Secondary Logo

Journal Logo

BASIC SCIENCE

Gatekeeper role of 14-3-3τ protein in HIV-1 gp120-mediated apoptosis of human endothelial cells by inactivation of Bad

Yano, Mihiro*; Nakamuta, Shinichi*; Shiota, Mayumi; Endo, Hiroshi; Kido, Hiroshi

Author Information
doi: 10.1097/QAD.0b013e32810539f3
  • Free

Abstract

Introduction

HIV-1 infection causes an early immune dysfunction and progressive destruction of CD4+ T lymphocytes. Previous studies have established that the programmed cell death of uninfected bystander cells is an important event implicated in the pathogenesis of AIDS [1–3]. The neuronal cell death associated with HIV-1 causes a degeneration of the nervous system in patients with AIDS, who develop cognitive and motor dysfunctions known as HIV-1-associated dementia (HAD) [4–6]. It is noteworthy that HIV-1 infects the macrophages and microglia, but not the neurons, and that neuronal cell death is predominantly caused by the attack of viral proteins and inflammatory cytokines released from infected macrophages, or microglia or both [7]. The viral envelope glycoprotein, gp120, which is shed from HIV-infected cells during viral replication, has been proposed as a prominent inducer of neuronal loss. It has become increasingly apparent that the release by gp120 of neurotoxic factors from brain macrophages causes neuronal cell death [8–10]. Gp120-mediated neuronal injury also occurs as a consequence of a direct interaction with neurons via chemokine receptors, such as CXC chemokine receptor 4 (CXCR4) and CC chemokine receptor 5 (CCR5), and blockade of this interaction prevents neuronal cell death [11–13]. It has been shown that the activation of caspase-3 contributes to gp120-dependent apoptosis in various CXCR4 positive cells, including human endothelial cells [14,15]. Little is known with respect to the upstream signals of caspase-3 in gp120-induced cell death. However, it has recently been reported that the interaction between gp120 and CD4/CXCR4 or CXCR4 causes the induction, and subsequent activation of Bax [15,16], suggesting that a mitochondrial pathway is intimately involved in gp120-induced apoptosis, specifically triggered by CXCR4.

The 14-3-3 protein is a highly conserved and ubiquitously expressed protein family, which is involved in the regulation of a wide range of cellular processes containing signal transduction [17–21]. They also have been implicated in the regulation of apoptosis, through the sequestration of various pro-apoptotic molecules, such as Bad and Bax [22,23]. Binding to the phosphorylated serine residue within the conserved motif of targets molecules is characteristic of 14-3-3 [24,25]. On the other hand, the highest tissue concentration of 14-3-3 proteins is in the brain, comprising approximately 1% of the total amount of soluble protein [26]. Another prominent role played by14-3-3 proteins has been abundantly discussed in the context of various neurological disorders. They often assemble in disease-specific lesions and protein aggregates within the brain of patients with Parkinson's diseases and type 1 spinocerebellar ataxia [27]. Furthermore, 14-3-3 proteins have been detected in the cerebrospinal fluid (CSF) of patients with Creutzfeldt–Jakob disease (CJD) and characterized as a most sensitive marker to make this diagnosis [28–31]. 14-3-3 proteins in CSF have also been detected in other diseases associated with extensive injury to the brain, such as herpes simplex encephalitis and acute ischemic stroke [28]. We have previously suggested that, in patients with HAD, 14-3-3 proteins might be reliable markers of the rate and amount of neural cell destruction, since they are present in the CSF of patients with advanced AIDS and neurological manifestations, particularly patients with CD4+ T cells in the blood < 20/mm3[32]. These observations indicate that the presence of 14-3-3 proteins in CSF is a marker of brain neuronal cell destruction and of their leakage from disrupted neurons. However, the detection of different 14-3-3 isomers in the CSF in specific neurological diseases suggests that these proteins are directly involved in the pathogenesis of each particular disorder [27]. In addition, in the central nervous system (CNS), 14-3-3 proteins are often induced in response to stress, such as nerve injury and oxidation, perhaps as a cell survival mechanism [33,34]. Thus, understanding the role of 14-3-3 proteins in cell death related to HIV-1, in gp120-induced apoptosis through CXCR4 or CCR5 in particular, may help address the neuropathogenetic mechanisms of HIV-1.

This study examined the role played by 14-3-3 proteins in the gp120-mediated cytotoxicity of human umbilical vein endothelial cells (HUVEC), which, like neuronal cells, have α- or β-chemokine receptors, but no CD4 receptor to induce their apoptosis [15,35]. We found that, in HUVEC, 14-3-3τ protects against cell death induced by gp120 by a negative regulation of the activity of Bad. Suppression of the expression of Bad rescued the cells from the apoptosis triggered by gp120. Furthermore, among the various 14-3-3 isoforms present in HUVEC, 14-3-3τ specifically up-regulated in response to the treatment of gp120. Down-regulation of 14-3-3τ by RNAi accelerated the gp120-dependent dephosphorylation of Bad at Ser-112 and its association with the Bcl-XL in mitochondria, thus promoting the gp120-mediated apoptosis. Our study is the first demonstration of the protective role of a 14-3-3 protein in gp120-induced cell death.

Methods

Materials

Recombinant HIV-1 gp120/gp160 were obtained from ImmunoDiagnostics Inc. (Woburn, Massachusetts, USA), stromal derived factor (SDF)-1α from R&D Systems, Inc. (Minneapolis, Minnesota, USA), rabbit antibodies against 14-3-3 total (K-19), isoform-specific antibodies against 14-3-3τ and ζ from Santa Cruz Biotechnology Inc. (Santa Cruz, California, USA), and β, ε, γ and η from IBL (Gunma, Japan). The rabbit anti-Bad, -Bcl-XL and mouse anti-phospho Bad (Ser112) antibodies were obtained from Cell Signaling Technology Inc. (Danvers, Massachusetts, USA). The mouse monoclonal antibody (MAb) against Bax was obtained from MBL (Nagoya, Japan). MAb against cytochrome c was purchased from BD Biosciences Pharmingen (San Jose, California, USA) and MAb against human CXCR4, 12G5 from R&D Systems. Paraffin-embedded brain tissue sections from three AIDS patients with HAD, three AIDS patients without HAD, and two lung cancer patients without brain metastasis and neurological complications, serving as negative controls, were supplied by Dr S. Mori and Dr A. Masunaga, University of Tokyo, and Dr T. Sano, University of Tokushima, Japan. The diagnosis of HAD was made according to established clinical criteria [36].

Cell culture and viability assay

HUVEC (Cambrex BioScience, Walkersville, Maryland, USA) were grown in endothelial basal medium (EBM) containing endothelial cell growth supplement at 37°C. The cells were treated with gp120 or gp160, at 10 nmol/l for 24 h, in absence or presence of CXCR4 neutralizing antibody. The activity of mitochondrial dehydrogenase [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (MTT) assay was used to determine cell death/survival. The reaction product was measured at Å570 and the relative viability of cells treated with gp120/160 versus untreated cells was calculated. The release of lactate dehydrogenase (LDH) was measured as described previously [37].

Reverse transcriptase-polymerase chain reaction

A RNeasy® Mini Kit (Qiagen, Valencia, California, USA) was used to isolate total RNA from HUVEC. Reverse transcriptase-polymerase chain reaction (RT-PCR) was carried out, using the following primer pairs to amplify the 14-3-3 proteins: β, GenPeptide accession no. NM003404, forward primer (F) 5′CATGAAGGCAGTCACAGAACA3′, reverse primer (R) 5′TTGCTTCATCAAATGCCG3′; ε, NM006761, (F) 5′CAGCAGCATTGAACAGAAAGA3′, (R) 5′CCTGCATGTCTGAAGTCCATA3′; γ, NM012479, (F) 5′AATGAGCCACTGTCGAATGA3′, (R) 5′TCGTTGAGGGTGTCAAGCT3′; ζ, NM003406, (F) 5′GACGGAAGGTGCTGAGAAAAA3′, (R) 5′TCTCCTTGGGTATCCGATGT3′; τ, NM006826, (F) 5′AGACTGAGCTGATCCAGAAGG3′, (R) 5′TGTGTGGGTTGCATCTCTTT3′; and η, NM003405, (F) 5′AAGAATGTGGTTGGTGCCAG3′, (R) 5′AGCAACTGCATGATCAGCGT3′. The products were examined by agarose gel electrophoresis after 21 cycles.

RNA interference

The sequences of the sense strands used to generate specific siRNA were obtained as follows: Bad, GenPeptide accession no. BC001901, 5′-AACGCAGATGCGGCAAAGCTC-3′; Bax, NM-138764, 5′-AACATGGAGCTGCAGAGGATG-3′; 14-3-3τ, X56468.1, 5′-AAGTTGCAGCTGATTAAGGAC-3′; 14-3-3ζ, MN-145690, 5′-AACATTGGATAATTCAGCTCC-3′; 14-3-3ε, U28936, 5′-AACCACATCCATCCCTGCTAC-3′. The siRNAs were synthesized using the Silencer siRNA construction kit (Ambion, Austin, Texas, USA) according to manufacturer's instructions. HUVEC were transfected with each siRNA (10 nmol/l) using the Oligofectamine reagent (Invitrogen, Carlsbad, California, USA), and grown for 72 h to allow an effective decrease in the expression of the respective target molecules.

Immunoblotting and immunoprecipitation

HUVEC were lysed in RIPA buffer (50 mmol/l Tris-HCl, pH 8.0, 150 mmol/l NaCl, 10% glycerol, 1% NP 40, 0.5% deoxycholate, 0.4 mmol/l ethylenediamine tetraacetic acid, 0.5 mmol/l sodium orthovanadate) for 30 min at 4°C. The cell lysates and immunoprecipitates were resolved in Laemmli sample buffer. The samples were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to a polyvinylidene difluoride membrane, reacted with the respective antibodies, and detected with an ECL chemiluminescence detection kit.

For immunoprecipitation, cell lysates were incubated with the indicated antibodies for 1 h at 4°C. Protein G-Sepharose beads were added to collect the immunocomplexes for an additional 1 h of incubation. The pellets were washed three times with RIPA buffer.

Cell fractionation

HUVEC lysed in 20 mmol/l HEPES-KOH, pH 7.5, buffer containing 0.25 mol/l sucrose were homogenized in a Dounce homogenizer, and centrifuged at 1000 g, to separate nuclei and unbroken cells. The supernatants were centrifuged at 10 000 g, for 15 min, and the pellets were collected as the heavy membrane/mitochondria fraction. The supernatants were further centrifuged at 100 000 g, for 30 min, and the resulting supernatants were collected as the cytosol fraction.

Immunofluorescence

The immunofluorescence of gp120-treated HUVEC grown on glass chamber slides was analyzed. The cells were fixed in 4% paraformaldehyde, and permeabilized with 0.1% Triton X-100 for 10 min at room temperature. The cells were stained with anti-14-3-3τ or ζ antibody (2 μg/ml) and anti-phospho-Bad, 5 μg/ml, diluted in blocking buffer for 2 h, and incubated for 1 h with either Alexa Flour 488 (Green)-conjugated goat secondary antibody against rabbit, or rat IgG and Texas Red-conjugated goat secondary antibody against mouse IgG (Invitrogen). The stained cells were visualized on confocal microscopy. The brain tissue sections were deparaffinized, and immunohistochemically stained, using the Histofine Simple stain MAXPO (Nichirei Biosciences Inc., Japan) according to manufacturer's instructions. Anti-14-3-3 universal (1 μg/ml) or anti-14-3-3τ (1 μg/ml) antibody was applied to the tissue sections for 1 h at room temperature.

Results

HIV-1 envelope proteins induce CXCR4-mediated cell death in HUVEC

The survival of HUVEC treated with gp120/160 was measured by the MTT assay. The gp120 proteins used in this study were from the T-cell tropic IIIB and MN strains of HIV-1, which interact with CXCR4 in preference to CCR5 [38,39]. After treatment with recombinant gp120 or gp160 (IIIB), the viability of the cells was decreased in a concentration-dependent manner, indicating that these viral envelop proteins induced apoptosis in HUVEC (Fig. 1a). Further, the inhibition of apoptosis by a specific neutralizing antibody to CXCR4 confirmed that this receptor plays a key role in the death of HUVEC (which lack the CD4 receptor) induced by gp120/160, (Fig. 1a). This gp120-mediated apoptosis was also confirmed by the LDH release assay and Hoechst staining (Fig. 1b and c).

Fig. 1
Fig. 1:
Induction of apoptosis of human umbilical vein endothelial cells (HUVEC) by HIV-1 gp120 and gp160. (a) HUVEC were treated with indicated concentrations of gp120 or gp160 for 24 h in the absence or presence of anti-CXCR4 receptor antibody, and the viability of the cells was analyzed by MTT assay. (b) Lactate dehydrogenase (LDH) release assay of HUVEC after treatment with gp120 or gp160 at 10 nmol/l for 24 h. Results are means of three separate experiments from cells of different cultures. (c) HUVEC treated or untreated with 10 nmol/l gp120 were incubated with Hoechst 33342 for the assessment of nuclear characteristics of apoptosis. Arrows point to morphologically characteristic apoptotic nuclei.

Gp120 specifically up-regulates the expression of 14-3-3τ in HUVEC

To clarify the mechanisms of gp120/gp160-dependent apoptosis, we studied the effects of these viral envelope proteins on the 14-3-3 protein family. We identified 14-3-3β, ζ, ε, γ and η to be the main isoforms in HUVEC, whereas we found very low expressions of 14-3-3τ (Fig. 2a). However, immunoblotting with a 14-3-3τ antibody revealed that treatment of HUVEC with gp120/160 increased the expression of 14-3-3τ 2.5-fold compared with untreated cells, while the expression of the other isoforms remained unchanged. A prominent increase in 14-3-3τ mRNA, but not of the other isoforms mRNA, in HUVEC exposed to gp120/gp160 was confirmed by RT-PCR (Fig. 2b). The exposure of HUVEC to SDF-1α, the natural ligand of CXCR4 which induces cell death in a similar manner to gp120 (Fig. 2c), did not increase the expression of 14-3-3τ, indicating that gp120 specifically up-regulated 14-3-3τ (Fig. 2d). In a previous study using a gene array, the 14-3-3 gene was identified as one of the host cell factors that are up-regulated in response to the treatment with gp120 in human neuronal cells [40]. These observations suggest that the 14-3-3 protein regulates the gp120-induced apoptosis. To examine the importance of the 14-3-3τ protein induced by gp120, we extended our in-vitro observations by immunohistochemically staining the brain tissue of AIDS patients, with and without HAD, for the 14-3-3 protein. Immunostaining was performed with a universal antibody against 14-3-3 proteins (K-19), which recognizes all isoforms except δ, and with a specific antibody for 14-3-3τ ⋅ Immunostaining with K-19 revealed that the neuronal cells express large amounts of 14-3-3 proteins in uninfected individuals (Fig. 2e), in AIDS patients without HAD (Fig. 2g) and in the area without morbidity in the brain of HAD patients (Fig. 2i). However 14-3-3 proteins were not detected in the loci with massive neuronal disruption in AIDS patients with HAD (Fig. 2k). It is noteworthy that we detected prominently elevated quantities of 14-3-3τ in the neuronal cells of non-atrophied areas near by massive disruption in the brain of AIDS patients with HAD (Fig. 2j), whereas minimal or small amounts of 14-3-3τ were detectable in the brain tissues of negative control patients (Fig. 2f) as well as AIDS patient without HAD (Fig. 2h).

Fig. 2
Fig. 2:
Induction of 14-3-3τ expression in HIV-1 gp120-treated human umbilical vein endothelial cells (HUVEC) and in neurons from HIV-1-associated dementia (HAD) patient. (a) Up-regulation of the expression of 14-3-3τ by gp120/gp160. Extracts prepared from HUVEC untreated or treated with 10 nmol/l gp120/gp160 for 24 h were separated by sodium dodecy sulphate-polyacrylamide gel electrophoresis, and the expressions of 14-3-3 proteins were determined by immunoblotting with each specific anti-14-3-3 antibody. The quantity of 14-3-3 protein was estimated by densitometric analysis using Scion Image (Scion Corporation, Frederick, Maryland, USA). (b) gp120/gp160-induced expression of each 14-3-3 isoform mRNA. (c) SDF-1α induces apoptosis in HUVEC. The viability of HUVEC treated with various concentrations of SDF-1 for 24 h was assessed by MTT assay. (d) Expression of 14-3-3 proteins in HUVEC treated with SDF-1α for 24 h, examined as described in (a). (e)–(k) Representative immunohistochemical staining patterns for 14-3-3 protein in human brain tissues. (e), (g), (i) and (k) are immunohistochemical stains with K-19 in cortical neurons; (f), (h), and (j) show the immunohistochemical detection of 14-3-3τ using specific antibody against 14-3-3τ. (e) and (f) Brain of lung cancer patient (negative control). (g) and (h) Brain of AIDS patient without HAD. (i) and (j) The neuronal cells of non-atrophied areas near to massive disruption in the brain of AIDS patients with HAD. (k) Severely atrophied area in the brain of AIDS patient with HAD.

Involvement of Bad and 14-3-3τ in the apoptosis of HUVEC by gp120

14-3-3τ has been implicated in signaling for apoptosis through a negative regulation of the activities of Bad and Bax. 14-3-3τ generally interacts with, and sequestrates these pro-apoptotic proteins to prevent their translocation to the mitochondria in living cells, inhibiting cell death [22,23]. On the other hand, previous studies have shown that gp120 increases the amounts of Bax found in CXCR4-positive cells, while its role in apoptosis was not clarified. To examine whether 14-3-3 proteins interact with these proapoptotic factors, we immunoprecipitated Bad and Bax in lysates extracted from HUVEC before and after gp120 treatment. Western blot analysis of the immunoprecipitates with the anti-14-3-3 proteins before treatment with gp120 revealed the presence of specific co-immunoprecipitation of 14-3-3τ, but not of other isoforms, with Bad (Fig. 3a). After treatment with gp120, the amount of association of 14-3-3τ with Bad was prominently decreased to 38% of that observed before treatment. In contrast, 14-3-3 proteins were barely detectable in the immunoprecipitates of Bax, regardless of whether the cells had been exposed to gp120 (Fig. 3a). To examine the roles of 14-3-3τ and Bad in gp120-induced apoptosis, we reduced the amounts of endogenous Bad and 14-3-3τ present in HUVEC with RNAi, and studied their effects on gp120-mediated cell death. Treatment of HUVEC with Bad dsRNA distinctly protected the cells against gp120-induced apoptosis, whereas treatment with Bax dsRNA had no effect (Fig. 3b). These observations suggest that Bad, but not Bax, mediated the apoptosis induced by gp120 in HUVEC. On the other hand, the suppression of 14-3-3τ prominently enhanced cell death mediated by gp120, although this effect on apoptosis was not observed in 14-3-3ε or ζ knock-down cells (Fig. 3c), suggesting that 14-3-3τ acts as an anti-apoptotic factor in the gp120-induced apoptosis of HUVEC.

Fig. 3
Fig. 3:
Bad-mediated apoptotic pathway in human umbilical vein endothelial cells (HUVEC) by gp120 and the inhibitory effect of 14-3-3τ on that pathway. (a) Co-immunoprecipitation of 14-3-3 proteins with pro-apoptotic proteins in gp120-treated or untreated HUVEC. Cell extracts, prepared as described in Fig. 2, were immunoprecipitated with an anti-Bad or anti-Bax antibody, followed by immunoblotting with each specific anti-14-3-3 antibody. The effect of pro-apoptotic proteins (b) or 14-3-3 proteins (c) RNAi on the gp120-mediated cell death in HUVEC. The cells exposed to siRNA targeting Bad, Bax, 14-3-3τ, 14-3-3ε or 14-3-3ζ for 72 h were either left untreated or treated with 10 nmol/l gp120 for 24 h, and an MTT assay was used to determine cell death/survival (upper panel). (b) The value was expressed as the percentage of cell viability without gp120, which was set at 100%. The silencing efficiency of each protein was determined by immunoblotting with the appropriate antibodies (lower panel).

Down-regulation of 14-3-3τ increases the gp120-dependent dephosphorylation of Bad in HUVEC

Binding of 14-3-3 to phosphorylated serine residues within the conserved motifs of target molecules is a well-defined mechanism for the recognition of targets proteins [24,25]. The importance of phosphorylation is noteworthy with regard to Bad. In living cells, where intracellular signaling cascades that promote survival are maintained, Bad is phosphorylated at Ser-112 and/or Ser-136 and associates with cytoplasmic 14-3-3, which protects it from dephosphorylation or sequesters it away from anti-apoptotic molecules localized in mitochondria, such as Bcl-XL and Bcl2 [41]. In absence of survival stimuli, Bad is dephosphorylated and localized to the outer mitochondrial membrane where it binds to the Bcl-2 family members, inactivates them, causing cell death. In HUVEC, grown in EBM supplemented with endothelial growth factor, Bad was phosphorylated on serine 112 (Fig. 4a). To confirm that the proapoptotic function of Bad was inactivated by 14-3-3τ in HUVEC undergoing apoptosis induced by gp120, we examined whether 14-3-3τ plays a role in preventing the dephosphorylation of Bad. Compared with control, the knock down of 14-3-3τ reduced by 45% the phosphorylation of Bad in gp120-treated cells, while little dephosphorylation of Bad was observed in either 14-3-3ζ RNAi or control cells after gp120 treatment (Fig. 4a). The total amounts of Bad, including its phosphorylated form, were nearly the same whether the cells had been exposed to gp120 or not. The dephosphorylation of Bad by gp120 in 14-3-3τ RNAi cells was time-dependent (Fig. 4b). We also analyzed, by immunofluorescence microscopy, the effects of suppressing 14-3-3τ on the phosphorylation of Bad. This analysis showed a prominent decrease in Bad phosphorylation (serine 112) in the cytosol of 14-3-3τ knock-down cells after treatment with gp120, while little change in the dephosphorylation of Bad was observed in the cells expressing normal amounts of 14-3-3τ (Fig. 4c). On the other hand, treatment of the cells with 14-3-3ζ dsRNA had no effect on the phosphorylation of Bad. These results suggest that 14-3-3τ protects Bad against the attack of gp120, preventing its dephosphorylation.

Fig. 4
Fig. 4:
14-3-3τ RNAi promotes the dephosphorylation of Bad evoked by gp120. Human umbilical vein endothelial cells (HUVEC) untreated or treated with dsRNA for 14-3-3τ or ζ was exposed to gp120 for 24 h, and cell extracts were prepared as described in ‘Methods’. (a) Degrees of phosphorylated Bad and total Bad were assessed by immunobloting, using indicated antibodies. The phosphorylation status of Bad was quantified by densitometric analysis using Scion Image. (b) Time-dependent dephosphorylation of Bad by gp120 in 14-3-3τ RNAi cells. (c) Absence of Bad phosphorylation in 14-3-3τ knock-down cells. HUVEC treated as in (a) were stained for 14-3-3τ and phosphor-Bad (upper images) or 14-3-3ζ and phosphor-Bad (lower images). Nuclei were stained with Hoechst 33342. In (c), the arrows point to 14-3-3τ knock-down cells (upper images) and 14-3-3ζ knock-down cells (lower images).

14-3-3τ prevents the translocation of Bad to mitochondria and subsequent release of cytochrome c into the cytosol

To determine whether 14-3-3τ is an apoptosis inhibitor of mitochondrial pathway, which induces apoptosis of HUVEC induced by gp120, we examined the role of 14-3-3τ in the subcellular localization of Bad before and after treatment with gp120. When we attenuated the expression 14-3-3τ by RNAi, the amount of Bad translocated from cytosol into mitochondria by treatment with gp120 was significantly greater than in the cells untreated with RNAi and in the cells treated with 14-3-3ζ RNAi (Fig. 5a). The magnitude of the increase after treatment with gp120 was 3.4-fold for 14-3-3τ dsRNA-treated cells and 1.6-fold for untreated cells (Fig. 5a). We then examined whether Bad interacted with pro-survival Bcl-2 family members. Western blots analysis of immunoprecipitated Bad with an anti-Bcl-XL antibody revealed that the rate of association between Bad and Bcl-XL was 1.8 fold greater in gp120-treated than in untreated cells. This association in 14-3-3τ dsRNA-treated cells was three-fold higher in presence than in absence of gp120 (Fig. 5b). We further ascertained the significance of 14-3-3τ in this pathway, using a cytochrome c release assay. Treatment of the cells with 14-3-3τ dsRNA increased 6.7-fold the gp120-dependent release of cytochrome c from mitochondria, in contrast to the 3.9-fold and 2.9-fold in control and 14-3-3ζ RNAi cells, respectively (Fig. 5c). These observations clearly indicate the inhibitory role of 14-3-3τ in gp120-mediated cell death, in which it inactivates the proapoptotic activity of Bad to promote cellular survival.

Fig. 5
Fig. 5:
A decrease in 14-3-3τ accerelates the gp120-mediated translocation of Bad to the mitochondria and the release of cytochrome c into the cytosol. Human umbilical vein endothelial cells (HUVEC) transfected with 14-3-3τ or ζ siRNA were either left untreated or treated with 10 nmol/l gp120 for 24 h. The cells were then lysed and fractionated by differential centrifugation to separate mitochondria from cytosol. The translocation of Bad to mitochondria was visualized by the immunoblotting of mitochondrial fractions using anti-Bad antibody (a). The grp75 protein was used as a loading control to ensure the use of equal amounts of mitochondria. The release of cytochrome c into the cytosol was also analyzed by western blotting using anti-cytochrome c antibody (c). Equal loading of cytosol fractions was controlled by Hsp90. 14-3-3τ RNAi promotes the gp120-dependent association of Bad with Bcl-XL (b). Cell extracts, prepared as described in Fig. 4, were immunoprecipitated with Bad antibody or control IgG, and immunoblotted for Bcl-XL. The quantity of each protein was estimated by densitometric analysis using Scion Image.

Discussion

We have shown the prognostic significance of 14-3-3 proteins in the CSF as a marker of neuronal injury in patients with AIDS [32]. More recently, the relationship between the appearance of 14-3-3 in CSF and dementia has been demonstrated in the simian immunodeficiency virus/macaque model of HAD [42]. However, no attention was paid to the physiological roles played by 14-3-3 in HAD, since its presence in the CSF of patients with HAD or with other diseases of the CNS is usually attributed to leakage from destroyed neurons. Therefore, we performed this study to determine whether 14-3-3 proteins play an important role in the process of cell injury caused by HIV-1.

gp120 has been suggested to be prominently involved in the progression of brain injury caused by HIV-1 infection, and its presence has, indeed, been found in the brain and CSF of HAD patients [43,44]. Previous studies have shown that the interaction of gp120 with CXCR4 or CCR5, or with both, triggers neuronal cell death. An in-vitro model system with culture of HUVEC, using preferentially CXCR4 to mediate HIV-1 infection via gp120 binding, might provide an important molecular clue to the pathogenesis of HAD, given the complexity of isolating human neurons and of growing them in culture. In this study, we have shown that 14-3-3τ, which has been barely detected in HUVEC as well as in the CNS of humans under normal condition, is up-regulated after treatment with gp120, and plays an essential role in preventing cell death. The inducible changes in the expression of 14-3-3 protein have been shown in defensive responses to microbial attacks, as well as in response to metabolic and nutritional stress [45,46]. We found, recently, that Drosophila 14-3-3ζ is a heat-induced protein, the expression of which is regulated at the transcriptional level [47]. Among the six isoforms examined, gp120 selectively increased the expressions of 14-3-3τ in HUVEC, indicating that different isoforms are regulated differently, and fulfill specific functions. Since increased amounts of 14-3-3τ have also been detected immunohistochemically in the brain of HAD patients, its up-regulation related to gp120, described here, should be viewed as an adaptive process that activates survival signaling pathways.

Earlier observations suggest that cell death caused by HIV-1 encoded proteins is closely related to mitochondrial control. It has been reported that gp120 increases the expression of the death agonist Bax, and that activation of the latter is a critical event in apoptosis induced by gp120 [15,16], while others found, on the contrary, that gp120 had no effect on the expression of Bax [48]. In the present study, we detected no change in the cellular content of Bax in gp120-treated HUVEC. In addition, the absence of rescue of the cells from gp120-induced apoptosis by the deletion of Bax argues against its role in the promotion of cell death, at least in HUVEC. Instead, we showed that dsRNA against Bad prominently inhibited the apoptosis mediated by gp120 in HUVEC. Furthermore, RNAi of 14-3-3τ accelerated the dephosphorylation of Bad at Ser 112 by gp120, thus promoting its association with Bcl-XL and the mitochondrial release of cytochrome c. Previous experiments have shown that serine 112 of Bad is phosphorylated by survival kinases, such as Rsk and PKA [49,50]. Phosphorylation of Bad at Ser 112 promotes its interaction with 14-3-3 proteins and its sequestration in the cytosol. In cell death mediated by HIV-1 encoded proteins, Nef blocks apoptosis in T cells by inducing the phosphorylation of Bad in a phosphatidylinositol 3 (PI3) kinase- and PAK-dependent pathway [51]. On the other hand, there is evidence showing that calcineurin, a calcium-activated protein phosphatase, dephosphorylates serine 112 of Bad, thereby enhancing the mitochondrial translocation of Bad and inducing apoptosis [52]. It has recently become apparent that the induction of gp160 in CD4+ cells causes an increase in intracellular calcium concentration, which activates endogenous calcineurin, in turn dephosphorylating Bad and promoting its association with Bcl-XL [53]. These observations might support ours, which showed that Bad is a key molecular switch candidate that regulates the death of HUVEC in response to gp120. Our experiments provided the first proof that 14-3-3 is the critical protein determining the cellular decision to either initiate or suppress the apoptosis mediated by gp120 through CXCR4. The relationship between the various events observed in HUVEC in vitro and the increased expression of 14-3-3τ in brain tissues of patients with HAD in vivo remains unclear. Although the apoptosis-related roles of 14-3-3τ observed in HUVEC do not directly explain the development of HAD, these in-vitro studies might provide important clues toward further investigations of its pathogenesis. Whether 14-3-3τ is, indeed, involved in the inhibition of neuronal cell death evoked by gp120, and whether this function is applicable in vivo, warrants further studies.

Acknowledgements

We thank Dr Shigeo Mori and Dr Atsuko Masunaga from The University of Tokyo, and Dr Toshiaki Sano from The University of Tokushima, for kindly supplying the sections of normal and diseased brain tissue.

Sponsorship: This work was supported, in part, by a Grant-in-Aid (#205-01) from the Ministry of Health and Welfare, a Grant-in-Aid (#17591044) from the ministry of Education, Culture, Sports, Science and Technology of Japan, and by the program for promotion of fundamental studies in health of NIBIO.

References

1. Meyaard L, Otto SA, Jonker RR, Mijnster MJ, Keet RP, Miedema F. Programmed death of T cells in HIV-1 infection. Science 1992; 257:217–219.
2. Finkel TH, Tudor-Williams G, Banda NK, Cotton MF, Curiel T, Monks C, et al. Apoptosis occurs predominantly in bystander cells and not in productively infected cells of HIV- and SIV-infected lymph nodes. Nat Med 1995; 1:129–134.
3. Badley AD, Pilon AA, Landay A, Lynch DH. Mechanisms of HIV-associated lymphocyte apoptosis. Blood 2000; 96:2951–2964.
4. Adle-Biassette H, Levy Y, Colombel M, Poron F, Natchev S, Keohance C, et al. Neuronal apoptosis in HIV infection in adults. Neuropathol Appl Neurobiol 1995; 21:218–227.
5. Petito CK, Robert B. Evidence of apoptotic cell death in HIV encephalitis. Am J Pathol 1995; 146:1121–1130.
6. An SF, Giometto B, Scaravilli T, Tavolato B, Gray F, Scaravilli F. Programmed cell death in brains of HIV-1-positive AIDS and pre-AIDS patients. Acta Neuropathol 1996; 91:169–173.
7. Kaul M, Garden GA, Lipton SA. Pathways to neuronal injury and apoptosis in HIV-associated dementia. Nature 2001; 410:988–994.
8. Lipton SA. Requirement for macrophage in neuronal injury induced by HIV envelope protein gp120. Neuroreport 1992; 3:913–915.
9. Giulian D, Wendt E, Vaca K, Noonan CA. The envelop glycoprotein of human immunodeficiency virus type 1 stimulates release of neurotoxins from monocytes. Proc Natl Acad Sci U S A 1993; 90:2769–2773.
10. Kong LY, Wilson BC, McMillian MK, Bing G, Hudson PM, Hong JS. The effect of the HIV-1 envelope protein gp120 on the production of nitric oxide and proinflammatory cytokines in mixed glial cell cultures. Cell Immunol 1996; 172:77–83.
11. Meucci O, Fatatis A, Simen AA, Bushell TJ, Gray PW, Miller RJ. Chemokines regulate hippocampal neuronal signaling and gp120 neurotoxicity. Proc Natl Acad Sci U S A 1998; 95:14500–14505.
12. Hesselgesser J, Taub D, Baskar P, Greenberg M, Hoxie J, Kolson DL, et al. Neuronal apoptosis induced by HIV-1 gp120 and the chemokine SDF-1 is mediated by the chemokine receptor CXCR4. Curr Biol 1998; 8:595–598.
13. Catani MV, Corasaniti MT, Navarra M, Nistico G, Finazzi-Agro A. Melino G. gp120 induces cell death in human neuroblastoma cells through the CXCR4 and CCR5 chemokine receptors. J Neurochem 2000; 74:2373–2379.
14. Biard-Piechaczyk M, Robert-Hebmann, Richard V, Roland J, Hipskimd RA, Devaux C. Caspase-dependent apoptosis of cells expressing the chemokine receptor CXCR4 is induced by cell membrane-associated human immunodeficiency virus type 1 envelope glycoprotein (gp120). Virology 2000; 268: 329–344.
15. Ullrich CK, Groopman JE, Ganju RK. HIV-1 gp120- and gp160-induced apoptosis in cultured endothelial cells is mediated by caspases. Blood 2000; 96:15883–15886.
16. Castedo M, Ferri KF, Blanco J, Roumier T, Larochette N, Metivier D, et al. Human immunodeficiency virus 1 envelope glycoprotein complex-induced apoptosis involves mammalian target of rapamycin/FKBP12-rapamycin-associated protein-mediated p53 phosphorylation. J Exp Med 2001; 194:1097–1110.
17. Fu H, Xia K, Pallas DC, Cui C, Conroy K, Narsimhan RP, et al. Interaction of the protein kinase Raf-1 with 14-3-3 proteins. Science 1994; 266:126–129.
18. Reuther GW, Fu H, Cripe LD, Collier RJ, Pendergast AM. Association of the protein kinase-c-Bcr and Bcr-Abl with proteins of the 14-3-3 family. Science 1994; 266:129–133.
19. Mori H, Inoue M, Yano M, Wakabayashi H, Kido H. 14-3-3tau associates with a translational control factor FKBP12-rapamycin-associated protein in T cells after stimulation by pervanadate. FEBS Lett 2000; 467:61–64.
20. Conklin DS, Galaktionov K, Bearch D. 14-3-3 proteins associate with cdc25 phosphatases. Proc Natl Acad Sci U S A 1995; 92:7892–7896.
21. Yaffe MB. How do 14-3-3 protein work?–Gatekeeper phosphorylation and the molecular anvil hypothesis. FEBS Lett 2002; 513:53–57.
22. Zha J, Harada H, Yang E, Jockel J, Korsmeyer SJ. Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-XL. Cell 1996; 87:619–628.
23. Nomura M, Shimizu S, Sugiyama T, Narita M, Ito T, Matsuda H, et al. 14-3-3 Interacts directly with and negatively regulates pro-apoptotic Bax. J Biol Chem 2003; 278:2058–2065.
24. Muslin AJ, Tanner JW, Allen PM, Shaw AS. Interaction of 14-3-3 with signaling proteins is mediated by the recognition of phosphoserine. Cell 1996; 84:889–897.
25. Yaffe MB, Rittinger K, Volinia S, Caron PR, Aitken A, Leffers H, et al. The structural basis for 14-3-3:phosphopeptide binding specificity. Cell 1997; 91:961–971.
26. Boston PF, Jackson P, Thompson RJ. Human 14-3-3 protein:radioimmunoassay, tissue distribution, and cerebrospinal fluid levels in patients with neurological disorders. J Neurochem 1982; 38:1475–1482.
27. Berg D, Holzmann C, Riess O. 14-3-3 Proteins in the nervous system. Nat Rev Neurosci 2003; 4:752–762.
28. Hsich G, Kenney K, Gibbs CJ, Lee KH, Harrington MG. The 14-3-3 brain protein in cerebrospinal fluid as a marker for transmissible spongiform encephalopathies. N Engl J Med 1996; 335:24–30.
29. Zerr I, Bodemer M, Gefeller O, Otto M, Poser S, Wiltfang J, et al. Detection of 14-3-3 protein in the cerebrospinal fluid supports the diagnosis of Creutzfeldt–Jakob disease. Ann Neurol 2000; 43:683–684.
30. Brandel JP, Delasnerie-Laupretre N, Laplanche JL, Hauw JJ, Alperovitch A. A diagnosis of Creutzfeldt–Jakob disease:effect of clinical criteria on incidence estimates. Neurology 2000; 54:1095–1099.
31. Shiga Y, Wakabayashi H, Miyazawa K, Kido H, Itoyama Y. 14-3-3 protein levels and isoform patterns in the cerebrospinal fluid of Creutzfeldt–Jakob disease patients in the progressive and terminal stages. J Clin Neurosci 2006; 13:661–665.
32. Wakabayashi H, Yano M, Tachikawa N, Oka S, Maeda M, Kido H. Increased concentration of 14-3-3ε, γ and ζ isoforms in cerebrospinal fluid of AIDS patients with neuronal destruction. Clin Chim Acta 2001; 312:97–105.
33. Namikawa K, Su Q, Kiryu-Seo S, Kiyama H. Enhanced expression of 14-3-3 family members in injured motoneurons. Mol Brain Res 1998; 55:315–320.
34. Satoh JI, Tabunoki H, Nanri Y, Arima K, Yamamura T. Human astrocytes express 14-3-3 sigma in response to oxidative and DNA-damaging stresses. Neurosci Res 2006; 56:61–72.
35. Huang MB, Hunter M, Bond VC. Effect of extracellular human immunodeficiency virus type 1 glycoprotein 120 on primary human vascular endothelial cell cultures. AIDS Res Hum Retroviruses 1999; 15:1265–1277.
36. Report of a Working Group of the American Academy of Neurology AIDS Task Force. Nomenclature and research case definitions for neurologic manifestations of human immunodeficiency virus-type 1 (HIV-1) infection. Neurology 1991; 41:778–785.
37. Shimizu S, Eguchi Y, Kamiike W, Itoh Y, Hasegawa J, Yamabe K, et al. Induction pf apoptosis as well as necrosis by hypoxia and predominant prevention of apoptosis by Bcl-2 and Bcl-XL. Cancer Res 1996; 56:2161–2166.
38. Bjorndal A, Deng H, Jansson M, Fiore JR, Colognesi C, Karlsson A, et al. Coreceptor usage of primary human immunodeficiency virus type 1 isolates varies according to biological phenotype. J Virol 1997; 71:7478–7487.
39. Bazan HA, Alkhatib G, Broder CC, Berger EA. Patterns of CCR5, CXCR4, and CCR3 usage by envelope glycoproteins from human immunodeficiency virus type 1 primary isolates. J Virol 1998; 72:4485–4491.
40. Xu Y, Kulkosky J, Acheampoing E, Nunnari G, Sullivan J, Pomerantz RJ. HIV-1-mediated apoptosis of neuronal cells: Proximal molecular mechanisms of HIV-1-induced encephalopathy. Proc Natl Acad Sci U S A 2004; 101:7070–7075.
41. Datta SR, Brunet A, Greenberg ME. Cellular survival:a play in three Akts. Genes Dev 1999; 13:2905–2927.
42. Helke KL, Queen SE, Tarwater PM, Turchan-Cholewo J, Nath A, Zink C, et al. 14-3-3 proteins in CSF:an early predictor of SIV CNS disease. J Neuropathol Exp Neurol 2005; 64:202–208.
43. Jones MV, Bell JE, Nath A. Immunolocalization of HIV envelope gp120 in HIV encephalitis with dementia. AIDS 2000; 14:2709–2713.
44. Buzy J, Brenneman DE, Pert CB, Martin A, Salazar A, Ruff MR. Protein gp120-like neurotoxic activity in the cerebrospinal fluid of HIV-infected individuals is blocked peptide T. Brain Res 1992; 598:10–18.
45. Roberts MR, Salinas J, Collinge DB. 14-3-3 proteins and the response to abiotic and biotic stress. Plant Mol Biol 2002; 1031:1031–1039.
46. Bae S, Xiao Y, Li G, Casiano CA, Zhang L. Effect of maternal chronic hypoxic exposure during gestation on apoptosis in fetal rat heart. Am J Physiol Heart Circ Physiol 2003; 285:H983–H990.
47. Yano M, Nakamuta S, Wu X, Okumura Y, Kido H. A novel function of 14-3-3 protein: 14-3-3ζ is a heat shock-related molecular chaperone that dissolves thermal-aggregated proteins. Mol Biol Cell 2006; 17:4769–4779.
48. Kapasi AA, Fan S, Singhal PC. Role of 14-3-3ε, c-Myc/Max, and Akt phosphorylation in HIV-1 gp120-induced mesangial cell proliferation. Am J Physiol Renal Physiol 2001; 280:F333–F342.
49. Shimamura A, Ballif BA, Richard SA, Blenis J. Rsk1 mediates a MEK-MAP kinase cell survival signal. Curr Biol 2000; 10:127–135.
50. Harada H, Becknell B, Wilm M, Mann M, Huang LJ, Taylor SS, et al. Phosphorylation and inactivation of BAD by mitochondria-anchored protein kinase A. Mol Cell 1999; 3:413–422.
51. Wolf D, Witte V, Laffert B, Blume K, Stromer E, Trapp S, et al. HIV-1 Nef associated PAK and PI3-kinases stimulate Akt-independent Bad-phosphorylation to induce anti-apoptotic signals. Nat Med 2001; 7:1181–1182.
52. Wang H, Pathan GN, Ethell LM, Krajewski S, Yamaguchi Y, Shibasaki F, et al. Ca2+-induced apoptosis through calcineurin dephosphorylation of BAD. Science 1999; 284:339–343.
53. Sasaki M, Miyazaki K, Koga Y, Kimura G, Nomoto K, Yoshida H. Calcineurin-dependent mitochondrial disturbances in calcium-induced apoptosis of human immunodeficiency virus gp160-expressing CD4+ cells. J Virol 2002; 76:416–420.
Keywords:

HIV-1-associated dementia; endothelial cell apoptosis; Bcl associated death promoter; 14-3-3 proteins

© 2007 Lippincott Williams & Wilkins, Inc.