The cytotoxic lymphocyte antigen 4 polymorphisms affect response to hepatitis C virus-specific therapy in HIV(+) patients with acute and chronic hepatitis C virus co-infection

Abstract

Objective: 

Cytotoxic lymphocyte antigen 4 (CTLA4), a co-receptor expressed on T lymphocytes, is involved in the regulation of T-cell functions. Here, we analyzed the potential impact of the CTLA4 polymorphisms on response to hepatitis C virus (HCV)-specific treatment in HIV(+) patients co-infected with HCV.

Patients and methods: 

A total of 184 HIV/HCV co-infected Caucasian patients were enrolled into this study, including 109 patients with chronic and 75 patients with acute hepatitis C. CTLA4 genotypes were determined by LightCycler PCR.

Results: 

We found the CTLA4 −318 C/C genotype to be associated with sustained virological response in HCV/HIV co-infection (P = 0.035). Moreover, response rates were significantly higher in patients with a +49G/G genotype [23/29 (79.3%)] than in carriers of other +49 genotypes [59/155 (38.1%); OR 6.2; P = 0.00005]. Of note, the CTLA4 +49G/G genotype was confirmed as an independent predictor for treatment response in both patients with acute and chronic hepatitis C.

Conclusion: 

CTLA4 polymorphisms are associated with treatment-induced resolution of HCV infection in HIV co-infected patients. These findings underline the impact of genetic host factors for successful treatment.

Introduction

About 30% of HIV(+) patients are co-infected with the hepatitis C virus (HCV) in Europe and the United States, and currently outbreaks of acute hepatitis C in HIV-infected men have been reported. HCV/HIV co-infected individuals show a more rapid progression towards severe liver disease resulting in a higher overall mortality as compared to patients with HCV mono-infection ^[1]. Thus, co-infection with HCV has become a major health problem in HIV-infected patients, especially after the decline in morbidity and mortality due to opportunistic diseases following the introduction of HAART in 1996.

A combination of pegylated interferon-α (Peg-IFN) with ribavirin represents the backbone of HCV-specific therapy at the moment. However, with this treatment a sustained virologic response (SVR) is achieved in only about 20–40% of HCV/HIV co-infected patients ^[1] in clinical studies and may be even lower in clinical practice.

A strong immune response is essential for spontaneous clearance of HCV viremia as well as for sustained response to treatment with Peg-IFN and ribavirin. Both CD4(+) T helper and CD8(+) cytotoxic T-cell responses are important in this context.

Host genetic factors have been shown to modulate these immune responses and may, therefore, also affect the course of HCV infection. Indeed, several genetic polymorphisms have been shown to influence response to therapy and spontaneous resolution of HCV ^[2], including single-nucleotide polymorphisms (SNPs) in the gene encoding for cytotoxic lymphocyte antigen 4 (CTLA4) ^[3,4].

Cytotoxic lymphocyte antigen 4 is a co-receptor expressed on activated T lymphocytes ^[5]. It binds to the co-stimulatory molecules CD80 and CD86, which are expressed on the surface of antigen-presenting cells (APCs). CTLA4 is capable of dampening T-cell proliferation and is involved in adjusting the threshold for T-cell activation. These mechanisms guard against autoimmunity, since mice lacking CTLA4 die within 3–4 weeks due to the development of diffuse lymphoproliferative disorders ^[5] The CTLA4 gene carries several polymorphisms including the 318C>T allelic variant in the promoter region as well as an A>G transition at position 49 within exon 1 (CTLA4 +49A>G) encoding an alanine (Ala) > threonine (Thr) substitution. A functional role for the +49A>G variant has been shown in vitro, demonstrating that lymphocytes carrying the mutant allele (+49G) exert reduced inhibitory activity ^[6]. Furthermore, epidemiological studies suggested the CTLA4 polymorphisms to predispose to a variety of autoimmune disorders such as autoimmune hepatitis, systemic lupus erythematosus, autoimmune thyroiditis, and type I diabetes ^[5]. In hepatitis C, the CTLA4 +49G allele may facilitate viral elimination as carriers of the G/G genotype were more likely to clear the virus spontaneously. Moreover, the CTLA4 +49 polymorphism has been shown to affect response to HCV therapy in patients treated with standard interferon-α but not in those treated with the more potent Peg-IFN ^[3,4].

However, it remained unclear whether the CTLA4 SNPs have any effect on treatment outcome in HIV/HCV co-infected patients with acute and chronic hepatitis C.

Patients and methods

Design and study populations

A total of 184 HIV/HCV co-infected Caucasian patients were enrolled into this study including 109 patients with chronic and 75 patients with acute hepatitis C. Acute hepatitis C was diagnosed when at least two of the following three criteria were fulfilled within the last 4 months prior to the diagnosis of HCV infection: HCV seroconversion; ALT>350IU with prior normal aminotransferases; risk exposure to HCV (modified to reference ^[7]). HCV/HIV co-infected patients with chronic HCV infection were treated with Peg-IFN-α and ribavirin combination therapy according to current guidelines for 24 or 48 weeks ^[8]. HCV/HIV co-infected patients with acute HCV infection without spontaneous viral clearance 12 weeks after presumed date of infection or date of diagnosis were offered a Peg-IFN and ribavirin combination therapy over a 24-week course ^[9].

Informed consent was obtained from each patient prior to inclusion into the study, and the study conformed with the ethical guidelines of the Helsinki declaration as approved by the local ethics committees.

Determination of CTLA4 genotypes

Determination of CTLA4 genotypes was performed by LightCycler PCR using the following oligonucleotide primers and hybridization probes:

CTLA4 +49: CCTGAACACCGCTCCCATA (sense), AGCCAGCCAAGCCAGAT (antisense), CCAGGTCCTGGCAGCC-X (sensor), and GTTCAGCTGAGCCTTGTGCCGCTG-p (anchor); CTLA4 −318: AAATGAATTGGACTGGATGGT (sense), TTACGAGAAAGGAAGCCGTG (antisense), GTTATCCAGATCCTCAAAGTGAACATG-X (sensor), and GCTTCAGTTTCAAATTGAATACATTTTCCA-P (anchor) (all TIB MOLBIOL, Germany).

Statistics

Cytotoxic lymphocyte antigen 4 genotype distributions as well as treatment response rates in patients with different CTLA4 genotypes were analyzed using 2 × 2 contingency tables. For statistical comparisons between the groups, χ² statistics, Fisher's exact test and Mann–Whitney U test were used as appropriate. To determine the effect of the CTLA4 +49 genotype in comparison to HCV load and genotype, the main established predictors of response, we stratified our patient data as HCV genotype 1 vs. non1, and HCV RNA 2.5 million copies/ml or less vs. more than 2.5 million copies/ml. These stratified parameters were analyzed together with HAART (HAART vs. no HAART), stage of hepatitis C (acute vs. chronic), and the CTLA4 genotypes in a forward conditional stepwise logistic regression model using SVR as outcome variable. P values less than 0.05 (two-sided) were regarded as significant.

Results

A total of 184 patients treated with Peg-IFN-α and ribavirin were analyzed, including 75 HIV-positive patients with acute hepatitis C [age: mean (range); 43 (28–73) years; CD4 cell count: 515 (32–1047) cells/μl; HIV load: 45 × 10³ (50–1.4 × 10⁶) copies/ml; ALT: 575 (32–3089) IU/ml; HCV load: 6.3 × 10⁶ (1.3 × 10³–6210⁶) copies/ml] and 109 chronically HCV-infected HIV(+) patients [age: mean (range); 45 (29–68) years; CD4 cell count: 524 (216–1902) cells/μl; HIV load: 18 × 10³ (50–5 × 10⁵) copies/ml; ALT: 94 (10–450) IU/ml; HCV load: 2.4 × 10⁶ (4.2 × 10³–17.4 × 10⁶) copies/ml]. Overall, the sustained virological response (SVR) rate was 45.7% (84/184). Co-infected patients with an acute hepatitis C were significantly more likely to achieve a SVR as compared to chronically infected patients [42/75 (56%) vs. 42/109 (38.5%)] (P = 0.02; OR 2.0).

Distributions of the CTLA4 +49 genotype differed significantly between treatment responders and nonresponders. Patients with a G/G genotype were significantly more likely to achieve a SVR relative to patients with G/A and A/A genotypes combined [23/29 (79.3%) vs. 59/155 (38.1%); OR 6.2; P = 0.00005]. A comparable effect was seen when the G/G genotype was compared to the G/A [SVR: 33/76 (43.4%); OR 4.9; P = 0.002] or the A/A genotype [SVR: 26/79 (32.9%); OR 7.7; P = 0.00002]. No difference could be detected between the G/A and the A/A groups. In a subgroup analysis, these data could also be confirmed when HIV-positive patients with acute or chronic hepatitis C were analyzed separately (Fig. 1a).

Fig. 1: Sustained virological response (SVR) rates in relation to CTLA4 +49 (a), CTLA4 −318 (b), and CTLA4 +49/−318 genotypes in HCV/HIV co-infected patients.

Analyzing the CTLA4–318 polymorphism we found carriers of a homozygous C/C genotype to be significantly more likely to achieve a SVR [77/153 (49.7%)] as compared to patients carrying other genotypes [9/31 (29%); P = 0.035]. However, this difference failed to reach statistical significance in the group of HIV-positive patients with acute hepatitis C (Fig. 1b). In addition, we found carriage of a homozygous −318C+49G haplotype to be significantly associated with SVR (Fig. 1c).

Of note, all distributions were in accordance with the Hardy–Weinberg equilibrium.

Next, we performed a univariate analysis (Table 1) to identify the relative contribution of possibly confounding factors (HCV load, age, sex, HCV genotype, HIV RNA levels, CD4 cell count, HAART) other than the CTLA4 genotype on outcome of HCV therapy in HCV/HIV-positive patients.

Table 1: Univariate analysis of the effect of the CTLA4 genotype on SVR in HCV/HIV co-infection.

In the subgroup of HIV(+) patients with chronic hepatitis C, HCV genotype (HCV genotype 1 vs. non1) as well as the CTLA4 +49 and CTLA4 +49/−318 genotype were significantly associated with response to treatment, whereas in acute hepatitis C only the CTLA4 +49 and the CTLA4 +49/−318 genotype were confirmed as predictors of response (Table 1).

Finally, we analyzed our data in a stepwise forward conditional regression model (Tables 2 and 3). When co-infected patients were analyzed as a combined group using acute vs. chronic hepatitis C as an additional variable, carriage of a CTLA4 +49 G/G or a CTLA4 +49G−318C/+49G−318C genotype remained a strong predictor for SVR, whereas HCV load, age, HCV genotype, HCV status, and sex were removed from the final regression model. When patients with acute and chronic hepatitis C were analyzed in separate regression models, the CTLA4 +49G/G genotype was confirmed as independent prognostic factor of SVR in both groups (Tables 2 and 3).

Table 2: Multivariate analysis of the effect of CTLA4 +49GG genotype carriage on SVR in HCV/HIV co-infection.

Table 3: Multivariate analysis of the effect of CTLA4 +49G−318C/+49G−318C genotype carriage on SVR in HCV/HIV co-infection.

Discussion

Response to HCV-specific therapy is depending on both viral and host factors. Among the host factors, gene polymorphisms have been shown to importantly affect the treatment response.

Here, we analyzed the impact of the CTLA4 polymorphisms on response to HCV-specific therapy in HIV(+) patients with acute and chronic hepatitis C and identified the CTLA4 +49 G/G genotype alone or in combination with the CTLA4 −318C/C genotype as an independent predictor of sustained virological response. CTLA4 functions as a down-regulator of immune responses after binding to the co-stimulatory molecules B7–1 (CD80), B7–2 (CD86). For instance, CTLA-4-mediated signals have been shown to actively inhibit the production of interleukin-2 (IL-2) and cell-cycle progression of T cells. Moreover, CTLA4 polymorphism might also affect activation of indoleamine 2,3-dioxygenase (IDO), regulatory T cells, and the duration of contact between T cell and APC. Thus, CTLA4 plays an important role in the modulation of T-lymphocyte functions ^[5]. Accordingly, the CTLA-4 +49 polymorphism has been suggested to contribute to the pathogenesis of autoimmune diseases via modulating the intensity of T-lymphocyte-mediated immune responses ^[10].

The A>G transition at CTLA-4 +49 leads to a nonsynonymous alanine → threonine shift at position 17 of the signal peptide, resulting in changed polarity of the amino acid ^[11].

This has been associated with a reduced expression of mature CTLA4 molecules on the cell membrane of T lymphocytes, possibly reflecting decreased processing ability of the variant protein ^[6]. Accordingly, carriage of the −318T allele has been associated with increased levels of CTLA4 mRNA as compared to −318C/−318C homozygotes.

In this context it is important to note that strong antiviral T-cell responses have been proposed to be associated with viral clearance both during the acute phase of primary HCV infection and antiviral therapy of chronic hepatitis ^[12]. Thus, it is conceivable that the CTLA-4 +49 GG genotype might affect response to interferon-based therapy via modulating T-cell-mediated HCV-specific immune responses ^[3,4]. Accordingly, two recent studies demonstrated the CTLA4 +49 polymorphism to affect response to treatment with standard interferon in HCV mono-infected individuals ^[3,4]. However, in these studies the CTLA4 +49 genotype did not predict treatment outcome when Peg-IFN was used instead of standard interferon ^[4]. This is in contrast to our findings in HCV/HIV co-infected individuals, when the CTLA4 +49 genotype was significantly associated with treatment outcome.

The reason for this difference remains elusive at the moment. However, CTLA4 has been shown to enhance susceptibility to HIV-1 infection in vitro^[13]. Moreover, up-regulation of CTLA4 during chronic HIV infection has been suggested to contribute to CD4 T-cell loss and anergy ^[14]. Thus, CTLA4-mediated effects might have more impact in HIV/HCV co-infected patients than in individuals mono-infected with HCV.

Whether the CTLA4 +49 polymorphism also affects spontaneous elimination of HCV in HIV-positive patients remains to be clarified. However, the finding that HCV/HIV co-infected patients displayed a similar CTLA4 +49 genotype distribution as healthy controls and HIV mono-infected patients, respectively, argues against a significant impact on the natural course of HCV infection (data not shown).

In conclusion, our study underlines the role of an efficient T-cell response and sheds light on the impact of genetic host factors for successful treatment.

Acknowledgements

This work was supported by the H.W. and J. Hector Foundation [grant number M42 (to J.N.)], by the Deutsche Krebshilfe [grant number 107865 (to H.D.N.)], and by NHMRC Project Grant 568859 (to M.D.).

S.M., A.B., T.L., J.G., M.D. and U.N. collected and analyzed clinical data and collected samples from the study population. M.V., T.S., U.S., J.K.R., and J.N. designed the study, did statistical analysis and wrote the manuscript. H.D.N., M.M., and M.C. performed CTLA4 genotyping.

There are no conflicts of interest.