Secondary Logo

Journal Logo

RESEARCH LETTERS

A point mutation in CD45 may be associated with an increased risk of HIV-1 infection

Tchilian, Elma Z.a; Wallace, Diana L.a; Dawes, Ritua; Imami, Nesrinab; Burton, Catherineb; Gotch, Francesb; Beverley, Peter C. L.a

Author Information
  • Free

The CD45 antigen is essential for normal antigen receptor-mediated signalling in lymphocytes, and different patterns of splicing of CD45 are associated with distinct functions in lymphocytes. Here we show that abnormal CD45 splicing caused by a C77G transversion in exon A of the gene encoding CD45 (PTPRC) is associated with increased susceptibility to HIV-1 infection.

The CD45 antigen is essential for lymphocyte antigen receptor signal transduction, as was shown in CD45-deficient mice [1,2] and humans lacking CD45 expression [3,4]. Multiple CD45 isoforms can be generated by the alternative splicing of exons 4, 5, and 6 of the extracellular domain. In humans, naive T cells express high molecular weight CD45 isoforms, recognized by CD45RA monoclonal antibodies (mAb), but activation of the cells results in a change to expression of low molecular weight isoforms, detected by a CD45RO mAb. Abnormal CD45 splicing, caused by a point mutation in the fourth or A exon of the gene encoding CD45, a C to G transversion at position 77 (C77G), has been recognized in humans [5,6]. In affected individuals, activated or memory lymphocytes continue to express both high and low molecular weight CD45 isoforms in contrast to the normal pattern of low molecular weight isoform expression. Recently, an association was described [7] between exon A (C77G) mutation and abnormal CD45 splicing with the development of multiple sclerosis within some families. Furthermore, two families with a similar defect in CD45 splicing associated with haemophagocytic lymphohistiocytosis and erythrocytic haemophagocytosis have been described [8,9].

We have investigated the pattern of CD45 expression in HIV infection. Using polymerase chain reaction (PCR) and Msp I digestion analysis (Fig. 1a) we identified 11 individuals with the exon A (C77G) mutation out of 197 HIV-1 patients (5.6%) and four out of 236 healthy donors (1.7%). The presence of the CD45 exon A mutant allele was also confirmed by sequencing and flow cytometric analysis on the C77G-positive samples, which showed the typical abnormal CD45 pattern of splicing characterized by the continuous expression of CD45RA isoforms on activated T cells (Fig. 1b). Using a two-tailed Fisher's exact test to test for the association between C77G mutation and HIV-1 infection, a statistically significant association was demonstrated (P = 0.03).

Fig. 1.
Fig. 1.:
Expression of CD45 isoforms in HIV-1 patients and healthy individualsa. (a) The detection of exon A (C77G) was performed on genomic DNA amplified by polymerase chain reaction using forward (5'–GACTACAGCAAAG ATGCCCAGTG–3') and reverse primers (5'–GGGATACTTGGGTGGAAGTA–3'). The C77G transition introduces a new restriction site for Msp I, which cleaves the mutant polymerase chain reaction product into two fragments of 72 and 83 base pairs (bp) (lane 2). The presence of an undigested band of 155 bp indicates the presence of the wild-type allele. (b) Flow cytometric analysis of variant CD45RA splicing. Peripheral blood mononuclear cells were stimulated with phytohaemagglutinin and on days 0 and 10 were stained with isoform-specific CD45RO-phycoerythrin and CD45RA-fluorescein isothiocyanate together with CD3-activated protein C antibodies. Analysis was performed on gated CD3 T cells. The normal pattern of CD45 splicing is characterized by a loss of CD45RA and a gain in the expression of CD45RO associated with the activated/memory function (A and B). Variant CD45 splicing can be identified by the absence of the single CD45RO+ population, and even after 10 days of stimulation the T cells remain CD45RA/RO double positive (C and D). aGenomic DNA samples and cryopreserved peripheral blood mononuclear cells were obtained from 182 HIV-1-infected patients enrolled at the St Stephen's Clinic, Chelsea and Westminster Hospital, London, UK, as a part of a functional immunological study. An additional 15 DNA samples, from individuals identified as HIV-1 infected at seroconversion, were supplied by Dr P. Borrow. Ethical approval was obtained and the patients gave written consent. The control group consisted of 236 healthy volunteer blood donors, obtained through the local blood bank of the UK National Blood Transfusion Service.

These results clearly indicate that exon A (C77G) transversion and abnormal CD45 splicing are associated with HIV-1 infection. Although the exact function of individual CD45 isoforms remains unknown, the expression of different isoforms does alter T cell receptor-mediated signal transduction. Studies with transgenic mice [10] supported the theory that the expression of only a high molecular weight isoform compromises immune function, and such mice cannot generate any cytotoxic T cell responses or neutralizing antibodies after viral infection. Furthermore, recent data demonstrated that CD45 can dephosphorylate the Janus kinases, which downregulate the cytokine and interferon receptor activation involved in the differentiation, proliferation and antiviral immunity of haemopoietic cells [11]. Although thorough functional studies have not been performed on (C77G) heterozygous individuals, by analogy with transgenic mice, it is likely that abnormal CD45 splicing is associated with immunodeficiency [8,9], autoimmunity [7], or a higher risk of infection with some organisms, as reported here.

The frequency of the C77G mutation in multiple sclerosis patients (6.4%) is similar to the frequency of 5.6% observed by us in HIV-1-infected individuals. However, the frequency of the C77G transversion in different normal populations is less clear. We analysed 236 healthy blood donors from the UK and found a frequency of 1.7% compared with 1% or less in healthy donors in Germany [7]. In north America the frequency of C77G has been shown to be higher (3.6%); however, that study was performed on patients attending the Mayo Clinic [7]. It is therefore not yet clear whether the apparent differences are associated with an ethnic variation in frequency or the health status of the populations tested. In any event, some CD45 polymorphisms appear to be associated with increased susceptibility to certain diseases. These associations and the immune function of individuals with CD45 polymorphisms warrant further study.

Acknowledgements

The authors would like to thank Drs Derek Macallan, Persephone Borrow and Nicola Jones for help with donor and patient samples. They also wish to thank staff and patients at St Stephen's Clinic, Chelsea and Westminster Hospital, London, UK.

Elma Z. Tchiliana

Diana L. Wallacea

Ritu Dawesa

Nesrina Imamib

Catherine Burtonb

Frances Gotchb

Peter C. L. Beverleya

References

1. Kishihara K, Penninger J, Wallace VA. et al. Normal B lymphocyte development but impaired T cell maturation in CD45-exon 6 protein tyrosine phosphatase deficient mice. Cell 1993, 74: 143–156.
2. Byth KF, Conroy LA, Howlett S. et al. CD45-null transgenic mice reveal a positive regulatory role for CD45 in early thymocyte development, in the selection of CD4+CD8+ thymocytes and in B cell maturation. J Exp Med 1996, 183: 1707–1718.
3. Kung C, Pingel JT, Hekinhemo M. et al. Mutations in the tyrosine phosphatase CD45 gene in a child with severe combined immunodeficiency disease. Nat Med 2000, 6: 343–345.
4. Tchilian EZ, Wallace DL, Wells RS, Flower DR, Morgan G, Beverley PCL. A deletion in the gene encoding the CD45 antigen in a patient with severe combined immunodeficiency. J Immunol 2001, 166: 1308–1313.
5. Thude H, Hundrieser J, Wonigeit K, Schwinzer R. A point mutation in the human CD45 gene associated with defective splicing of exon A. Eur J Immunol 1995, 25: 2101–2106.
6. Zilch CF, Walker AM, Timon M, Goff LK, Wallace DL, Beverley PCL. A point mutation within CD45 exon A is the cause of variant CD45RA splicing in human. Eur J Immunol 1998, 28: 22–29.
7. Jacobsen M, Schweer D, Ziegler A. et al. A point mutation in PTPRC is associated with the development of multiple sclerosis. Nat Genet 2000, 26: 495–499.
8. Wagner R, Morgan G, Strobel S. A prospective study of CD45 isoform expression in haemophagocytic lymphohistiocytosis; an abnormal inherited immunophenotype in one family. Clin Exp Immunol 1995, 99: 216–219.
9. Bujan W, Schandene L, Ferster A, De Valck C, Goldman M, Sariban E. Abnormal T cell phenotype in familial erythrophagocytic lymphohistiocytosis. Lancet 1993, 342: 1296.1296.
10. Kozieradzki I, Kundig T, Kishihara K. et al. T cell development in mice expressing splice variants of the protein tyrosine phosphatase CD45. J Immunol 1997, 158: 3130–3139.
11. Irie-Sasaki J, Sasaki T, Matsumoto W. et al. CD45 is a JAK phosphatase and negatively regulates cytokine receptor signalling. Nature 2001, 409: 349–354.
© 2001 Lippincott Williams & Wilkins, Inc.