Neutrophil Depletion Attenuates Acute Liver Stress after Exhaustive Exercise in Mice

Abstract

Purpose 

Exhaustive exercise induces acute liver stress; however, the precise mechanisms remain unclear.

Methods 

We investigated the effects of neutrophil depletion in male C57BL/6J mice. Male C57BL/6J mice were divided into four groups: sedentary with control antibody (n = 20), sedentary with antineutrophil antibody (n = 20), exhaustive exercise with control antibody (n = 20), and exhaustive exercise with antineutrophil antibody (n = 20). Antineutrophil antibodies (1A8) or control antibodies were administered intraperitoneally before running on a treadmill. Immediately and at 24 h after running to exhaustion on a treadmill at a 7% gradient and a speed of 24 m·min⁻¹, blood neutrophil counts were measured by flow cytometry. Plasma activities of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were also measured. Hematoxylin–eosin staining was performed to calculate the liver stress score, and hepatic tumor necrosis factor-α was measured using enzyme-linked immunosorbent assay.

Results 

Exercise increased blood neutrophil and neutrophil infiltration into the liver. Plasma AST and ALT activities were significantly higher immediately after exhaustive exercise than after sedentary control (AST, sedentary with control antibody: 52.2 ± 0.4, exhaustive exercise with control antibody: 210.0 ± 19.8; ALT, sedentary with control antibody: 29.8 ± 2.2, exhaustive exercise with control antibody: 87.2 ± 15.8). However, AST and ALT activities were significantly decreased with the 1A8 antibody (AST, 102.2 ± 12.9; ALT, 39.2 ± 4.0). In addition, the liver stress score increased after exercise but was significantly reduced by prior 1A8 antibody administration. The 1A8 antibody treatment also decreased hepatic tumor necrosis factor-α levels after exhaustive exercise.

Conclusions 

These results suggested that neutrophils play a critical role in increasing liver stress by regulating inflammation.

Moderate exercise is effective for maintaining or promoting health (¹), whereas prolonged exercise induces increased concentrations and/or activities of biomarkers that reflect physiological stress in the skeletal muscle, kidney, liver, and other tissues (^2–4). The liver may be susceptible to intensive exercise because of sustained energy depletion and metabolic disturbance (⁵). Fojt et al. (⁶) were the first to show that blood aspartate aminotransferase (AST) and alanine aminotransferase (ALT), which are biomarkers of liver stress, increase after exercise. Our group also reported that prolonged exercise in humans increases AST and ALT activities in blood (⁷). These results suggest that the liver is stressed by exercise.

To elucidate the precise mechanisms of acute liver stress after intense exercise, additional investigations are required. In animal models, treadmill running has been used in mice and rats. Acute liver damage was reported to occur 24 h after exhaustive exercise in rats (⁸). In an animal model, exhaustive exercise increased the activities of AST and ALT in plasma (^9,10). In addition, Gao et al. (¹¹) have shown that exhaustive exercise causes histological liver damage, including tissue destruction and erythrocyte influx. However, the precise mechanisms underlying liver stress after exhaustive exercise have not been fully elucidated.

Various experimental models of acute liver injury have demonstrated infiltration by inflammatory cells including neutrophils and macrophages (^12,13). Inflammatory cells are involved in the release of inflammatory cytokines (e.g., tumor necrosis factor (TNF)-α, interleukin (IL)-6, and IL-1β (¹⁴), and the production of reactive oxygen species (ROS) (¹⁵). The damaging effects of inflammation and ROS on the liver suggest that inflammatory cells may play an important role in the mechanisms underlying exercise-related liver stress. For example, neutrophil depletion with anti-GR1 antibodies has been shown to ameliorate liver injury (¹⁶). Hamada et al. (¹⁷) also showed that inhibition of neutrophil infiltration using MMP-9−/− mice and mice treated with MMP-9–blocking antibodies reduced liver injury induced by ischemia/reperfusion and decreased the production of inflammatory cytokines such as TNF-α and IL-6. However, the specific mechanisms underlying neutrophil-mediated liver stress during exercise are currently unknown and warrant further investigation.

In a previous study, we reported that the number of neutrophils in blood is increased after prolonged exercise (¹⁸). Such neutrophils show a leftward shift of the nucleus (¹⁸) and high CD62L expression (¹⁹), indicating that these cells are derived from the bone marrow reserve. In addition, the plasma levels of neutrophil-derived granular enzymes increase with exercise (¹⁸), suggesting that exercise activates neutrophils and causes degranulation. However, few data are available regarding the possible relationship between altered neutrophil receptor expression, function, and exhaustive exercise-induced tissue damage, including liver stress. Identifying the mechanisms of liver stress could help guide novel preventive and therapeutic strategies for athletes undergoing intense training. In the present study, we aimed to test the hypothesis that increased neutrophil infiltration and activation after exhaustive exercise induces liver stress and inflammation. This hypothesis was tested by investigating the effects of neutrophil depletion through antineutrophil antibody injection on liver stress and inflammation after exhaustive exercise.

METHODS

Animals

Male C57BL/6J mice were purchased from Kiwa Laboratory Animals (Wakayama, Japan) at 10 wk of age and were housed with four mice per cage in a controlled environment under a light/dark cycle (lights on at 9:00 am and off at 11 pm). The experimental procedures complied with the Guiding Principles for the Care and Use of Animals at Waseda University and were approved by the Institutional Animal Care and Use Committee of the university (2013-A110). Mice were randomly assigned to four groups: sedentary with control antibody (n = 20), sedentary with antineutrophil antibody (n = 20), exhaustive exercise with control antibody (n = 20), and exhaustive exercise with antineutrophil antibody (n = 20). All mice had free access to standard chow and water.

Injection of neutrophil antibody

A neutrophil-specific antibody, anti–Ly-6G (clone 1A8), and an isotype control antibody (clone 2A3) were purchased from Bio X Cell (Sunnyvale, CA). The 1A8 (0.5 μg) and 2A3 (0.5 μg) antibodies were individually diluted in phosphate-buffered saline, and the mice were administered 150 μL of either antibody solution intraperitoneally, according to their respective experimental groups.

Exercise protocol

Mice in the sedentary groups remained under resting conditions in the cage, whereas mice in the exercise groups were subjected to exhaustive exercise 48 h after injection. One week before exhaustive exercise, the mice in all groups were familiarized with running on a motorized treadmill (Natsume, Tokyo, Japan). On the day of the experiment, the mice were forced via a shock grid to run on a treadmill with a 7% gradient at a speed of 10 m·min⁻¹ for 15 min, followed by 15 m·min⁻¹ for 15 min, 20 m·min⁻¹ for 15 min each, and finally 24 m·min⁻¹ until exhaustion. Exhaustion was defined as the point at which the mice refused to run despite touching the shock grid five times.

Blood, liver, and leukocyte from bone marrow sampling

Ten animals from each group were sacrificed immediately after exhaustive exercise, and 10 at 24 h after exhaustive exercise. Anesthesia was induced with 2% isoflurane inhalation at 0.8 L·min⁻¹, maintained at 1% at 0.8 L·min⁻¹. Blood samples were collected from the abdominal aorta using a 1-mL syringe mounted with a 20-gauge needle and coated with heparin (5000 UI·mL⁻¹; Nipro, Osaka, Japan). Blood samples were transferred to a tube coated with heparin and centrifuged at 2600g for 10 min, then plasma was stored at −80°C until analysis.

The liver tissues were snap-frozen by immersing the samples in liquid nitrogen and stored at −80°C until analysis.

We isolated leukocytes from the bone marrow using previously described methods with some modifications (²⁰). Femurs and tibiae were removed, and bone marrow was harvested by flushing with Hanks’ balanced salt solution without Ca²⁺/Mg²⁺, 30 mM HEPES, and 15 mM EDTA. A single-cell suspension was created by passing the suspension through a 21-gauge needle. The cells were centrifuged at 1200 rpm for 5 min at room temperature. The resultant pellet containing leukocytes was suspended in 5 mL of red blood cell lysis buffer (Sigma-Aldrich, St. Louis, MO) and centrifuged at 1200 rpm for 5 min at room temperature. Cells were resuspended in Versa Lyse (Beckman Coulter, Miami, FL).

Fluorescence-activated cell sorting

Whole blood (25 μL) was added to polypropylene tubes and incubated for 20 min at room temperature with mouse antimouse monoclonal antibodies against the following cell surface antigens: PE-Cy5.5-Ly-6G (eBioscience, San Diego, CA), PE-Cy7-CD11b (eBioscience), FITC-CD62L (eBioscience), and PE CD107a (eBioscience). Leukocytes from the bone marrow (2.5 × 10⁵ cells) were incubated with PE-Cy5.5-Ly-6G (eBioscience) and PE-Cy7-CD11b (eBioscience) for 20 min. After this initial incubation, 600 μL of Versa Lyse was added, and the samples were vortexed then incubated for another 10 min. Finally, the tubes were centrifuged for 5 min at 500g before the supernatant was removed, and the cell pellet was resuspended in 350 μL of Versa Lyse. Flow cytometry was performed using Guava® EasyCyteTM 6HT and InCyte software (Millipore, Long Beach, CA). Leukocytes were gated according to side scatter and forward scatter plots. Neutrophils were gated according to Ly-6G+ and CD11b+ on side scatter and forward scatter plots. The blood neutrophil count was calculated by multiplying the blood white blood cell count, measured using an automatic blood cell counter (PocH100i; Sysmex, Kobe, Japan), by the percentage of neutrophils. The geometric mean of fluorescence intensity (MFI) of CD62L and CD107a antibodies in the Ly-6G+ and CD11b+ gated cell populations was calculated to quantify cell surface expression by neutrophils (5000 cells acquired for each sample). Unstained and single-color controls for each antibody were used for compensation. Validation of this flow cytometric approach for the identification of total CD11b+ Ly-6G+ neutrophils is shown in Supplemental Figure 1 (Supplemental Digital Content, https://links.lww.com/MSS/C748).

Assessment of liver function

The plasma AST and ALT activities were measured using a standard commercial assay (L-type ALT.J2, L-type AST; Wako Pure Chemical Industries, Osaka, Japan). The analysis was performed using a Hitachi 7180 automated multiparametric analyzer (Hitachi, Tokyo, Japan) by Oriental Yeast Co., Ltd. (Tokyo, Japan). All analyses were performed as a single unit.

Histological analysis

A piece of the liver tissue was transferred to a plastic mold, covered with Optimal Cutting Temperature compound, and snap frozen by immersing it in precooled isopentane at −80°C. Hematoxylin–eosin (H&E) and Masson’s trichrome staining were performed. The severity of liver stress observed in the tissue sections was scored as follows: 0, no evidence or minimal evidence of stress; 1, mild stress consisting of cytoplasmic vacuolation and focal nuclear pyknosis; 2, moderate-to-severe stress with extensive nuclear pyknosis, cytoplasmic hypereosinophilia, and loss of intercellular borders; and 3, severe necrosis with disintegration of the hepatic cords, hemorrhage, and neutrophil infiltration (²¹).

Immunohistochemical staining was applied to frozen sections of liver tissue to examine the expression of Ly-6G and F4/80. The 5-μm serial sections were incubated in 4% paraformaldehyde for 7 min at 4°C. Endogenous peroxidase was inactivated using 1% hydrogen peroxide in methanol for 30 min at 4°C. Ly-6G (ab25377; Abcam, London, United Kingdom) and F4/80 (ab16911; Abcam) primary antibodies were added to a 1% bovine serum albumin solution, and the sections were incubated overnight at 4°C. Secondary antirat or mouse antibodies were added to the phosphate-buffered saline buffer with normal mouse serum for 30 min at room temperature. Proteins were visualized using the Vectastain Elite ABC Kit (Vector, Burlingame, CA) for 30 min at room temperature, and further incubation was performed with diaminobenzidine chromogen. Ly-6G– and F4/80-positive cells were counted on four random high-power (200×) fields/slide using BZ-2 software (KEYNENCE, Osaka, Japan).

The liver stress scores and counts of the Ly-6G– and F4/80-positive cells were determined by three independent observers who were blinded to the diagnoses, and the average value for each section was calculated.

Hepatic TNF-α measurement

To examine TNF-α protein levels in the livers of mice, liver tissue (100 mg) was homogenized in 500 μL tissue protein extraction reagent with a protease inhibitor (Thermo, Rockford, IL). The protein concentration was measured using the BCA Protein Assay (Thermo Fisher Scientific, Waltham, MA). Hepatic TNF-α levels were measured using the Mouse TNF-α Quantikine enzyme-linked immunosorbent assay kit (R&D Systems, Minneapolis, MN). Optical density was analyzed using a SpectraMax 190 microplate reader (Molecular Devices LLC., San Jose, CA).

Quantitative reverse transcription-polymerase chain reaction

Total RNA was extracted from the liver using an RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. The purity of total RNA was assessed using the NanoDrop system (NanoDrop Technologies, Wilmington, DE), and samples with A260/A280 ratios between 1.9 and 2.1 were used for analysis. Total RNA was reverse-transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA). Quantitative reverse transcription-polymerase chain reaction was performed with the Fast 7500 real-time polymerase chain reaction (PCR) system (Applied Biosystems) using 10 ng of cDNA and the Fast SYBR Green PCR Master Mix (Applied Biosystems). The thermal profile consisted of denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 3 s, and annealing at 60°C for 15 s. 18S ribosomal RNA was used as the housekeeping control, and all data were normalized by the expression of 18S ribosomal RNA using the 2^−ΔΔCT method. The data are expressed as the number of fold changes relative to the values of the sedentary group with the control antibody. The specific PCR primer pairs used for each gene are listed in Table 1. The primers used in this study have been used in previous studies (^22–27).

TABLE 1 - Primer sequences for RT-PCR analysis.

Gene	Forward	Reverse
18s ribosomal RNA	CGGCTACCACATCCAAGGA	AGCTGGAATTACCGCGGC
Ly-6G	TGGACTCTCACAGAAGCAAAG	GCAGAGGTCTTCCTTCCAACA
TNF-α	TCTTCTCATTCCTGCTTGTGG	GAGGCCATTTGGGAACTTCT
IL-6	AACGATGATGCACTTGCAGA	TGGTACTCCAGAAGACCAGAGG
IL-1β	GGGCCTCAAAGGAAAGAATC	TTGCTTGGGATCCACACTCT
F4/80	CTTTGGCTATGGGCTTCCAGTC	GCAAGGAGGACAGAG-TTTATCGTG
MCP-1	CTTCTGGGCCTGCTGTTCA	CCAGCCTACTCATTGGGATCA

RT-PCR, reverse transcription-polymerase chain reaction.

Detection of ROS

NADPH oxidase activity was measured using a lucigenin assay. Mouse liver tissues were homogenized in 50 mM phosphate buffer (pH 7.0) containing 150 mM sucrose, 1 mM EDTA, and a protease inhibitor cocktail (Sigma-Aldrich). Protein concentrations were measured using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). The reaction was initiated by adding the homogenates (10 μg of protein) to an assay solution containing lucigenin (5 μM) and NADPH (100 μM), and photon emissions were measured for 3 min in a luminometer chamber (Multilabel Reader 2030 ARVO X4; PerkinElmer, Waltham, MA).

Liver tissue O₂⁻ generation was detected by Dihydroethidium (DHE, Beyotime, China) following the specification guide book.

Statistical analyses

All data are presented as mean ± SEM. All statistical analyses were performed using SAS software version 9.4. To evaluate the statistical significance of exhaustive exercise and antineutrophil antibody treatment, the data were analyzed using two-way repeated-measures ANOVA or two-way ANOVA. If significant interactions were observed, further comparisons were performed using Tukey’s HSD post-hoc test. The level of significance was set at P < 0.05.

RESULTS

Running time

The mean running time until the mice became exhausted was 320.3 ± 50.2 min in the control antibody group and 331.4 ± 46.0 min in the 1A8 antibody group; these values were not statistically different.

Neutrophil mobilization

To identify the effects of 1A8 antibody treatment on exhaustive exercise-induced neutrophil mobilization, we examined neutrophils in blood and bone marrow. Blood neutrophil levels were significantly higher immediately after exhaustive exercise than those in the sedentary control group. However, they decreased with antineutrophil antibody treatment. An exercise-induced increase in blood neutrophil levels was observed even 24 h after exercise (Fig. 1A). The percentage of neutrophils in the bone marrow significantly decreased immediately after exhaustive exercise. In addition, these levels were lowered by the 1A8 antibody. However, 24 h after exhaustive exercise, the percentage of neutrophils in the bone marrow did not differ among the groups (Fig. 1B).

FIGURE 1: Effects of exhaustive running exercise and 1A8 antibody on neutrophil mobilization. A, Blood neutrophils immediately and 24 h after exhaustive exercise. B, Percentage of neutriohils in bone marrow immediately and 24 h after exhaustive exercise. Values represent means ± SEM. Analyses were performed using two-way repeated-measures ANOVA. *P < 0.05, †P < 0.1.

Blood neutrophil surface receptor expression

The effect of exhaustive exercise on neutrophil surface receptor expression was assessed using CD11b, CD62L, and CD107a. CD11b MFI in neutrophils increased immediately after exhaustive exercise. However, there was no significant effect after 24 h of exhaustive exercise (Table 2). CD62L-positive neutrophils in the blood increased after exhaustive exercise and decreased after the 1A8 antibody administration. This result was observed not only immediately after exercise but also at 24 h later. Regrettably, there were significant differences in each measure of CD62L in the sedentary group (Table 2). In addition, CD107a MFI, which is a marker of degranulation in neutrophils, was greater immediately after exhaustive exercise. Furthermore, CD107a-positive neutrophils in the blood were significantly higher immediately and 24 h after exercise, and these increases were significantly smaller in the exhaustive exercise with the 1A8 antibody treatment group (Table 2).

TABLE 2 - Effects of exhaustive running exercise and 1A8 antibody on neutrophil receptor expression.

	Time	Sed	Sed + 1A8	Ex	Ex + 1A8
CD11b MFI in neutrophils	0 h after exercise	203.2 ± 18.1	201.2 ± 12.0	254.8 ± 15.0*	215.2 ± 12.6**
	24 h after exercise	197.5 ± 14.9	192.3 ± 9.3	229.8 ± 8.5	187.4 ± 8.7**
CD62L MFI in neutrophils	0 h after exercise	42.9 ± 4.3	41.0 ± 4.0	63.2 ± 8.8*	66.0 ± 6.7
	24 h after exercise	79.8 ± 6.5***	60.8 ± 7.2	62.6 ± 3.3*	53.7 ± 5.9
Percentage of CD62L-positive cells in neutrophils (%)	0 h after exercise	43.0 ± 3.5	37.2 ± 6.8	61.9 ± 7.1*	69.8 ± 4.0
	24 h after exercise	69.6 ± 2.0***	57.3 ± 4.2	59.7 ± 3.4*	57.2 ± 4.2
CD62L-positive neutrophils in blood (102·mL−1)	0 h after exercise	3.4 ± 0.4	1.3 ± 0.3	9.5 ± 1.9*	0.9 ± 0.3**
	24 h after exercise	4.6 ± 0.9***	2.8 ± 0.3	7.6 ± 1.4*	5.3 ± 1.1**
CD107a MFI in neutrophils	0 h after exercise	26.9 ± 1.7	22.3 ± 2.5	34.7 ± 7.0*	23.5 ± 2.5**
	24 h after exercise	26.5 ± 0.4	23.2 ± 0.7	32.7 ± 3.4*	22.1 ± 0.6**
Percentage of CD107a-positive cells in neutrophils (%)	0 h after exercise	87.6 ± 1.8	71.6 ± 1.0*	94.2 ± 5.4*	66.1 ± 7.5**
	24 h after exercise	83.5 ± 2.0	73.3 ± 3.4*	86.0 ± 2.4	68.9 ± 3.7**
CD107a-positive neutrophils in blood (102·mL−1)	0 h after exercise	5.9 ± 0.8	2.5 ± 0.6*	14.5 ± 4.7*	0.7 ± 0.2**
	24 h after exercise	5.5 ± 0.7	3.7 ± 0.4*	10.6 ± 2.0*	6.3 ± 1.2**

Values represent means ± SEM. Analyses were performed using two-way repeated-measures ANOVA.

*P < 0.05 vs sedentary.

**P < 0.05 vs exercise at the same time point.

***P < 0.05 vs sedentary immediately after exercise.

Ex, exercise; MFI, mean fluorescence intensity; Sed, sedentary.

Neutrophil infiltration in the liver

To identify the effect of 1A8 antibody treatment on exhaustive exercise-induced neutrophil infiltration in the liver, we performed immunohistochemical staining and examined the mRNA expression of Ly-6G, which is a specific marker of neutrophils. Ly-6G–positive cells did not differ among groups immediately after exhaustive exercise; however, 24 h after exhaustive exercise, they were significantly higher in exhaustive exercise group than they were in sedentary group. In contrast, these values were significantly lower in the exhaustive exercise with the 1A8 antibody treatment group than they were in the exhaustive exercise group (Fig. 2B). Consistently, although exhaustive exercise increased Ly-6G mRNA in the liver, injection of the 1A8 antibody reduced it after 24 h of exhaustive exercise (Fig. 2C).

FIGURE 2: Effects of exhaustive running exercise and 1A8 antibody on neutrophil infiltration into mouse liver. A, Histochemical analysis of Ly-6G (brown; Ly-6G–positive cells, original magnification ×200). Ly-6G–positive cells are marked by arrows. B, Ly-6G–positive cells, C, Ly-6G mRNA expression in the liver. Values represent means ± SEM. Analyses were performed using two-way repeated-measures ANOVA. *P < 0.05. Ex, exercise; Sed, sedentary.

Liver function

The effects of exhaustive exercise and 1A8 antibody on liver function were assessed based on the plasma activities of AST and ALT immediately after and at 24 h after exercise. AST and ALT activities were significantly higher immediately and at 24 h after exhaustive exercise than they were in sedentary controls. However, they decreased with the 1A8 antibody treatment (Table 3).

TABLE 3 - Effects of exhaustive exercise and 1A8 antibody on plasma activities of AST and ALT.

	Time	Sed	Sed + 1A8	Ex	Ex + 1A8
AST (IU·L−1)	0 h	52.2 ± 4.2	56.0 ± 6.9	210.0 ± 19.8*	102.2 ± 12.9**
	24 h	38.8 ± 1.1***	38.4 ± 1.1	192.8 ± 66.4*	106.2 ± 19.5**
ALT (IU·L−1)	0 h	29.8 ± 2.2	28.4 ± 2.9	87.2 ± 15.8*	39.2 ± 4.0**
	24 h	21.4 ± 0.6***	21.4 ± 0.8	114.6 ± 51.3*	64.0 ± 20.3**

Values represent means ± SEM. Analyses were performed using two-way repeated-measures ANOVA.

*P < 0.05 vs sedentary.

**P < 0.05 vs exercise at the same time point.

***P < 0.05 vs sedentary immediately after exercise.

Ex, exercise; MFI, mean fluorescence intensity; Sed, sedentary.

Liver histology

We performed H&E and Masson’s trichrome staining to reveal liver stress.

Liver stress was scored using H&E staining to assess hepatic stress. The liver stress score, as determined by factors including hemorrhage, cytoplasmic vacuolation, and infiltration of inflammatory cells, was significantly higher in the exhaustive exercise group than that in the sedentary group. Compared with the exhaustive exercise group, the exhaustive exercise with the 1A8 antibody group had significantly lower liver stress scores (Figs. 3A, C).

FIGURE 3: Effects of exhaustive running exercise and 1A8 antibody on liver stress in mice. H&E (A) and Masson’s trichrome (B) staining of liver sections 24 h after exercise (original magnification ×100). C, Liver stress score. Values represent means ± SEM. Analyses were performed using two-way ANOVA for multiple comparisons. *P < 0.05.

Masson’s trichrome staining revealed that the hepatocytes had a normal radial arrangement in the sedentary group. The structures of the nuclei and nucleoli of the hepatocytes were also normal. In the exhaustive exercise group, impairment in the radial arrangement of hepatocytes and cytoplasmic fragmentation was observed. There was a significant decrease in the number of sinusoids, and structural degeneration was observed. Exercise-induced histological changes were reduced in the exhaustive exercise with the 1A8 antibody treatment group (Fig. 3B).

Inflammatory cytokines and ROS in the liver

The effects of exhaustive exercise and neutrophil depletion on inflammatory cytokines and ROS in the liver 24 h after exercise were assessed. Levels of TNF-α, a marker of hepatic inflammation, were increased by exercise but decreased by the 1A8 antibody (Fig. 4A). Changes in the mRNA expression of several cytokines are shown in Figures 4B–D. They were also significantly increased by exhaustive exercise but decreased by administration of the 1A8 antibody. After 24 h of exhaustive exercise, NADPH-oxidase activity and O²⁻ production in the liver were significantly higher in the exhaustive exercise group than they were in the sedentary group. However, these values were significantly lower in the exhaustive exercise with the 1A8 antibody treatment group than they were in the exhaustive exercise group (Figs. 3E, F).

FIGURE 4: Effects of exhaustive running exercise and 1A8 antibody on inflammatory cytokines and ROS in the liver. Hepatic TNF-α protein levels (A), TNF-α (B), IL-6 (C), and IL-1β mRNA expression (D), NADPH-oxidase activity (E), and O₂ ⁻ production in the liver (F). Values represent means ± SEM. Analyses were performed using two-way ANOVA for multiple comparisons. *P < 0.05. Ex, exercise; Sed, sedentary.

Macrophage infiltration in the liver

To identify the effects of 1A8 antibody treatment on exhaustive exercise-induced macrophage infiltration, we examined immunohistochemical staining and mRNA expression of F4/80, which is a specific marker of macrophages. F4/80 immunochemistry staining revealed that exhaustive exercise induced a substantial increase in macrophage infiltration into the liver, but this infiltration was markedly reduced by the injection of the 1A8 antibody (Figs. 5A, B). Likewise, although exhaustive exercise increased the F4/80 mRNA level, injection of the 1A8 antibody reduced it (Fig. 5C). Monocyte chemoattractant protein (MCP)-1 mRNA, which recruits monocytes and macrophages to the sites of inflammation, was increased by exercise but decreased by the 1A8 antibody (Fig. 5D).

FIGURE 5: Effects of exhaustive running exercise and 1A8 antibody on macrophage infiltration into mouse liver. A, Histochemical analysis of F4/80 (original magnification ×200). F4/80-positive cells are marked by arrows. F4/80-positive cells (B), F4/80 (C), and MCP-1 (D) mRNA expression in the liver. Values represent means ± SEM. Analyses were performed using two-way repeated-measures ANOVA. *P < 0.05. Ex, exercise; Sed, sedentary.

DISCUSSION

Although endurance exercise induces acute liver stress (^6–8), the underlying mechanisms are poorly understood. This study attempted to further understand the mechanisms of acute liver stress after exhaustive exercise by measuring blood neutrophil surface molecule expression and investigating the effects of suppressing neutrophil infiltration.

Prolonged exercise increases the number of neutrophils in the blood and activates them (^7,28). Activated neutrophils produce inflammatory cytokines, ROS, and proteases, which promote tissue damage. In this study, we found that the blood neutrophil count increased and the percentage of neutrophils in the bone marrow decreased immediately after exhaustive exercise (Figs. 1A, B). Our results agree with a previous study showing that acute endurance exercise causes marked peripheral neutrophilia, with a significant increase in both the absolute number and relative proportion of band neutrophils, indicating partial recruitment of bone marrow neutrophils (²⁸). CD62L on the surface of leukocytes plays an important role in this leukocyte-endothelial cell interaction. Van Eeden et al. (²⁹) reported that younger neutrophils recruited from the bone marrow express higher levels of CD62L on their surface. The main limitation of this study is that the CD62L MFI and percentage of CD62L-positive cells in neutrophils were significantly different at baseline and 24 h later in the sedentary group. However, it is worth noting that CD62L-positive neutrophils in the blood were significantly increased immediately after exercise, although more detailed studies are needed to clarify this. Furthermore, we previously reported that neutrophils are activated and degranulation is enhanced after endurance exercise (³). In the present study, CD107a, a degranulation maker of neutrophils, was found to have increased expression. The surface expression of CD11b, which facilitates the binding of granulocytes to IgG-like molecules (cell adhesion molecules) on endothelial cells, was found to increase after exercise (³⁰), suggesting that this upregulated CD11b expression may be associated with neutrophil degranulation (³¹). In the present study, we observed an increase in the MFI of CD11b after exhaustive exercise; together with the aforementioned results, this suggests that blood neutrophils are activated after exhaustive exercise. In a previous study, l-selectin–deficient mice were less susceptible to ischemia/reperfusion-induced liver injury than wild-type mice (³²). As discussed previously, an excessive number of neutrophils are recruited and activated after exhaustive exercise. This excessive neutrophil influx might contribute to the pathogenesis of tissue damage, including the liver stress. However, the specific mechanisms underlying neutrophil-mediated acute liver stress after exercise remain unknown. In this study, we used clone 1A8 antibodies of an anti–Ly-6G antibody to deplete neutrophils from tissues with inflammatory cell infiltration and found that injection of the 1A8 antibody before exercise reduced neutrophil infiltration of the liver after exhaustive exercise (Fig. 2). These results demonstrate the efficacy of our 1A8 antibody injection protocol for reducing neutrophil infiltration of the liver after exhaustive exercise.

Inflammatory cells such as neutrophils and macrophages trigger an inflammatory response in the liver by activating the production of inflammatory cytokines and ROS, which can further exacerbate liver stress. Our group previously reported that mRNA expression of inflammatory cytokines increases in the liver after exhaustive exercise (^9,33). Interestingly, preexercise treatment with anti-inflammatory and antioxidant substances was found to lower the plasma activities of AST and ALT after exhaustive exercise (^8,9). Therefore, it is possible that acute liver stress induced by exhaustive exercise is influenced by mediators released from activated neutrophils, including inflammatory cytokines and ROS. In this study, we quantified hepatic TNF-α and mRNA expression of inflammatory cytokines to evaluate the inflammatory response, NADPH-oxidase activity, and O²⁻ production in the liver. The increase in liver stress and inflammation 24 h after exhaustive exercise was reversed by blocking neutrophil infiltration into the liver with a preexercise injection of the 1A8 antibody. Furthermore, NADPH-oxidase activity and O²⁻ production were increased with exercise but were ameliorated with the 1A8 antibody. These results are supported by a previous study in which drug-induced liver injury was significantly reduced in neutrophil-depleted mice (¹⁶), and experiments with NADPH oxidase inhibitors that showed reduced oxidative stress and liver injury (³⁴). Taken together, the results of our study support the notion that neutrophils play an important role in causing liver stress and that neutrophil infiltration into the liver after exhaustive exercise regulates liver stress by activating the inflammatory pathway. These results also suggest that exercise-induced liver stress can be attenuated by blocking neutrophil infiltration.

Macrophages are reported to be involved in acute liver injury in various models (³⁵). This suggests that macrophage infiltration may be the primary cause of acute liver stress. The present study also showed increased macrophage infiltration into the liver after intense exercise. Other studies have shown that macrophages are recruited to various tissues by chemotactic factors such as chemokines (³⁶). MCP-1 belongs to the CC chemokine family; it is expressed in many cell types and predominantly recruits monocytes and macrophages to sites of inflammation. Karlmark et al. (³⁶) reported that in a carbon tetrachloride-treated model, macrophage infiltration was lower in CCR2 knockout mice compared with that in wild-type mice. In addition, carbon tetrachloride–induced acute liver injury was suppressed by CCR2 knockout. These findings are consistent with our observation that exhaustive exercise upregulates MCP-1 mRNA expression and macrophage infiltration in mice. Collectively, the evidence presented indicates that elevated MCP-1 production may be associated with enhanced macrophage infiltration after exhaustive exercise. However, the cellular source underlying chemokine production in the liver is unknown. A few studies have attempted to identify which cells produce chemokines in the liver. Neutrophils are known to release macrophage chemoattractants such as MCP-1 and regulate the infiltration of macrophages into local tissues to induce inflammation (³⁷). This suggests that neutrophils may be a source of liver tissue–derived chemokines and contribute to the infiltration of macrophages into the liver after exhaustive exercise.

One limitation of this study was that it only tested immediately and 24 h after exercise. Recent studies have identified previously unappreciated novel roles of neutrophils in controlling inflammation and resolving tissue injury, in addition to proinflammatory and tissue-destructive functions. Several lines of evidence indicate that neutrophils can limit the inflammatory response of other innate immune cells (³⁸). Further studies are needed to test different time points to elucidate the pathogenesis of acute liver stress induced by exhaustive exercise. Although this study only showed the effects of neutrophils on liver stress, the antineutrophil antibody administration model used in this study has also been reported to attenuate muscle damage caused by exhaustive exercise (³⁹). This suggests that neutrophils mobilized and activated by exhaustive exercise cause tissue damage. More detailed studies on tissue and multicellular interactions are needed in the future.

CONCLUSIONS

In summary, we found that excessive numbers of neutrophils were recruited and activated in the blood and infiltrated the liver after exhaustive exercise. In addition, we demonstrated that neutrophil depletion substantially decreased liver stress, inflammation, and oxidative stress in the liver after exhaustive exercise. These novel findings provide evidence that neutrophils contribute to the mechanisms causing exhaustive exercise-induced liver stress.