Secondary Logo

Journal Logo

Gαi protein-dependant extracellular signal-regulated kinase-1/2 activation is required for HIV-1 reverse transcription

Mettling, Clémenta; Desmetz, Carolinea; Fiser, Anne-Laurea; Réant, Brigittea; Corbeau, Pierrea,b; Lin, Yea-Liha

doi: 10.1097/QAD.0b013e32830abdaf
BASIC SCIENCE
Free
SDC

Background: HIV-1 triggers infection through interaction with the CD4 receptor and the chemokine receptors, CCR5 or CXCR4, on host cells. The involvement of signaling via the chemokine receptors in viral infection remains an issue of debate. We have previously reported that Gαi1 is involved in the signaling triggered by R5 HIV-1 strains through CCR5 binding to facilitate viral replication in unstimulated peripheral blood mononuclear cells. In this study, we pursued the identification of the downstream signaling molecules in CCR5-mediated infection. We also questioned whether CXCR4 using HIV-1 strains induce the same signaling mechanism.

Methods: We analyzed by western blotting the coreceptor-mediated activation of various mitogen-acitvated protein kinases, including extracellular signal-regulated kinase (ERK)1/2, p38 and c-jun N-terminal kinase in non-stimulated human peripheral blood mononuclear cells. The involvement of Gαi protein in ERK1/2 activation was tested using pertussis toxin. Using real-time PCR, we studied the role of ERK1/2 in the life cycle of HIV-1.

Results: We found that pertussis toxin inhibited the replication of X4 as well as R5 strains. Furthermore, both strains activated a pertussis toxin-sensitive mitogen-activated protein kinase pathway involving mitogen-activated protein kinase kinases-1/2 and ERK1/2. The inhibition of ERK1/2 activation by U0126 and PD98059 blocked both R5 and X4 HIV-1 replication. Furthermore, ERK1/2 activity was required for the completion of HIV-1 reverse transcription.

Conclusion: Our results show that R5 and X4 HIV-1 strains induce the same Gαi-dependent ERK pathway that facilitates reverse transcription. The identification of the signaling pathway required for optimal viral replication sheds a new light on HIV physiopathology and opens new therapeutic possibilities.

aInstitut de Génétique Humaine, CNRS-UPR1142, Montpellier, France

bLaboratoire d'Immunologie, CHU Carémeau, Nîmes, France.

Received 9 January, 2008

Revised 7 May, 2008

Accepted 29 May, 2008

Correspondence to Yea-Lih Lin, Institut de Génétique Humaine, CNRS-UPR1142, 141, rue de la Cardonille, 34396 Montpellier, Cedex 5, France. Tel: +33 4 99 61 99 32; fax: +33 4 99 61 99 01; e-mail: ylin@igh.cnrs.fr

Back to Top | Article Outline

Introduction

The interaction between CCR5 and viral envelope glycoprotein gp120 triggers various activation signals including the phosphorylation of CCR5 itself, the phosphorylation of focal adhesion kinase, tyrosine phosphorylation of the tyrosine kinase Pyk2 [1], calcium mobilization [2] and induction of chemotaxis [3]. Yet, HIV signaling through the chemokine receptor has been considered dispensable for infection. This conclusion stemmed from experiments showing that virus replication was not affected when signaling through the CCR5 receptor was blocked either by mutagenesis or Gi-protein inactivation by pertussis toxin (PTX) [4–6]. However, the activation status of cells may conceal signaling through CCR5 triggered by the virus as these experiments had been carried out in tumor cell lines or in stimulated primary cells. Indeed, introduction of the wild type CCR5 gene into non-stimulated peripheral blood mononuclear cells (PBMC) from a CCR5Δ32/CCR5Δ32 homozygous donor expressing no CCR5 on the cell surface reconstituted the susceptibility of these cells to HIV-1 infection, whereas PBMC expressing artificially a G-protein-coupling defective CCR5 mutant (R126N) remained resistant to viral infection [7]. In support of this notion, primary viral isolates and laboratory-adapted viral strains with gp120 envelopes that do not induce calcium mobilization entered macrophages but were unable to complete the viral life cycle. Nevertheless, this postentry block was overcome when signaling was triggered by the natural ligand of CCR5, MIP-1α [8].

The mitogen-activated protein kinase (MAPK) extracellular signal-regulated kinases (ERK)1/2 are central components of signaling pathways activated by various extracellular stimuli. Several laboratories have evidenced the involvement of ERK1/2 activity in viral replication in different models. For instance, the activation of p42 ERK2 by R5 gp120 and R5 HIV-1 has been shown in the human central nervous system [9]. A growing body of evidence shows that ERK phosphorylation is induced following activation of G-protein-coupled receptors [10,11]. However, the signaling pathway linking CCR5 and ERK1/2 activation triggered by the virus remains poorly defined. Therefore, we tested the hypothesis that the binding of R5 HIV-1 virions to CCR5 might induce the phosphorylation of ERK1/2 downstream of Gi proteins, which results in the reinforcement of viral replication.

As a member of the seven-transmembrane domain receptor family coupling to Gi and Gq proteins, CXCR4 seems to have different functional organizations of its primary structure compared with those of CCR5. For instance, the DRY (aspartic acid, arginine and tyrosine) motif in the second intracellular domain of CCR5 is indispensable for triggering the signal via G proteins, while dispensable for Gi signaling for CXCR4 [12,13]. Due to the structural complexity of CCR5 and CXCR4, signaling events induced by the interaction with specific ligands may not be mimicked entirely by binding to HIV-1. Specifically, binding of SDF-1 stimulates the ERK pathway, whereas interaction of X4 HIV-1 with CXCR4 did not activate this pathway [14,15]. In contrast, both R5 HIV-1 gp120 and MIP-1β activated MEK/ERK efficiently [16,17]. Thus, we questioned whether the Gαi protein signaling triggered by X4 virions through binding to CXCR4 has an impact on the life cycle of X4 HIV strains as it does on R5 virions.

Back to Top | Article Outline

Materials and methods

Cell culture

Human PBMC from healthy donors were isolated by Ficoll-Paque (Eurobio, Lille, France) density centrifugation. CD4-positive T cells were isolated using Dynal CD4-positive isolation kit (Invitrogen, Cergy Pontise, France). The purity of CD4-positive cells was around 99%, which was verified by flow cytometry analysis (FACSCalibur; BD Bioscience, Rungis, France) using a labeled anti-CD4 antibody (Beckman Coulter, Roissy, France). Isolated PBMC were cultured in RPMI-1640 medium containing 10% fetal calf serum (FCS), 10 mmol/l glutamax-1, 100 U/ml penicillin and 100 μg/ml streptomycin (Invitrogen) at 37°C and 5% CO2.

Back to Top | Article Outline

Cell treatment and virus infection

For kinases inhibition, human PBMC cultured in RPMI-1640 containing 10% FCS were washed twice with Hanks-buffered saline and once with AIM-V medium (Invitrogen) and kept in this medium for 24 h. They were then treated with 10 μmol/l of various kinase inhibitors, U0126, PD98059, PP2 or SB203580 before viral infection. These inhibitors were purchased from Calbiochem (Fonteney sous Bois, France).

For PTX treatment, PBMC were treated with 1 ng/ml PTX for 18 h before viral infection or 4 h postinfection, with or without 5 μg/ml of phytohemagglutinin M (PHA-M; Roche, Fonteney, France), and 20 U/ml of recombinant interleukin-2 (IL-2) (Roche). The treated cells were then distributed into 96-well culture plates at a density of 2 × 106 cells/ml. Cells were then infected with an R5 (Ada-M or Ad8) strain or an X4 (NL4-3) strain at a final multiplicity of infection of 0.02, equivalent to 100 ng gag p24 [18], or mock infected with the same volume of culture supernatant from the non-infected cell lines used for virus amplification. Infected cells were washed intensively 18 h postinfection and kept in fresh RPMI with or without PTX or 10 U/ml of IL-2. Half of the culture supernatant was collected at day 4, day 7 and day 11 after infection and replaced by an equivalent volume of fresh medium containing the same treatments. Viral production was quantified by the amounts of viral gag p24 in the culture supernatant using an enzyme-linked immunosorbent assay (ELISA) kit (Beckman Coulter). Cell viability was quantified during the infection using 0.4% trypan-blue (Invitrogen). There was no significant difference in cell viability between control and treated cells during the infection periods.

Ada-M laboratory-adapted virus obtained from the AIDS Research and Reference Reagent Program was expanded in HOS-CD4-CCR5 cells (AIDS Research and Reference Reagent Program, Bethesda, Maryland, USA). X4 HIV-1 (NL4-3) DNA from the AIDS Research and Reference Reagent program was transfected into human embryonic kidney 293T cells by the calcium-phosphate method. Virus was then amplified in the human cell line CEM.

Back to Top | Article Outline

Western blot analysis

Cell lysates from infected cells were harvested and analyzed by Western blot analysis [19]. Signal intensity was quantified by using program Aida/2D densitometry. All primary antibodies for MAP kinase pathway, antiphosphop44/42 Map Kinase (ref. #9101), antiphospho-MEK1/2 (ref. #9121), antip44/42 MAP Kinase (ref. #9102), antiphospho-SAPK/JNK (c-jun N-terminal kinase) (ref. #9251) and antiphospho-p38 MAPK (ref. #9211) are from Cell Signaling (New England Biolabs, Saint Quentin Yvelines, France).

Back to Top | Article Outline

Pseudotyped virion production and single-round infection

The plasmid pNL4.3-env-Luc+ harboring a luciferase gene was cotransfected with plasmid p8.2 [20] and either the R5 envelope plasmid pCMV-Ad8-Env or the X4 envelope plasmid pVB34 (NL4-3-Env) (AIDS Research and Reference Reagent Program) into 293T cells. The virions, named R5-Luc or X4-Luc were collected 48 h posttransfection, filtrated and concentrated using Vivaspin 20 (30 000 MWCO; Satorius AG, Goettingen, Germany).

For the single-round infection assay, non-stimulated human PBMC were treated with or without the inhibitors for 30 min after 24-h serum starvation. Cells were then infected for 4 h, washed three times with phosphate buffered saline (PBS) and kept in fresh RPMI-1640 containing 10% FCS without drug for another 48 h. Luciferase activity was monitored using luciferase assay kit and a luminometer (Promega, Charbonnieres, France).

Back to Top | Article Outline

Real-time PCR

Infected cells were resuspended in lysis buffer (10 mmol/l Tris pH 8.0; 0.5 mmol/l EDTA; 0.0001% SDS; 0.001% Triton; 100 μg/ml proteinase K), incubated 3 h at 50°C and 10 min at 95°C. For the detection of early and late reverse transcripts, DNA was amplified with the appropriate primers at 70°C in a LightCycler (Roche) with SYBR Green following the manufacturer's recommendation. Viral DNA was normalized by cellular genomic CCR5. Integration was measured according to Brussel and Sonigo [21], with the following modifications: the first amplification with primers L-M667 (NL4-3) or L-M667* (Ada-M) only (control) or with Alu1 and Alu2 (integrated) had an annealing temperature of 65°C. To reduce non-specific background, 2 μl of the first amplification was digested with 20 U Exonuclease I (New England Biolabs) in 20 μl for 2 h at 37°C. The nuclease was heat inactivated at 80°C for 20 min. Two microliters of the digestion were then amplified with SYBR Green at 65°C with primers Lambda T and AA55M.

Primers sequence: Strong-stop: (1) agcctgggagctctctggcta and (2) ccagagtcacacaacagacgg; Late: (1) and (3) cgcttcagcaagccgagtcct, L-M667*: atgccacgtaagcgaaactctggctagctagggaacccactg CCR5 gene: (4) gtgaagcaaatcgcagcccgc and (5) gcagcatagtgagcccagaag.

Back to Top | Article Outline

Results

Gαi activity is required for R5 and X4 HIV-1 replication in human PBMC

We wanted to clarify whether Gαi activity is required for the replication of CXCR4-utilizing HIV-1 strains as it is for the replication of R5 strains [7]. Human PBMC without preactivation were pretreated with or without 1 ng/ml PTX for 18 h. As shown in Fig. 1a and b, PTX inhibited both R5 and X4 HIV-1 production in unstimulated PBMC.

Fig. 1

Fig. 1

We then studied the effect of PTX on the viral life cycle. To test the possibility that PTX treatment might inhibit viral entry at the receptor/coreceptor level, non-stimulated PBMC were treated with 1 ng/ml of PTX either 18 h before infection or 4 h postinfection. The results showed that both conditions caused the same level of inhibition (Fig. 1c), suggesting that PTX does not have effect on the viral entry step of infection. Using real-time PCR, we found that PTX inhibited production of the late transcripts of reverse transcription (Fig. 1d).***

Back to Top | Article Outline

R5 and X4 HIV-1 induce MAPK kinases-1/2, ERK-1/2 but neither c-jun N-terminal kinase nor p38 MAPK activation

We tested whether R5 or X4 HIV-1 can induce the activation of ERK1/2 pathway in non-stimulated PBMC. As shown in Fig. 2a and b, both R5 and X4-HIV-1 induced a transient activation of MEK1/2 and ERK1/2. This activation diminished to the basal level between 20 min and 1 h after viral infection. The activation of ERK1/2 was also observed in non-stimulated primary CD4-positive T cells (Fig. 2c).

Fig. 2

Fig. 2

We further verified whether the whole HIV-1 virion- induced ERK activation is coreceptor dependent. PBMC from a CCR5Δ32/CCR5Δ32 or a CCR5WT/CCR5WT homozygous donor were infected with an R5 or an X4 strain. The X4 strain (NL4-3) but not the R5 HIV-1 (Ada-M) induced the activation of ERK1/2 in PBMC from the CCR5Δ32/CCR5Δ32 donor, whereas R5 virus did induce ERK1/2 phosphorylation in PBMC of the CCR5WT/CCR5WT donor (Fig. 2d). Lack of ERK1/2 activation was also observed in the cells infected with the virions devoid of envelope (Fig. 2e).

Popik and Pitha [16] have shown that HIV-1 induced the activation of ERK, p38 MAPK and c-jun N-terminal kinase (JNK) in Jurkat T cells expressing CCR5. Contrary to the observation in Jurkat cells, neither R5 nor X4 HIV-1 induced the phosphorylation of JNK-p54, JNK-p46 or p38 MAPK in unstimulated PBMC (Fig. 3a).

Fig. 3

Fig. 3

Back to Top | Article Outline

R5 and X4 HIV-1 induce ERK-1/2 activation through Gαi proteins

We then asked whether ERK activation is downstream to this Gαi pathway. PTX treatment completely inhibited the phosphorylation of ERK1/2 induced by Ada-M or NL4-3 (Fig. 3b and c).

Back to Top | Article Outline

Src family kinases are not involved in CCR5 and CXCR4 signaling in response to HIV-1 in PBMC

A recent report has shown that the Src kinase Lyn is required for CCR5-mediated ERK1/2 activation induced by R5 HIV-1 gp120 in human macrophages [17]. We further clarified whether the Src kinase family is an intermediate signaling molecule between Gi protein and ERK1/2. PP2 did not inhibit the phosphorylation of ERK1/2 induced by the virus as well as the control compound PP3 (Fig. 4a and b). Moreover, we found that PP2 did not have any effect on viral production (Fig. 4c).

Fig. 4

Fig. 4

Back to Top | Article Outline

ERK-1/2 activity is involved in HIV-1 replication in PBMC

To test whether ERK1/2 activity is required for R5 or X4 HIV-1 infection, non-stimulated PBMC were treated with or without 10 μmol/l of U0126 for 30 min and then proceeded to the single-round infection assay. As seen in Fig. 5a, the treatment of MEK inhibitor reduced by 80% the HIV-1 long terminal repeat (LTR) driven luciferase activity in the virions pseudotyped with M-tropic or T-tropic envelope. However, the p38 MAPK inhibitor-SB203580 had no effect on R5-envelope-pseudotyped luciferase activity (Fig. 5b). U0126 treatment did not induce significant change in the surface CD4, CCR5 and CXCR4 density after 30 min and 4 h treatment (data not shown).

Fig. 5

Fig. 5

Back to Top | Article Outline

ERK-1/2 activity is required for the completion of HIV-1 reverse transcription in PBMC

We further compared the efficiency of different steps of viral cycle in infected PBMC with/without U0126 treatment. The treatment of MEK inhibitor did not reduce the levels of the early reverse transcription products (Fig. 5c). Interestingly, the presence of MEK inhibitor reduced about 50% of late reverse transcripts. However, the inhibitor had no effect on the HIV-1 integration step, as the efficiency of HIV DNA integration did not differ from the efficiency of the reverse transcription (Fig. 5c).

Back to Top | Article Outline

ERK-1/2 activity required for HIV-1 replication is of cellular origin

It has been reported that ERK2 cosediments in an active form with HIV-1 particles upon density gradient fractionation [22]. This raises the possibility that the phosphorylated ERK1/2 found in infected cells could be of viral origin, already activated. We treated PBMC with the other MEK1 inhibitor-PD98059, which targets only inactive but not activated MEK1 [23]. PD98059 inhibited about 70–80% of both R5 and X4 HIV-1 production (Fig. 5d). Therefore, the ERK1/2 activity required for HIV-1 infection is actually generated in the target cells as a consequence of the infection rather than supplied by the virions.

Back to Top | Article Outline

Discussion

In this study, we found that both R5 and X4 HIV-1 replication is sensitive to PTX treatment, showing that Gαi proteins are implicated in viral production following virion–coreceptor interaction. Indeed, Gαi activity is required for reverse transcription. Moreover, both R5 and X4 strains triggered Gαi-dependent phosphorylation of MEK–ERK1/2, which is necessary for the completion of HIV-1 reverse transcription. An inhibitory effect of a PTX subunit, B-oligomer, upon viral entry of R5 strains has been reported, which mediates its effect through a receptor other than CCR5 [24]. We can rule out a Gi-independent inhibitory effect of the B-oligomer in our observation as the concentration of PTX that we used was 50 times lower than needed. Moreover, the B-oligomer acts on viral entry rather than on the completion of reverse transcription and does not affect X4 strains replication [24].

The activation of Gαi-ERK pathway triggered by both R5 and X4 strains suggests that viruses might induce signals through the interaction with their corresponding coreceptors to create a cellular environment that facilitates viral reverse transcription. Our results emphasize the importance of the capacity of the viral envelopes to trigger cell activation via their coreceptors. This is consistent with our previous finding that viral reverse transcription is more efficient in the cells expressing higher CCR5 density on the cell surface [25].

Several studies have evidenced various roles of ERK in the HIV-1 life cycle. Marozsan et al.[26] have shown that ERK kinases activated by high concentrations of aminooxypentane (AOP)-RANTES appear to phosphorylate the preintegration complex (PIC) and facilitate the nuclear transport of PIC. ERK2 activity associated with the virions produced in PMA treated or constitutively active MEK1 transfected 293T cells increased the infectivity of virus [27]. In our model, we found that intracellular ERK1/2 activity in the recipient cells is also required for a productive infection. These results address the importance of ERK activity in the HIV-1 viral cycle. Several laboratories have shown that ERK activation results in the increase of HIV-1 LTR expression through the transcriptional factors including NF-κB, AP-1 and C/EBP [15,28,29]. Our results showed that ERK may have a postintegration effect on the HIV life cycle (compare Fig. 5a with Fig. 5c). However, using non-stimulated primary cells, we showed that ERK activity is mainly required for the completion of reverse transcription. The discrepancy with other studies might be due to the different systems including tumor cell lines or activated primary cells used by the other laboratories. The connection between Gi proteins and ERK kinases in the signaling triggered by CCR5 remains unclear. We are now pursuing the identification of the effectors linking the G proteins and ERK kinases in HIV-1 infection.

The link between ERK activation and HIV reverse transcription remains to be unveiled. Various hypotheses have been proposed. ERK induced the phosphorylation of nef and Tat [30], which have been shown to facilitate efficient viral reverse transcription [31,32]. Kinoshita et al.[33] have shown that NFATc can overcome a blockade at reverse transcription and permit active HIV-1 replication. Two recent reports have further evidenced the interaction between NFAT and ERK. Yang et al.[34] have shown that Ser676 of NFATc4 is phosphorylated by the ERK–MAP kinase. MEK1–ERK1/2 and calcineurin-NFAT proteins form a complex in cardiac myocytes, resulting in direct phosphorylation of NFATc3, which then augmented the DNA binding activity of NFATc3 [35]. Moreover, Fauci's laboratory has recently shown that HIV envelope induces the activation of NFAT [36]. It is tempting to speculate that HIV-induced ERK activation could result in an increase in NFAT activity that could not only regulate LTR activity through its interacting partner AP-1 but also facilitate reverse transcription through a not-yet identified mechanism.

Our results show that ERK pathway triggered during R5 and X4 infection drastically facilitates HIV-1 infection in primary mononuclear cells by enhancing reverse transcription of viral RNA. The permissiveness of a cell might depend not only on the presence of the right receptors but also on the capacity of the virion to efficiently trigger the right signaling pathways through these receptors. Our ongoing project in the identification of the molecular mechanism(s) linking coreceptors to ERK and the regulation of ERK on viral reverse transcription might provide important information about the signal transduction on viral life cycle and open new therapeutic possibilities.

Back to Top | Article Outline

Acknowledgements

We thank C. Chable-Bessia for technical assistance on Western blotting and G. Lutfalla for helpful advice about real-time PCR. HIV-1 strains (Ad8, Ada-M and NL4-3) were provided by the National Institutes of AIDS Research and Reference Reagent Program. This project was supported by the Agence National de Recherche sur le SIDA (ANRS grant 2006-003).

Contributors: performed research, C.M., C.D., AL. F., B.R. and YL. L.; designed research, YL. L.; wrote the paper, P.C. and YL. L.

Back to Top | Article Outline

References

1. Del Corno M, Liu QH, Schols D, de Clercq E, Gessani S, Freedman BD, Collman RG. HIV-1 gp120 and chemokine activation of Pyk2 and mitogen-activated protein kinases in primary macrophages mediated by calcium-dependent, pertussis toxin-insensitive chemokine receptor signaling. Blood 2001; 98:2909–2916.
2. Davis CB, Dikic I, Unutmaz D, Hill CM, Arthos J, Siani MA, et al. Signal transduction due to HIV-1 envelope interactions with chemokine receptors CXCR4 or CCR5. J Exp Med 1997; 186:1793–1798.
3. Gosling J, Monteclaro FS, Atchison RE, Arai H, Tsou CL, Goldsmith MA, Charo IF. Molecular uncoupling of C-C chemokine receptor 5-induced chemotaxis and signal transduction from HIV-1 coreceptor activity. Proc Natl Acad Sci USA 1997; 94:5061–5066.
4. Alkhatib G, Locati M, Kennedy PE, Murphy PM, Berger EA. HIV-1 coreceptor activity of CCR5 and its inhibition by chemokines: independence from G protein signaling and importance of coreceptor downmodulation. Virology 1997; 234:340–348.
5. Farzan M, Choe H, Martin KA, Sun Y, Sidelko M, Mackay CR, et al. HIV-1 entry and macrophage inflammatory protein-1beta-mediated signaling are independent functions of the chemokine receptor CCR5. J Biol Chem 1997; 272:6854–6857.
6. Amara A, Vidy A, Boulla G, Mollier K, Garcia-Perez J, Alcami J, et al. G protein-dependent CCR5 signaling is not required for efficient infection of primary T lymphocytes and macrophages by R5 human immunodeficiency virus type 1 isolates. J Virol 2003; 77:2550–2558.
7. Lin YL, Mettling C, Portales P, Reant B, Clot J, Corbeau P. G-protein signaling triggered by R5 human immunodeficiency virus type 1 increases virus replication efficiency in primary T lymphocytes. J Virol 2005; 79:7938–7941.
8. Arthos J, Rubbert A, Rabin RL, Cicala C, Machado E, Wildt K, et al. CCR5 signal transduction in macrophages by human immunodeficiency virus and simian immunodeficiency virus envelopes. J Virol 2000; 74:6418–6424.
9. Lannuzel A, Barnier JV, Hery C, Huynh VT, Guibert B, Gray F, et al. Human immunodeficiency virus type 1 and its coat protein gp120 induce apoptosis and activate JNK and ERK mitogen-activated protein kinases in human neurons. Ann Neurol 1997; 42:847–856.
10. Kucukkaya B, Arslan DO, Kan B. Role of G proteins and ERK activation in hemin-induced erythroid differentiation of K562 cells. Life Sci 2006; 78:1217–1224.
11. Park KS, Lee HY, Kim MK, Shin EH, Jo SH, Kim SD, et al. Lysophosphatidylserine stimulates L2071 mouse fibroblast chemotactic migration via a process involving pertussis toxin-sensitive trimeric G-proteins. Mol Pharmacol 2006; 69:1066–1073.
12. Zhao J, Ma L, Wu YL, Wang P, Hu W, Pei G. Chemokine receptor CCR5 functionally couples to inhibitory G proteins and undergoes desensitization. J Cell Biochem 1998; 71:36–45.
13. Roland J, Murphy BJ, Ahr B, Robert-Hebmann V, Delauzun V, Nye KE, et al. Role of the intracellular domains of CXCR4 in SDF-1-mediated signaling. Blood 2003; 101:399–406.
14. Misse D, Cerutti M, Noraz N, Jourdan P, Favero J, Devauchelle G, et al. A CD4-independent interaction of human immunodeficiency virus-1 gp120 with CXCR4 induces their cointernalization, cell signaling, and T-cell chemotaxis. Blood 1999; 93:2454–2462.
15. Popik W, Hesselgesser JE, Pitha PM. Binding of human immunodeficiency virus type 1 to CD4 and CXCR4 receptors differentially regulates expression of inflammatory genes and activates the MEK/ERK signaling pathway. J Virol 1998; 72:6406–6413.
16. Popik W, Pitha PM. Early activation of mitogen-activated protein kinase kinase, extracellular signal-regulated kinase, p38 mitogen-activated protein kinase, and c-Jun N-terminal kinase in response to binding of simian immunodeficiency virus to Jurkat T cells expressing CCR5 receptor. Virology 1998; 252:210–217.
17. Tomkowicz B, Lee C, Ravyn V, Cheung R, Ptasznik A, Collman RG. The Src kinase Lyn is required for CCR5 signaling in response to MIP-1beta and R5 HIV-1 gp120 in human macrophages. Blood 2006; 108:1145–1150.
18. Jordan A, Defechereux P, Verdin E. The site of HIV-1 integration in the human genome determines basal transcriptional activity and response to Tat transactivation. EMBO J 2001; 20:1726–1738.
19. Lin YL, Mettling C, Portales P, Reant B, Robert-Hebmann V, Reynes J, et al. The efficiency of R5 HIV-1 infection is determined by CD4 T-cell surface CCR5 density through Galphai-protein signalling. AIDS 2006; 20:1369–1377.
20. Naldini L, Blomer U, Gallay P, Ory D, Mulligan R, Gage FH, et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 1996; 272:263–267.
21. Brussel A, Sonigo P. Analysis of early human immunodeficiency virus type 1 DNA synthesis by use of a new sensitive assay for quantifying integrated provirus. J Virol 2003; 77:10119–10124.
22. Cartier C, Deckert M, Grangeasse C, Trauger R, Jensen F, Bernard A, et al. Association of ERK2 mitogen-activated protein kinase with human immunodeficiency virus particles. J Virol 1997; 71:4832–4837.
23. Alessi DR, Cuenda A, Cohen P, Dudley DT, Saltiel AR. PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo. J Biol Chem 1995; 270:27489–27494.
24. Alfano M, Schmidtmayerova H, Amella CA, Pushkarsky T, Bukrinsky M. The B-oligomer of pertussis toxin deactivates CC chemokine receptor 5 and blocks entry of M-tropic HIV-1 strains. J Exp Med 1999; 190:597–605.
25. Lin YL, Mettling C, Portales P, Reynes J, Clot J, Corbeau P. Cell surface CCR5 density determines the postentry efficiency of R5 HIV-1 infection. Proc Natl Acad Sci USA 2002; 99:15590–15595.
26. Marozsan AJ, Torre VS, Johnson M, Ball SC, Cross JV, Templeton DJ, et al. Mechanisms involved in stimulation of human immunodeficiency virus type 1 replication by aminooxypentane RANTES. J Virol 2001; 75:8624–8638.
27. Jacque JM, Mann A, Enslen H, Sharova N, Brichacek B, Davis RJ, Stevenson M. Modulation of HIV-1 infectivity by MAPK, a virion-associated kinase. EMBO J 1998; 17:2607–2618.
28. Briant L, Robert-Hebmann V, Sivan V, Brunet A, Pouyssegur J, Devaux C. Involvement of extracellular signal-regulated kinase module in HIV-mediated CD4 signals controlling activation of nuclear factor-kappa B and AP-1 transcription factors. J Immunol 1998; 160:1875–1885.
29. Flory E, Weber CK, Chen P, Hoffmeyer A, Jassoy C, Rapp UR. Plasma membrane-targeted Raf kinase activates NF-kappaB and human immunodeficiency virus type 1 replication in T lymphocytes. J Virol 1998; 72:2788–2794.
30. Yang X, Gabuzda D. Regulation of human immunodeficiency virus type 1 infectivity by the ERK mitogen-activated protein kinase signaling pathway. J Virol 1999; 73:3460–3466.
31. Schwartz O, Marechal V, Danos O, Heard JM. Human immunodeficiency virus type 1 Nef increases the efficiency of reverse transcription in the infected cell. J Virol 1995; 69:4053–4059.
32. Harrich D, Ulich C, Garcia-Martinez LF, Gaynor RB. Tat is required for efficient HIV-1 reverse transcription. EMBO J 1997; 16:1224–1235.
33. Kinoshita S, Chen BK, Kaneshima H, Nolan GP. Host control of HIV-1 parasitism in T cells by the nuclear factor of activated T cells. Cell 1998; 95:595–604.
34. Yang TT, Xiong Q, Graef IA, Crabtree GR, Chow CW. Recruitment of the extracellular signal-regulated kinase/ribosomal S6 kinase signaling pathway to the NFATc4 transcription activation complex. Mol Cell Biol 2005; 25:907–920.
35. Sanna B, Bueno OF, Dai YS, Wilkins BJ, Molkentin JD. Direct and indirect interactions between calcineurin-NFAT and MEK1-extracellular signal-regulated kinase 1/2 signaling pathways regulate cardiac gene expression and cellular growth. Mol Cell Biol 2005; 25:865–878.
36. Cicala C, Arthos J, Censoplano N, Cruz C, Chung E, Martinelli E, et al. HIV-1 gp120 induces NFAT nuclear translocation in resting CD4+ T-cells. Virology 2006; 345:105–114.
Keywords:

extracellular signal-regulated kinase; HIV; reverse-transcription; signaling

© 2008 Lippincott Williams & Wilkins, Inc.