Secondary Logo

Journal Logo

BASIC SCIENCE

In HIV-positive patients, myeloid-derived suppressor cells induce T-cell anergy by suppressing CD3ζ expression through ELF-1 inhibition

Tumino, Nicolaa,c; Turchi, Federicaa; Meschi, Silviab; Lalle, Eleonorab; Bordoni, Veronicaa; Casetti, Ritaa; Agrati, Chiaraa; Cimini, Eleonoraa; Montesano, Carlac; Colizzi, Vittorioc; Martini, Federicoa; Sacchi, Alessandraa

Author Information
doi: 10.1097/QAD.0000000000000871

Abstract

Introduction

Although T cells potentially represent key actors in the first line of defence during the early phases of HIV infection [1,2][1,2], T-cell dysfunction in infected HIV individuals is a common event associated to disease progression [3]. An important factor associated to a defective pathogen clearance in chronic infection is T-cell exhaustion, defined as the progressive loss of functions by consumption in antigen-specific T cells [4,5][4,5].

It has been previously shown that during HIV infection, a down-modulation of CD3ζ is induced on αβ and γδ T cells [6,7][6,7], correlating with their functional inability. In other chronic inflammations and in high-load antigenic persistence, selective defects in global CD8+ T-cell function have been associated with down-regulation of CD3ζ expression. These include autoimmune disorders [8], malignancy [9], and microbial infections [10–12][10–12][10–12].

CD3ζ molecule is a 16-kDa transmembrane protein expressed as a disulfide-linked homodimer; it is indispensable for coupling antigen recognition by the T-cell receptor (TCR) and downstream T-cell response [13,14][13,14], and its down-modulation could represent a mechanism by which T-cell anergy is induced during HIV infection.

Different factors were described to induce an impairment of CD3ζ expression, such as arginine deprivation [15] or tryptophan catabolites accumulation [16]. Both mechanisms are mediated by the activity of arginase I (ArgI) and indoleamine 2,3-dioxygenase (IDO), mostly produced by myeloid-derived suppressor cells (MDSC) [17]. MDSC are a heterogeneous population comprising myeloid-cell progenitors [18]. In pathological conditions such as cancer, various infectious diseases or some autoimmune disorders, a partial block in the differentiation of immature myeloid cells into mature myeloid cells results in an expansion of the MDSC population [17]. Importantly, the activation of these cells in a pathological context results in the up-regulated expression of immune suppressive factors such as Arg1, IDO and inducible nitric oxide synthase (iNOS), and an increase in the production of NO (nitric oxide) and reactive oxygen species (ROS) [17]. MDSC can be divided into two subsets: monocytic (M-MDSC) and granulocytic (Gr-MDSC). In humans, the monocytic subset contains CD14+ cells, whereas the granulocytic subset contains CD14 CD15+ cells [17,19][17,19].

Two recent papers show that levels of MDSC are elevated in HIV+ patients and correlate with disease progression [20,21][20,21]. However, the mechanisms used by MDSC to inhibit T-cell function against HIV-infected cells have not been clearly shown. In the present work we evaluated the role of Gr-MDSC in regulating CD3ζ expression during HIV infection. We found that in HIV+ patients, the presence of a high frequency of Gr-MDSC correlates with a lower expression of CD3ζ; moreover, the depletion of Gr-MDSC in vitro was able to restore CD3ζ level in T cells, thus enhancing the HIV-specific T-cell response. As for the relevant mechanism, we showed that CD3ζ down-modulation was due to the inhibition of its transcription factors ELF-1 (E74 like-factor 1), induced by Gr-MDSC throughout a cell contact-dependent mechanism.

Materials and methods

Study population

One hundred and five HIV+ patients afferent to the ‘Lazzaro Spallanzani’ National Institute for Infectious Diseases (INMI) (Rome, Italy) were recruited. Eighty-five HIV+ patients on cART with CD4+ T-cell counts ranging from 42 to 1853 cells/μl (median 687 cells/μl), and viral loads ranging from less than 40 to 311 695 viral RNA copies/ml (median <40 viral RNA copies/ml; 12 patients had a viral load >50 copies/ml); and 20 HIV+ patients off therapy, with CD4+ T-cell counts ranging from 15 to 1156 cells/μl (median 520 cells/μl) and viral load ranging from less than 40 to 2 607 565 viral RNA copies/ml (median 55 984 viral RNA copies/ml), were recruited for the purpose of this study. All patients were selected by excluding any co-morbidity, such as hepatitis C virus, hepatitis B virus, Epstein Barr virus, Mycobacterium tuberculosis co-infections and malignancies. Sixteen HIV-seronegative donors were used as a control and were processed under the same conditions. Features of the study population are reported in Table S1, http://links.lww.com/QAD/A771 of supplementary data. The study was approved by the Institutional Review Board of INMI (n. 78 dated 21 Nov. 2013). Residual peripheral blood from HIV+ patients obtained for CD4+ T-cell counts was used.

Peripheral blood mononuclear cells separation and cell culture

Peripheral blood mononuclear cells (PBMC) were isolated by density gradient centrifugation (Lympholyte-H; Cederlane, Canada). After separation, PBMC were cultured in RPMI 1640 (EuroClone, Italy) supplemented with 10% heat-inactivated fetal bovine serum (EuroClone), 2 mmol/l L-glutamine, 10 mmol/l HEPES buffer (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid), 2 mmol/l penicillin and 50 μg/ml streptomycin (EuroClone). Cells were maintained at 37°C in humidified air with 5% CO2. When indicated, PBMC were treated with 500 μg/ml N-hydroxy-nor-L-arginine (NOHA, Calbiochem, Germany), 500 μg/ml N-monomethyl-L-arginine (L-NMMA, Calbiochem, Germany), 300 UI/ml Catalase (Sigma-Aldrich, St Louis, Missouri, USA) and 500 μg/ml 1-methyl tryptophan (1-MT, Sigma-Aldrich), 10 μg/ml neutralizing anti-PD-L1 (BioLegend, USA). The HIV-specific CD8+ T-cell response was induced by stimulating with a pool of HIV peptides (Group-specific antigen, Gag; Trans-activator of transcription, Tat; Negative regulator factor, Nef ) specifically designed for CD8+ T-cell response (from NIH/AIDS Reagent Program, USA) for 18 h. γδ T-cell response was evaluated stimulating PBMC with isopentenyl pyrophosphate (IPP, 100 μg/ml, Sigma-Aldrich) for 18 h. Brefeldin A (10 μg/ml, Sigma-Aldrich) was added after 1 h of stimulation in order to prevent cytokine secretion. In selected experiments, PBMC obtained from HIV+ patients and healthy donors were incubated with 10 μg/ml of actinomycin-D (Sigma-Aldrich) for 30 min, 1, 2, and 6 h.

Flow cytometry

CD3ζ expression was accomplished using FITC-conjugated anti-Vδ2, APC-conjugated anti-CD3, PerCP-conjugated anti-CD8 or anti-CD4 monoclonal antibodies (mAbs) (BD Biosciences, USA), and PE-labelled anti-CD3ζ (Beckman Coulter, France).

In brief, 0.5×106 PBMC were incubated with antibodies for membrane staining at 4°C for 15 min, and then washed and fixed with 1% paraformaldehyde (PFA) (Sigma-Aldrich). For intracellular staining, cells were permeabilized, and stained with PE-labelled anti-CD3ζ. Acquisition of 100 000 events in the lymphocyte-gated population was performed using FACS Calibur and analysed with CellQuest software (Becton Dickinson, USA). The number of CD3ζ molecules per cell was evaluated using the Phycoerythrin Fluorescence Quantization Kit (BD Biosciences) according to the manufacturer's instructions.

Evaluation of the MDSC percentage was accomplished with 0.5×106 cells stained with FITC-conjugated anti-CD15, PE-conjugated anti-CD33, PerCP-conjugated anti-HLA-DR, a cocktail of APC-conjugated antibodies anti-CD3, -CD56, -CD19 (Lin), APC-H7-conjugated anti-CD14 and PE-Cy7-conjugated anti-CD11b, PE-conjugated anti-CD124 mAbs, PE-conjugated anti-PD-L1 mAbs (BD Biosciences). Acquisition of 100 000 events was performed in the leukocyte-gated population on FACS CANTO II and analysed with FACS DIVA software (BD Biosciences).

For intracellular staining, PBMC were stained with FITC-conjugated anti-Vδ2, APC-conjugated anti-IFNγ, APC-H7-conjugated anti-CD8, V500-conjugated anti-CD3 (BD Biosciences) as described above. Acquisition of 100 000 events in the lymphocyte-gated population were performed on FACS CANTO II and analysed with FACS DIVA software (BD Biosciences).

Gr-MDSC and T cells separation and cell culture

Gr-MDSC depletion was performed using magnetic selection. Briefly, PBMC from cART-treated patients were stained with anti-CD15 FITC-conjugated mAb (BD Biosciences). After washing, cells were labelled with anti-FITC microbeads (Miltenyi Biotec, Germany). The purity of sorted Gr-MDSC was >95%, as verified by flow cytometry (data not shown). T cells were purified by using a Pan T-cell isolation kit (Miltenyi Biotec) according with manufacturer's instructions.

After separation, Gr-MDSC-depleted PBMC or purified T cells were cultured with Gr-MDSC at different ratios (1 : 0, 1 : 1, 1 : 4) for 18 h. In selected experiments, Gr-MDSC-depleted PBMC were cultured with Gr-MDSC separated by a semi-permeable membrane (0.4-μm pore transwell; BD FALCON, USA), and when indicated, Gr-MDSC were fixed with 1% paraformaldehyde (1% PFA) at room temperature for 10 min and cultured with Gr-MDSC-depleted PBMC (1 : 1 ratio) for 18 h.

RNA extraction and real-time PCR

Total RNA extraction from 1.5×106 PBMC or purified T cells was performed with RNeasy mini kit (QIAGEN, USA) following the manufacturer's instructions. Reverse-transcription was conducted by TaqMan Reverse Transcription Reagent kit (Applied Biosystems, USA).

The quantification of mRNA encoding for CD3ζ was performed by a Taqman real-time PCR (RT-PCR) method. The following primers and specific probe were used: forward GGTGTCATTCTCACTGCCTTGTT, reverse TACCAGCAGGGCCAGAACC, probe CTGAGAGTGAAGTTCAGC, covalently labelled with 6-carboxyfluorescein (FAM) at the 5′-end and with 6-carboxy-tetramethylrhodamine (TAMRA) as a quencher dye at the 3′-end.

Western blotting

PBMC or purified T cells (2 × 106) were lysed using a protein extraction kit (Complete Lysis-M, ROCHE, Switzerland). Ten micrograms of lysate were separated on a 10% gradient SDS-PAGE and electroblotted onto Hybond ECL nitrocellulose membrane (Amersham Life Science, Germany). Membranes were blocked in PBS, 5% milk powder and 0.1% Tween 20. Membranes were stained overnight with an anti-ELF-1 (C20) (Santa Cruz Biotechnology, USA), or β-actin (C4) (Merck Millipore, Germany) Abs, followed by 1-h incubation with goat ant-rabbit IgG-HRP (Upstate Biotechnology, USA). Signals were detected by enhanced chemo-luminescence (Amersham Bioscience, Germany).

Statistical analysis

GraphPad Prism version 5.00 for Windows (GraphPad Software, USA) was used to perform the analysis. A nonparametric test (Mann–Whitney) was used to compare patient groups. The parametric Spearman test was used to evaluate correlations. A P less than 0.05 was considered statistically significant.

Results

Granulocytic myeloid-derived suppressor cells are decreased in immunological successfully treated patients

We evaluated the frequency of Gr-MDSC in HIV+ patients by flow cytometry, and we found that Gr-MDSC, identified as Lin- HLA-DRlow/- CD11b+ CD33+ CD14 CD15+ CD124+, were expanded compared with healthy donors (Fig. 1a and b).

Fig. 1
Fig. 1:
Gr-MDSC are expanded during HIV infection.Gr-MDSC were identified after PBMC separation by flow cytometry. (a) Representative plots of the adopted gating strategy to identify MDSC. In the morphological gate (ForwardScatter (FSC)/SideScatter (SSC)) we excluded debris, then we gated Lin-/HLA DRlow/- cells. In this gate we selected CD11b+/CD33+ cells (MDSC, blue dots). The expression of CD14, CD15 and CD124 is shown on cells selected from the morphological gate, indicating in blue the MDSC population. (b) Frequency of Gr-MDSC in PBMC from 16 healthy donors (HD), 85 HIV+ patients undergoing antiretroviral therapy (cART) and 20 HIV+ patients not on antiretroviral therapy (no-cART). (c) Percentage of Gr-MDSC in HD- and cART-treated HIV+ patients divided into four groups according to CD4+ T-cell number (CD4+ <400 n = 14; 400< CD4+ <600 n = 17; 600< CD4+ <800 n = 24; CD4+ >800 n = 30). Results are shown as box and whiskers: the box encompasses the interquartile range of individual measurements, the horizontal bar-dividing line indicates the median value, and the whiskers represent minimum and maximum values.

Moreover, we did not find any differences in Gr-MDSC levels between cART-treated and non-treated patients (Fig. 1b). Albeit no correlation was observed between MDSC frequency and CD4+ T-cell count (data not shown), grouping cART patients in those with CD4+ T-cell count over 800 cells/μl (CD4+ >800), between 800 and 600 cells/μl (600< CD4+ <800), between 600 and 400 (400< CD4+ <600) and lower than 400 cells/μl (CD4+ <400), the latest had the highest frequency of Gr-MDSC (Fig. 1c). No difference was found among the other three groups, although they were still higher than healthy donors (CD4+ >800 vs. healthy donors P = 0.0005; 600< CD4+ <800 vs. healthy donors P = 0.0005; 400< CD4+ <600 P = 0.001; CD4+ <400 vs. healthy donors P < 0.0001). No correlation with viral load was observed (data not shown).

Gr-MDSC regulate CD3ζ expression on T cells

We previously reported that CD3ζ expression on Vγ9Vδ2 T cells from HIV+ patients is down-modulated compared with healthy donors [7], thus explaining their anergy [22]. In the present study, we found that the reduction of CD3ζ level shown on Vγ9Vδ2 T cells also occurs on CD4+ and CD8+ T cells from the same HIV+ patients (Fig. 2a), confirming previously reported data [23] and suggesting that all T-cell subsets are affected.

Fig. 2
Fig. 2:
Gr-MDSC regulate CD3ζ expression.(a) CD3ζ expression was analysed in CD8+, CD4+ and Vγ9Vδ2 T cells from 105 HIV+ patients and 16 healthy donors (HD) by flow cytometry. CD3ζ is shown as the number of molecules per cell. Results are shown as box and whiskers: the box encompasses the interquartile range of individual measurements, the horizontal bar-dividing line indicates the median value, and the whiskers represent minimum and maximum values. (b) The correlation between CD3ζ expression (number of molecules/cell) and Gr-MDSC frequency evaluated on CD8+, CD4+ and Vγ9Vδ2 T cells from 85 HIV+ patients on cART by flow cytometry. The nonparametric Spearman's test was used to describe correlations. (c) CD3ζ expression (number of molecules/cell) in the indicated T-cell subsets after 18 h of culture of PBMC, Gr-MDSC-depleted PBMC (PBMC-mdsc), and Gr-MDSC-depleted PBMC cultured with purified Gr-MDSCs at different ratios (PBMC+mdsc 1 : 1, PBMC+mdsc 1 : 4) from 14 HIV+ patients (CD4+ T-cell count: 520 cells/μl, range 105–1853 cells/μl; viral load: <40, range <40–86 260 HIV RNA copies/ml) on cART. Results are shown as box and whiskers: the box encompasses the interquartile range of individual measurements, the horizontal bar-dividing line indicates the median value, and the whiskers represent minimum and maximum values.

Interestingly, a strong inverse correlation was observed between Gr-MDSC frequency and the expression of CD3ζ on CD8+ and CD4+ T cells, and on Vγ9Vδ2 T cells from HIV+ patients (Fig. 2b), suggesting a direct role of Gr-MDSC in affecting CD3ζ expression.

To demonstrate that Gr-MDSC from HIV+ patients are indeed able to suppress CD3ζ expression, we depleted Gr-MDSC, and we tested the expression of CD3ζ in Gr-MDSC-depleted PBMC. Gr-MDSC depletion induced a significant restoration of CD3ζ expression on all T-cell subsets (Fig. 2c); moreover, when Gr-MDSC-depleted PBMC were cultured with purified Gr-MDSC at a different ratio (1 : 1, 1 : 4), a strong down-modulation of CD3ζ was again observed (Fig. 2c). These data indicate that Gr-MDSC are able to control CD3ζ expression during HIV infection on all T-cell subsets studied. This phenomenon was not observed when monocytes were used (Fig. S1, http://links.lww.com/QAD/A771), it was not due to the induction of cell death (Fig. S2, http://links.lww.com/QAD/A771), and it was not observed on other molecules, as CD8 (Fig. S2, http://links.lww.com/QAD/A771).

Further, we excluded that Gr-MDSC act on CD3ζ throughout a bystander effect of other cells; in fact Gr-MDSC cultured with purified T cells are able to induce CD3ζ down-modulation (Fig. S3A, http://links.lww.com/QAD/A771).

The effect on CD3ζ is a general feature of Gr-MDSC; indeed, purified Gr-MDSC from healthy donors cultured with autologous PBMC induce a decrease of CD3ζ (Fig. S3B, http://links.lww.com/QAD/A771).

Gr-MDSC-induced down-modulation of CD3ζ is associated to T-cell response impairment

We wondered whether Gr-MDSC could affect both HIV-specific T cells and Vγ9Vδ2 T-cell responses. To this aim, we stimulated PBMC from HIV+ patients with HIV peptides or phosphoantigen (IPP), and evaluated IFNγ production in CD8+ T cells and Vγ9Vδ2 T cells, respectively. We found an inverse correlation between the frequency of Gr-MDSC and the percentage of CD8+ T cells producing IFNγ (Fig. 3a). We then evaluated if Gr-MDSC depletion is able to enhance the HIV-specific T-cell response, possibly by restoring CD3ζ. To answer this question, we depleted Gr-MDSC, and stimulated the remaining PBMC with HIV peptides. Gr-MDSC depletion induced a significant enhancement of HIV-specific IFNγ response compared with whole PBMC in 11 out of 14 patients (Fig. 3b and Fig. S4, http://links.lww.com/QAD/A771), indicating that Gr-MDSC regulate the HIV-specific T-cell response, possibly by down-modulating CD3ζ. An inverse correlation was found between the Gr-MDSC proportion and the percentage of Vγ9Vδ2 T cells producing IFNγ upon IPP stimulation (Fig. 3c), even though Gr-MDSC depletion does not restore IPP-induced IFNγ production (Fig. 3d).

Fig. 3
Fig. 3:
Gr-MDSC depletion restores CD8+ but not γδ T-cell functionality.(a) Correlation between Gr-MDSC frequency and proportion of IFNγ+ CD8+ T cells (among CD8+ T cells) from 19 HIV+ patients on cART (CD4+ T-cell count: 692 cells/μl, range 207–1223 cells/μl; viral load: <40, range <40–42 420 HIV RNA copies/ml), after stimulation with a pool of HIV peptides (evaluated by flow cytometry). (b) Evaluation of proportion of IFNγ+ CD8+ T cells (among CD8+ T cells) after HIV peptide stimulation in PBMC and Gr-MDSC-depleted PBMC (PBMC-mdsc) from 14 HIV+ patients on cART (CD4+ T-cell count: 658 cells/μl, range 207–1223 cells/μl; viral load: <40, range <40–42 420 HIV RNA copies/ml). (c) Correlation between Gr-MDSC frequency and the proportion of IFNγ+ Vγ9Vδ2 T cells (evaluated by flow cytometry) from 19 HIV+ patients on cART (CD4+ T-cell count: 692 cells/μl, range 207–1223 cells/μl; viral load: <40, range <40–42 420 HIV RNA copies/ml) after stimulation with IPP. (d) Evaluation of the proportion of IFNγ+ Vγ9Vδ2 T cells after IPP stimulation in PBMC and Gr-MDSC-depleted PBMC (PBMC-mdsc) from seven HIV+ patients on cART. Results are shown as before–after graph.

Gr-MDSC down-modulate CD3ζ by a cell contact-dependent mechanism

To investigate whether the effect of Gr-MDSC on CD3ζ is cell contact-dependent, we co-cultured Gr-MDSC and PBMC at a 1 : 1 ratio separated by a semi-permeable membrane. We found that when co-cultured separately, Gr-MDSC were not able to down-modulate CD3ζ expression on T cells (Fig. 4), indicating that Gr-MDSC action needs cell-to-cell contact. Furthermore, to evaluate whether the cell-contact occurs via interaction between molecules expressed on the cell membrane, or via active mechanisms requiring living cells, purified Gr-MDSC were fixed with 1% PFA and then cultured with autologous PBMC. PFA-fixed Gr-MDSC were still able to induce down-modulation of CD3ζ on T cells (Fig. 4), suggesting that this phenomenon is mediated by molecule/s constitutively expressed on the Gr-MDSC membrane, also after fixation. It was demonstrated that during HIV infection CD3ζ level correlated with PD-L1 expression on neutrophils [24]. We found that Gr-MDSC express PD-L1 (Fig. S5A); however, when PBMCs were cultured with a neutralizing anti-PD-L1 mAb no effects were observed on the expression of CD3ζ (Fig. S5B, http://links.lww.com/QAD/A771).

Fig. 4
Fig. 4:
Gr-MDSC are able to down-regulate CD3ζ expression by a cell contact-dependent mechanism.CD3ζ expression (number of molecules/cell) on CD8+, CD4+ and Vγ9Vδ2 T cells from 14 HIV+ patients on cART (CD4+ T-cell count: 520 cells/μl, range 105–1853 cells/μl; viral load: <40, range <40–86 260 HIV RNA copies/ml). In PBMC, Gr-MDSC-depleted PBMC (PBMC-mdsc), Gr-MDSC-depleted PBMC cultured with purified Gr-MDSC (PBMC+mdsc 1 : 1), Gr-MDSC-depleted PBMC cultured in transwell with purified Gr-MDSC (PBMC+mdsc 1 : 1 TW), and Gr-MDSC-depleted PBMC cultured with purified PFA fixed Gr-MDSC (PBMC+mdsc 1 : 1 PFA). Results are shown as box and whiskers: the box encompasses the interquartile range of individual measurements, the horizontal bar-dividing line indicates the median value, and the whiskers represent minimum and maximum values.

Gr-MDSC inhibit CD3ζ mRNA expression

We asked whether the modulation of CD3ζ occurs at the transcriptional level. To investigate this possibility, a real-time PCR was carried out to establish the level of mRNA coding CD3ζ. Figure 5a shows that compared with healthy donors, HIV+ patients present a lesser quantity of mRNA coding CD3ζ. This data was confirmed by using purified T cells to normalize for T-cell number (Fig. S6A, http://links.lww.com/QAD/A771). Further, we depleted Gr-MDSC, and a real-time PCR was performed on the remaining PBMC after 18 h of culture. We found that Gr-MDSC depletion restores the expression of CD3ζ mRNA (Fig. 5b), indicating that Gr-MDSC affects the expression of CD3ζ molecule by interfering with the transcription process.

Fig. 5
Fig. 5:
MDSC inhibit CD3ζ mRNA by suppressing ELF-1 expression.(a) mRNA coding CD3ζ evaluated by RT-PCR on PBMC from 26 HIV+ patients on cART (CD4+ T-cell count: 497.5 cells/μl, range 194–910 cells/μl; viral load: <40, range <40–117100 HIV RNA copies/ml) and five healthy donors (HD). (b) mRNA coding CD3ζ evaluated by RT-PCR on PBMC and Gr-MDSC-depleted PBMC (PBMC-mdsc) from five HIV+ patients on cART (CD4+ T-cell count: 638 cells/μl, range 366–1853 cells/μl; viral load: <40, range <40–86 260 HIV RNA copies/ml). Results are expressed as the number of copies of mRNA coding CD3ζ normalized with mRNA coding β-actin. Analysis of CD3ζ transcription factors ELF-1 by western blot. Panel (c) shows the representative results from two HD and four HIV+ patients. (d) ELF-1 expression in PBMC from five HD and nine HIV+ patients on cART (CD4+ T-cell count: 232 cells/μl, range 132–455 cells/μl; viral load: <40, range <40–46 HIV RNA copies/ml). Results are shown as the ratio between the optical densities (OD) of ELF-1 and β-actin. (e) Representative results of ELF-1 expression by western blot in PBMC and Gr-MDSC-depleted PBMC (PBMC-mdsc) from three out of six HIV+ patients on cART (CD4+ T-cell count: 749 cells/μl, range 524–1223 cells/μl; viral load: <40, range <40–42 420 HIV RNA copies/ml). Results are shown as box and whiskers: the box encompasses the interquartile range of individual measurements, the horizontal bar-dividing line indicates the median value, and the whiskers represent minimum and maximum values.

Gr-MDSC inhibit the CD3ζ transcription factor ELF-1 in T cells

We wondered whether the reduction of CD3ζ mRNA was due to its lower stability. We treated PBMC from HIV+ patients and healthy donors with actinomycin D. We found that CD3ζ mRNA from PBMC treated with actinomycin D is very stable in both HIV+ patients and healthy donors and no difference was observed between the two groups (data not shown), suggesting that the inhibition of CD3ζ is not due to mRNA instability.

One of the factors regulating the transcription of the CD3ζ gene is ELF-1 [25]; we evaluated the expression of this factor in the PBMC of HIV+ patients and healthy donors by western blotting. Figure 5c shows the results obtained from two representative healthy donors and four HIV+ patients. As expected, two bands are present, corresponding to the cytoplasmic and nuclear forms of ELF-1 (80 and 98 kDa, respectively). We observed that in HIV+ patients, both cytoplasmic and nuclear forms are lower than in healthy donors (Fig. 5c and d). To normalize for the number of T cells, we performed the same experiment with purified T cells, confirming previous result (Fig. S6B, http://links.lww.com/QAD/A771). These data indicate that the diminished expression of this transcription factor might participate to the down-modulation of CD3ζ mRNA in HIV+ patients. To confirm this hypothesis, we depleted Gr-MDSC from the PBMC of HIV+ patients with low CD3ζ expression and after 18 h we evaluated ELF-1 expression by western blot. We found that depletion of Gr-MDSC restored the expression of ELF-1, indicating that these cells are able to modulate CD3ζ by affecting the expression of its transcription factor (Fig. 5e).

Discussion

The T-cell response against pathogens occur following the initial step of recognition of specific antigen and the transmission of activation signals, which are mediated by the TCR. During the past decade, various reports have been published showing that during chronic inflammation, such as in cancer [26–28][26–28][26–28], infections [7,29–31][7,29–31][7,29–31][7,29–31] and autoimmune disorders [32,33][32,33], T cells become functionally impaired. In all of these cases, it has been shown that the immune dysfunction is associated with the loss of expression of CD3ζ molecule. Interestingly, such CD3ζ down-regulation has also been observed in T cells that do not directly participate in eliciting the antigen-specific response. However, few studies have attempted to delineate its immunological and molecular basis, and clinical implications. In the present study, we demonstrated that during HIV infection, CD3ζ down-modulation is mediated by Gr-MDSC, and their depletion is able to restore CD3ζ expression. We also showed that Gr-MDSC inhibit CD3ζ mRNA expression by silencing its transcription factor ELF-1. These data are in line with other reports showing that Gr-MDSC are expanded in other infections [34] and cancer [35], and are correlated with a decrease of CD3ζ expression on T cells. In these papers, the authors also suggested that ArgI could decrease CD3ζ expression; however, no experiments that aimed to inhibit ArgI and confirm its role in CD3ζ modulation were performed. Although it has been demonstrated that arginine deprivation and tryptophan starvation can alter CD3ζ expression in vitro[15,16][15,16], we found that the enzyme activity of ArgI, IDO, iNOS and the production of ROS (data not shown) are not involved in the modulation of CD3ζ expression during HIV infection. This observation is consistent with the requirement of cell contact. It was previously postulated that cell contact is necessary because short-lived suppressor mediators need cell proximity [36]. However, we excluded this hypothesis since fixed Gr-MDSCs were still able to decrement CD3ζ. Recently, Bowers and colleagues showed an immune suppression activity of neutrophils from HIV+ patients mediated by PD-L1/PD1 pathway. Further, neutrophils PD-L1 expression correlated with CD3ζ expression on T cells [24]. We found that Gr-MDSC express PD-L1; however, the PD-L1/PD1 pathway is not involved in CD3ζ down-modulation by Gr-MDSC. These data suggest that a different, unknown mechanism, mediated by molecules expressed on the Gr-MDSC membrane, drives the alteration of CD3ζ expression.

The expansion of different MDSC subsets in treatment naïve HIV+ patients was previously described in two reports [20,21][20,21]. In agreement with Vollbrecht and colleagues we found a higher proportion of Gr-MDSC in HIV+ patients. The proportion of Gr-MDSC in patients on cART remains higher than the healthy donors and comparable to the Gr-MDSC level of untreated subjects. Unlike the previous studies, we did not find correlations between %Gr-MDSC and CD4+ T-cell count or viral load. This discrepancy could be due to the different features of patients included in the cited studies. In fact, our patients were mostly cART treated whereas Qin and Vollbrecht cohorts mostly comprised treatment naïve subjects.

Interestingly, we found that among treated patients, individuals whose CD4+ T-cell counts did not go beyond 400 cells/μl showed higher Gr-MDSC levels than patients who did. On the other hand, no association was observed with HIV viral load. These data indicate that in patients on cART, Gr-MDSC frequency is associated with immunological response rather than viremia, suggesting their potential use in monitoring immunological reconstitution. However, further investigations are needed to determine whether Gr-MDSC is a predictor or a result of immunological failure. In agreement with Gr-MDSC results, we did not find any correlation between CD3ζ and HIV viral load and CD4+ T-cells count.

The CD3ζ down-modulation could represent a mechanism by which T-cell anergy is induced by HIV infection. In fact, we found an inverse correlation between Gr-MDSC frequency and HIV-specific CD8+ T-cell response, and consistent with CD3ζ up-regulation, Gr-MDSC depletion induced an increase of IFNγ production by CD8+ T cells upon HIV peptide stimulation. However, it should be noted that in three patients, Gr-MDSC depletion did not increase IFNγ production, even if CD3ζ up-regulation was found. These data suggest that other suppressive mechanisms occurred in these individuals. Unexpectedly, Gr-MDSC depletion did not restore IFNγ production by Vγ9Vδ2 T cells, despite the up-regulation of CD3ζ and the inverse correlation with Gr-MDSC levels. We previously demonstrated a CD3ζ down-modulation on Vγ9Vδ2 T cells from HIV+ patients that correlated with their functionality; furthermore, treatment with phorbol myristate acetate (PMA) restored CD3ζ expression and function [7]. PMA is a protein kinase C (PKC) activator involved in many intracellular pathways. Thus, a possible explanation of our data is that the up-regulation of CD3ζ in Vγ9Vδ2 T cells may not be sufficient to restore their functionality, perhaps because other mechanisms occur [37] that could be bypassed by PKC activation. However, this issue needs investigation.

In conclusion we demonstrated that Gr-MDSC are expanded in HIV+ patients undergoing cART, in particular in low CD4+ T-cell count patients, and inhibit CD3ζ expression through an undiscovered cell contact-dependent mechanism that induces the silencing of the transcription factor ELF-1. Our data provide new knowledge on mechanisms used by Gr-MDSC in immune modulation and on their role in the immune reconstitution during antiviral treatments. These findings are pivotal since they open up the possibility of testing Gr-MDSC as a predictive factor of treatment outcome.

Acknowledgements

Author contributions: N.T., F.M. and A.S. designed the study. N.T. and F.T. performed the experiments. S.M. and E.L. performed the RT-PCR. N T. analysed the data. V.B., R.C. and C.M. contributed to analyse data. N.T. and A.S. wrote the paper. C.A., V.B., R.C., E.C., C.M., V.C. and F.M. contributed to revise the paper.

Financial support: This work was supported by grants from Italian Ministry of Health (Ricerca Corrente) to INMI L. Spallanzani.

Conflicts of interest

There are no conflicts of interest.

References

1. Migueles SA, Laborico AC, Shupert WL, Sabbaghian MS, Rabin R, Hallahan CW, et al. HIV-specific CD8+ T cell proliferation is coupled to perforin expression and is maintained in nonprogressors. Nat Immunol 2002; 3:1061–1068.
2. Rosenberg ES, Billingsley JM, Caliendo AM, Boswell SL, Sax PE, Kalams SA, et al. Vigorous HIV-1-specific CD4+ T cell responses associated with control of viremia. Science 1997; 278:1447–1450.
3. Chowdhury A, Silvestri G. Host-pathogen interaction in HIV infection. Curr Opin Immunol 2013; 25:463–469.
4. Zajac AJ, Blattman JN, Murali-Krishna K, Sourdive DJ, Suresh M, Altman JD, et al. Viral immune evasion due to persistence of activated T cells without effector function. J Exp Med 1998; 188:2205–2213.
5. Wherry EJ, Ha SJ, Kaech SM, Haining WN, Sarkar S, Kalia V, et al. Molecular signature of CD8+ T cell exhaustion during chronic viral infection. Immunity 2007; 27:670–684.
6. Trimble LA, Shankar P, Patterson M, Daily JP, Lieberman J. Human immunodeficiency virus-specific circulating CD8 T lymphocytes have down-modulated CD3zeta and CD28, key signaling molecules for T-cell activation. J Virol 2000; 74:7320–7330.
7. Sacchi A, Tempestilli M, Turchi F, Agrati C, Casetti R, Cimini E, et al. CD3zeta down-modulation may explain Vgamma9Vdelta2 T lymphocyte anergy in HIV-infected patients. J Infect Dis 2009; 199:432–436.
8. Krishnan S, Kiang JG, Fisher CU, Nambiar MP, Nguyen HT, Kyttaris VC, et al. Increased caspase-3 expression and activity contribute to reduced CD3zeta expression in systemic lupus erythematosus T cells. J Immunol 2005; 175:3417–3423.
9. Nakagomi H, Petersson M, Magnusson I, Juhlin C, Matsuda M, Mellstedt H, et al. Decreased expression of the signal-transducing zeta chains in tumor-infiltrating T-cells and NK cells of patients with colorectal carcinoma. Cancer Res 1993; 53:5610–5612.
10. Das A, Hoare M, Davies N, Lopes AR, Dunn C, Kennedy PT, et al. Functional skewing of the global CD8 T cell population in chronic hepatitis B virus infection. J Exp Med 2008; 205:2111–2124.
11. Maki A, Matsuda M, Asakawa M, Kono H, Fujii H, Matsumoto Y. Decreased expression of CD28 coincides with the down-modulation of CD3zeta and augmentation of caspase-3 activity in T cells from hepatocellular carcinoma-bearing patients and hepatitis C virus-infected patients. J Gastroenterol Hepatol 2004; 19:1348–1356.
12. Bronstein-Sitton N, Cohen-Daniel L, Vaknin I, Ezernitchi AV, Leshem B, Halabi A, et al. Sustained exposure to bacterial antigen induces interferon-gamma-dependent T cell receptor zeta down-regulation and impaired T cell function. Nat Immunol 2003; 4:957–964.
13. Samelson LE. Signal transduction mediated by the T cell antigen receptor: the role of adapter proteins. Annu Rev Immunol 2002; 20:371–394.
14. Pitcher LA, van Oers NS. T-cell receptor signal transmission: who gives an ITAM?. Trends Immunol 2003; 24:554–560.
15. Zea AH, Rodriguez PC, Culotta KS, Hernandez CP, DeSalvo J, Ochoa JB, et al. L-Arginine modulates CD3zeta expression and T cell function in activated human T lymphocytes. Cell Immunol 2004; 232:21–31.
16. Fallarino F, Grohmann U, You S, McGrath BC, Cavener DR, Vacca C, et al. The combined effects of tryptophan starvation and tryptophan catabolites down-regulate T cell receptor zeta-chain and induce a regulatory phenotype in naive T cells. J Immunol 2006; 176:6752–6761.
17. Gabrilovich DI, Nagaraj S. Myeloid-derived suppressor cells as regulators of the immune system. Nat Rev Immunol 2009; 9:162–174.
18. Sica A, Bronte V. Altered macrophage differentiation and immune dysfunction in tumor development. J Clin Invest 2007; 117:1155–1166.
19. Greten TF, Manns MP, Korangy F. Myeloid derived suppressor cells in human diseases. Int Immunopharmacol 2011; 11:802–807.
20. Vollbrecht T, Stirner R, Tufman A, Roider J, Huber RM, Bogner JR, et al. Chronic progressive HIV-1 infection is associated with elevated levels of myeloid-derived suppressor cells. AIDS 2012; 26:F31–F37.
21. Qin A, Cai W, Pan T, Wu K, Yang Q, Wang N, et al. Expansion of monocytic myeloid-derived suppressor cells dampens T cell function in HIV-1-seropositive individuals. J Virol 2013; 87:1477–1490.
22. Agrati C, D’Offizi G, Gougeon ML, Malkovsky M, Sacchi A, Casetti R, et al. Innate gamma/delta T-cells during HIV infection: Terra relatively Incognita in novel vaccination strategies?. AIDS Rev 2011; 13:3–12.
23. Geertsma MF, van Wengen-Stevenhagen A, van Dam EM, Risberg K, Kroon FP, Groeneveld PH, et al. Decreased expression of zeta molecules by T lymphocytes is correlated with disease progression in human immunodeficiency virus-infected person. J Infect Dis 1999; 180:649–658.
24. Bowers NL, Helton ES, Huijbregts RP, Goepfert PA, Heath SL, Hel Z. Immune suppression by neutrophils in HIV-1 infection: role of PD-L1/PD-1 pathway. PLoS Pathog 2014; 10:e1003993.
25. Juang YT, Solomou EE, Rellahan B, Tsokos GC. Phosphorylation and O-linked glycosylation of Elf-1 leads to its translocation to the nucleus and binding to the promoter of the TCR zeta-chain. J Immunol 2002; 168:2865–2871.
26. Mizoguchi H, O'Shea JJ, Longo DL, Loeffler CM, McVicar DW, Ochoa AC. Alterations in signal transduction molecules in T lymphocytes from tumor-bearing mice. Science 1992; 258:1795–1798.
27. Matsuda M, Petersson M, Lenkei R, Taupin JL, Magnusson I, Mellstedt H, et al. Alterations in the signal-transducing molecules of T cells and NK cells in colorectal tumor-infiltrating, gut mucosal and peripheral lymphocytes: correlation with the stage of the disease. Int J Cancer 1995; 61:765–772.
28. Kiessling R. Signals from lymphocytes in colon cancer. Gut 1997; 40:153–154.
29. Zea AH, Culotta KS, Ali J, Mason C, Park HJ, Zabaleta J, et al. Decreased expression of CD3zeta and nuclear transcription factor kappa B in patients with pulmonary tuberculosis: potential mechanisms and reversibility with treatment. J Infect Dis 2006; 194:1385–1393.
30. Stefanová I, Saville MW, Peters C, Cleghorn FR, Schwartz D, Venzon DJ, et al. HIV infection-induced posttranslational modification of T cell signaling molecules associated with disease progression. J Clin Invest 1996; 98:1290–1297.
31. Trimble LA, Lieberman J. Circulating CD8 T lymphocytes in human immunodeficiency virus-infected individuals have impaired function and downmodulate CD3 zeta, the signaling chain of the T-cell receptor complex. Blood 1998; 91:585–594.
32. Liossis SN, Ding XZ, Dennis GJ, Tsokos GC. Altered pattern of TCR/CD3-mediated protein-tyrosyl phosphorylation in T cells from patients with systemic lupus erythematosus. Deficient expression of the T cell receptor zeta chain. J Clin Invest 1998; 101:1448–1457.
33. Maurice MM, Lankester AC, Bezemer AC, Geertsma MF, Tak PP, Breedveld FC, et al. Defective TCR-mediated signaling in synovial T cells in rheumatoid arthritis. J Immunol 1997; 159:2973–2978.
34. Zeng QL, Yang B, Sun HQ, Feng GH, Jin L, Zou ZS, et al. Myeloid-derived suppressor cells are associated with viral persistence and downregulation of TCR ζ chain expression on CD8(+) T cells in chronic hepatitis C patients. Mol Cells 2014; 371:66–73.
35. Liu CY, Wang YM, Wang CL, Feng PH, Ko HW, Liu YH, et al. Population alterations of L-arginase- and inducible nitric oxide synthase-expressed CD11b+/CD14-/CD15+/CD33+ myeloid-derived suppressor cells and CD8+ T lymphocytes in patients with advanced-stage nonsmall cell lung cancer. J Cancer Res Clin Oncol 2010; 1361:35–45.
36. Goh C, Narayanan S, Hahn YS. Myeloid-derived suppressor cells: the dark knight or the joker in viral infections?. Immunol Rev 2013; 255:210–221.
37. Sacchi A, Rinaldi A, Tumino N, Casetti R, Agrati C, Turchi F, et al. HIV infection of monocytes-derived dendritic cells inhibits Vγ9Vδ2 T cells functions. PLoS One 2014; 9:e111095.
Keywords:

αβ T cells; γδ T cells; CD3 ζ; HIV; HIV-specific T-cell response; immune suppression; MDSC

Supplemental Digital Content

Copyright © 2015 Wolters Kluwer Health, Inc.