. Coinfecting viruses as determinants of HIV disease. Curr HIV/AIDS Rep 2009; 6:5–12.
6. Gianella S, Morris SR, Vargas MV, Young JA, Callahan B, Richman DD, et al. Role of seminal shedding of herpesviruses in HIV type 1 transmission. J Infect Dis 2013; 207:257–261.
7. Gianella S, Scheffler K, Mehta SR, Little SJ, Freitas L, Morris SR, Smith DM. Seminal shedding of CMV and HIV transmission among men who have sex with men. Int J Environ Res Public Health 2015; 12:7585–7592.
8. Gianella S, Massanella M, Wertheim JO, Smith DM. The sordid affair between human herpesvirus and HIV. J Infect Dis 2015; 212:845–852.
9. Sylwester AW, Mitchell BL, Edgar JB, Taormina C, Pelte C, Ruchti F, et al. Broadly targeted human cytomegalovirus-specific CD4+ and CD8+ T cells dominate the memory compartments of exposed subjects. J Exp Med 2005; 202:673–685.
10. Hunt PW, Martin JN, Sinclair E, Epling L, Teague J, Jacobson MA, et al. Valganciclovir reduces T cell activation in HIV-infected individuals with incomplete CD4+ T cell recovery on antiretroviral therapy. J Infect Dis 2011; 203:1474–1483.
11. Gianella S, Strain MC, Rought SE, Vargas MV, Little SJ, Richman DD, et al. Associations between virologic and immunologic dynamics in blood and in the male genital tract. J Virol 2012; 86:1307–1315.
12. Durier N, Ananworanich J, Apornpong T, Ubolyam S, Kerr SJ, Mahanontharit A, et al. Cytomegalovirus viremia in Thai HIV-infected patients on antiretroviral therapy: prevalence and associated mortality. Clin Infect Dis 2013; 57:147–155.
13. Lisco A, Munawwar A, Introini A, Vanpouille C, Saba E, Feng X, et al. Semen of HIV-1-infected individuals: local shedding of herpesviruses and reprogrammed cytokine network. J Infect Dis 2012; 205:97–105.
14. Olivier AJ, Masson L, Ronacher K, Walzl G, Coetzee D, Lewis DA, et al. Distinct cytokine patterns in semen influence local HIV shedding and HIV target cell activation. J Infect Dis 2014; 209:1174–1184.
15. Mostad SB, Kreiss JK, Ryncarz AJ, Overbaugh J, Mandaliya K, Chohan B, et al. Cervical shedding of cytomegalovirus in human immunodeficiency virus type 1-infected women. J Med Virol 1999; 59:469–473.
16. Speck CE, Coombs RW, Koutsky LA, Zeh J, Ross SO, Hooton TM, et al. Risk factors for HIV-1 shedding in semen. Am J Epidemiol 1999; 150:622–631.
17. Sheth PM, Danesh A, Sheung A, Rebbapragada A, Shahabi K, Kovacs C, et al. Disproportionately high semen shedding of HIV is associated with compartmentalized cytomegalovirus reactivation. J Infect Dis 2006; 193:45–48.
18. Gianella S, Morris SR, Anderson C, Spina CA, Vargas MV, Young JA, et al. Herpes viruses and HIV-1 drug resistance mutations influence the virologic and immunologic milieu of the male genital tract. AIDS 2013; 27:39–47.
19. Gianella S, Massanella M, Richman DD, Little SJ, Spina CA, Vargas MV, et al. Cytomegalovirus replication in semen is associated with higher levels of proviral HIV DNA and CD4+ T cell activation during antiretroviral treatment. J Virol 2014; 88:7818–7827.
20. Deeks SG, Verdin E, McCune JM. Immunosenescence and HIV. Curr Opin Immunol 2012; 24:501–506.
21. Freeman ML, Lederman MM, Gianella S. Partners in crime: the role of CMV in immune dysregulation and clinical outcome during HIV infection. Curr HIV/AIDS Rep 2016; 13:10–19.
22. Shin LY, Sheth PM, Persad D, Kovacs C, Kain T, Diong C, et al. Impact of CMV therapy with valganciclovir on immune activation and the HIV viral load in semen and blood: an observational clinical study. J Acquir Immune Defic Syndr 2014; 65:251–258.
23. Condra JH, Schleif WA, Blahy OM, Gabryelski LJ, Graham DJ, Quintero JC, et al. In vivo emergence of HIV-1 variants resistant to multiple protease inhibitors. Nature 1995; 374:569–571.
24. Johnston E, Dupnik KM, Gonzales MJ, Winters MA, Rhee SY, Imamichi T, et al. Panel of prototypical infectious molecular HIV-1 clones containing multiple nucleoside reverse transcriptase inhibitor resistance mutations. AIDS 2005; 19:731–733.
25. Richman D, Shih CK, Lowy I, Rose J, Prodanovich P, Goff S, et al. Human immunodeficiency virus type 1 mutants resistant to nonnucleoside inhibitors of reverse transcriptase arise in tissue culture. Proc Natl Acad Sci U S A 1991; 88:11241–11245.
26. Rimsky LT, Shugars DC, Matthews TJ. Determinants of human immunodeficiency virus type 1 resistance to gp41-derived inhibitory peptides. J Virol 1998; 72:986–993.
27. Sullivan PS, Do AN, Ellenberger D, Pau CP, Paul S, Robbins K, et al. Human immunodeficiency virus (HIV) subtype surveillance of African-born persons at risk for group O and group N HIV infections in the United States. J Infect Dis 2000; 181:463–469.
28. Grivel JC, Margolis L. Use of human tissue explants to study human infectious agents. Nat Protoc 2009; 4:256–269.
29. Biancotto A, Iglehart SJ, Lisco A, Vanpouille C, Grivel JC, Lurain NS, et al. Upregulation of human cytomegalovirus by HIV type 1 in human lymphoid tissue ex vivo. AIDS Res Hum Retroviruses 2008; 24:453–462.
30. Lisco A, Vanpouille C, Tchesnokov EP, Grivel JC, Biancotto A, Brichacek B, et al. Acyclovir is activated into a HIV-1 reverse transcriptase inhibitor in herpesvirus-infected human tissues. Cell Host Microbe 2008; 4:260–270.
31. Vanpouille C, Introini A, Morris SR, Margolis L, Daar ES, Dube MP, et al. Distinct cytokine/chemokine network in semen and blood characterize different stages of HIV infection. AIDS 2016; 30:193–201.
32. Vanpouille C, Khandazhinskaya A, Karpenko I, Zicari S, Barreto-de-Souza V, Frolova S, et al. A new antiviral: chimeric 3TC-AZT phosphonate efficiently inhibits HIV-1 in human tissues ex vivo. Antiviral Res 2014; 109:125–131.
33. Le Grice SF, Gruninger-Leitch F. Rapid purification of homodimer and heterodimer HIV-1 reverse transcriptase by metal chelate affinity chromatography. Eur J Biochem 1990; 187:307–314.
34. Tchesnokov EP, Obikhod A, Massud I, Lisco A, Vanpouille C, Brichacek B, et al. Mechanisms associated with HIV-1 resistance to acyclovir by the V75I mutation in reverse transcriptase. J Biol Chem 2009; 284:21496–21504.
35. Larder BA, Kemp SD. Multiple mutations in HIV-1 reverse transcriptase confer high-level resistance to zidovudine (AZT). Science 1989; 246:1155–1158.
36. Dupnik k GM, Shafer RW. Most multidrug-resistant HIV-1 reverse transcriptase clones in plasma encode functional reverse transcriptase enzymes. Antivir Ther 2001; 6 (Suppl. 1):42.
37. Marchand B, Tchesnokov EP, Götte M. The pyrophosphate analogue foscarnet traps the pre-translocational state of HIV-1 reverse transcriptase in a Brownian ratchet model of polymerase translocation. J Biol Chem 2007; 282:3337–3346.
38. Detels R, Leach CT, Hennessey K, Liu Z, Visscher BR, Cherry JD, et al. Persistent cytomegalovirus infection of semen increases risk of AIDS. J Infect Dis 1994; 169:766–768.
39. Emery VC, Sabin C, Feinberg JE, Grywacz M, Knight S, Griffiths PD. Quantitative effects of valacyclovir on the replication of cytomegalovirus (CMV) in persons with advanced human immunodeficiency virus disease: baseline CMV load dictates time to disease and survival. The AIDS Clinical Trials Group 204/Glaxo Wellcome 123-014 International CMV Prophylaxis Study Group. J Infect Dis 1999; 180:695–701.
40. Spector SA, Wong R, Hsia K, Pilcher M, Stempien MJ. Plasma cytomegalovirus (CMV) DNA load predicts CMV disease and survival in AIDS patients. J Clin Invest 1998; 101:497–502.
41. Hsue PY, Hunt PW, Sinclair E, Bredt B, Franklin A, Killian M, et al. Increased carotid intima-media thickness in HIV patients is associated with increased cytomegalovirus-specific T-cell responses. AIDS 2006; 20:2275–2283.
42. Lederman MM, Funderburg NT, Sekaly RP, Klatt NR, Hunt PW. Residual immune dysregulation syndrome in treated HIV infection. Adv Immunol 2013; 119:51–83.
43. Deayton J, Mocroft A, Wilson P, Emery VC, Johnson MA, Griffiths PD. Loss of cytomegalovirus (CMV) viraemia following highly active antiretroviral therapy in the absence of specific anti-CMV therapy. AIDS 1999; 13:1203–1206.
44. Naeger DM, Martin JN, Sinclair E, Hunt PW, Bangsberg DR, Hecht F, et al. Cytomegalovirus-specific T cells persist at very high levels during long-term antiretroviral treatment of HIV disease. PLoS One 2010; 5:e8886.
45. Gianella S, Anderson CM, Var SR, Oliveira MF, Lada SM, Vargas MV, et al. Replication of human herpesviruses is associated with higher HIV DNA levels during antiretroviral therapy started at early phases of HIV infection. J Virol 2016; 90:3944–3952.
46. Freeman ML, Mudd JC, Shive CL, Younes SA, Panigrahi S, Sieg SF, et al. CD8 T-cell expansion and inflammation linked to CMV coinfection in ART-treated HIV infection. Clin Infect Dis 2016; 62:392–396.
47. De Bolle L, Michel D, Mertens T, Manichanh C, Agut H, De Clercq E, et al. Role of the human herpesvirus 6 u69-encoded kinase in the phosphorylation of ganciclovir. Mol Pharmacol 2002; 62:714–721.
48. Tchesnokov EP, Obikhod A, Schinazi RF, Gotte M. Delayed chain termination protects the antihepatitis B virus drug entecavir from excision by HIV-1 reverse transcriptase. J Biol Chem 2008; 283:34218–34228.
49. Van de Perre P, Segondy M, Foulongne V, Ouedraogo A, Konate I, Huraux JM, et al. Herpes simplex virus and HIV-1: deciphering viral synergy. Lancet Infect Dis 2008; 8:490–497.
50. Vanpouille C, Lisco A, Margolis L. Acyclovir: a new use for an old drug. Curr Opin Infect Dis 2009; 22:583–587.
51. McMahon MA, Siliciano JD, Lai J, Liu JO, Stivers JT, Siliciano RF, et al. The antiherpetic drug acyclovir inhibits HIV replication and selects the V75I reverse transcriptase multidrug resistance mutation. J Biol Chem 2008; 283:31289–31293.
52. Vanpouille C, Lisco A, Introini A, Grivel JC, Munawwar A, Merbah M, et al. Exploiting the anti-HIV-1 activity of acyclovir: suppression of primary and drug-resistant HIV isolates and potentiation of the activity by ribavirin. Antimicrob Agents Chemother 2012; 56:2604–2611.
53. Vanpouille C, Lisco A, Grivel JC, Bassit LC, Kauffman RC, Sanchez J, et al. Valacyclovir decreases plasma HIV-1 RNA in HSV-2 seronegative individuals: a randomized placebo-controlled crossover trial. Clin Infect Dis 2015; 60:1708–1714.
54. Medina DJ, Hsiung GD, Mellors JW. Ganciclovir antagonizes the antihuman immunodeficiency virus type 1 activity of zidovudine and didanosine in vitro. Antimicrob Agents Chemother 1992; 36:1127–1130.
55. Pescovitz MD, Ettenger RB, Strife CF, Sherbotie JR, Thomas SE, McDiarmid S, et al. Pharmacokinetics of oral valganciclovir solution and intravenous ganciclovir in pediatric renal and liver transplant recipients. Transpl Infect Dis 2010; 12:195–203.
Keywords:

cytomegalovirus; delayed-chain termination; ganciclovir; HIV-1; reverse transcriptase

Supplemental Digital Content

Back to Top | Article Outline
Copyright © 2017 Wolters Kluwer Health, Inc.