Skip Navigation LinksHome > December 2012 - Volume 39 - Issue 12 > Trichomonas vaginalis Prevalence Increases With Remoteness i...
Sexually Transmitted Diseases:
doi: 10.1097/OLQ.0b013e31826ae875
Original Study

Trichomonas vaginalis Prevalence Increases With Remoteness in Rural and Remote New South Wales, Australia

Ryder, Nathan MBBS, MPH&TM*; Woods, Helen BSocSc; McKay, Kate CertIVAHW; Giddings, Nicolla DipAppSc; Lenton, Jo-ann; Little, Christine BSc; Jeoffreys, Neisha PhD; McNulty, Anna M. MMed§¶

Free Access
Article Outline
Collapse Box

Author Information

From the *Sexual Health and Blood Borne Virus Unit, Department of Health, Northern Territory; †HIV and Related Programmes, Far Western and Western New South Wales Local Health Districts; ‡Centre for Infectious Diseases and Microbiology, Institute for Clinical Pathology and Medical Research, Westmead; §Sydney Sexual Health Centre, Sydney Hospital; and ¶School of Public Health and Community Medicine, University of New South Wales, Randwick, New South Wales, Australia.

The authors have no conflicts of interest to declare.

Correspondence: Nathan Ryder, MBBS, MPH&TM, Sexual Health and Blood Borne Virus Unit, PO Box 40623, Casuarina NT 0800, Australia. E-mail: nathan.ryder@nt.gov.au.

Received for publication March 20, 2012, and accepted July 20, 2012.

Collapse Box

Abstract

Background: Trichomonas has been reported to be rare in Australia’s major cities while remaining very common in some extremely remote Aboriginal communities. This study examined the Trichomonas prevalence and relationship to remoteness among patients attending sexual health clinics in rural and remote areas of New South Wales, Australia.

Methods: During the period 2009 to June 2010, all women attending sexual health clinics in the Western and Far Western Local Health Districts of New South Wales who agreed to sexually transmitted infection testing were offered Trichomonas testing using an in-house polymerase chain reaction test. Overall prevalence was calculated, and logistic regression was used to determine association with remoteness of residency.

Results: Of the 506 women attending during the study period, 356 (70%) were tested. Thirty women (8.4%) tested positive to Trichomonas. Trichomonas infection was independently associated with increasing age, being symptomatic, never having had a previous Papanicolaou smear, and remote residency.

Conclusions: The prevalence of Trichomonas was relatively high among women attending sexual health clinics in rural and remote western New South Wales. Trichomonas was more common among women living more remotely, which may reflect population-level health service use. Testing for Trichomonas should be considered for all women requesting testing for sexually transmitted infections in rural and remote Australia.

The reported prevalence of Trichomonas vaginalis in Australia is extremely variable, ranging from virtually zero in Australia’s largest cities1–3 to 25% in remote northern Aboriginal communities.4 However, there are virtually no data from other rural and remote areas and limited data from Aboriginal people living in less remote areas.

The prevalence Trichomonas is consistently higher among older women, women who have never accessed cervical cancer screening and women from marginalized populations such as sex workers, people who inject drugs, prisoners, and ethnic minorities.5 Because Trichomonas appears to have a long natural history, it has been suggested that lower levels of health service accessibility account for the high prevalence in some populations.6 Because remote residency is associated with health service use, we performed this study to determine the prevalence of Trichomonas in rural and remote areas of New South Wales (NSW) and associations with remote residency and Aboriginality.

Back to Top | Article Outline

MATERIALS AND METHODS

The study was performed among clients attending the outreach clinics of public sexual health clinics in rural and remote western NSW, Australia. The sexual health clinics are located in the Western and Far Western Local Health Districts of NSW. These districts cover an area of 348,000 km2 and have a population of 268,000. Aboriginal people make up 9% of the population, compared with 2.5% nationally. All women attending the services are routinely offered testing for chlamydia, gonorrhea, syphilis, and human immunodeficiency virus. On their first visit during the period March 2009 to June 2010, all women who agreed to sexually transmitted infection (STI) testing were offered testing for Trichomonas in addition to the standard tests. For each woman, the following data were retrospectively extracted from the clinic database and the patients’ medical records: postal code of residence, age, Aboriginality, country of birth, self-reported ever injecting recreational drugs, concurrent gonorrhea or chlamydia diagnoses, self-reported ever having had a previous Papanicolaou (Pap) smear, and any current symptoms potentially related to an STI, including but not limited to vulvovaginal symptoms. Remoteness was determined using the Australian government validated Accessibility/Remoteness Index of Australia.7 For analytical purposes, the categories highly accessible and accessible, along with moderately accessible and remote, were combined to form the categories less and more remote, respectively.

Trichomonas testing was performed using a real-time polymerase chain reaction assay targeting a 67–base pair region of a repeated sequence in the T. vaginalis genome (Genbank L23861). DNA was extracted from genital swabs using the NucliSENS easyMAG (BioMerieux, Marcy l’Etoile, France) and combined with Immomix (BioLine, Alexandria, Australia), 500 nM each of primers TVF (5′ CATTGACCACACGGACAAAAAG 3′) and TVR (5′ CGAAGTGCTCGAATGCGA 3′) and 100 nM of probe TVP (5′ (6FAM) TCATTTCGGATGGTCAAGCAGCCA (BHQ1) 3′). Primer and probe sequences have been described previously.8 The reaction mix was amplified in an LC480 real-time thermocycler (Roche Applied Science, Mannheim, Germany) using the following reaction conditions (95°C for 10 minutes; 50 cycles of 95°C for 10 seconds, 54°C for 10 seconds, and 72°C for 10 seconds; and 40°C for 30 seconds).

Chlamydia trachomatis and Neisseria gonorrhoeae tests were performed using a commercial duplex real-time polymerase chain reaction assay on the Abbott m2000 RealTime System (Abbott Molecular Inc., Des Plaines, IL). Syphilis samples were screened using the Architect Syphilis TP assay on the Abbott Architect i2000 SR analyser (Abbott Diagnostics, Abbott Park, IL).

Data were analyzed using STATA version 10 (StataCorp, College Station, TX). Pearson χ2 tests were used to compare proportions, and 95% confidence intervals (CIs) were calculated using the exact binomial method. Multivariate analysis of variables associated with Trichomonas infection was performed using logistic regression with backward stepwise elimination of potential confounders identified from the literature. The final logistic regression model retained age, symptoms, Aboriginality, previous Pap smear, and remote residency.

The study was approved by the human research ethics committees of the South Eastern Sydney Illawarra and the Greater Western Area Health Services, along with the NSW Aboriginal Health and Medical Research Council.

Back to Top | Article Outline

RESULTS

Of the 506 eligible women who attended the clinics during the period, 356 (70%) were tested and included in the study. The median age of women was 23 years, 182 (51%) women were aboriginal, and 130 (37%) lived in more remote areas. The overwhelming majority of women, 347 (97%), were Australian born, 73 (20%) had ever previously injected recreational drugs, 241 (68%) reported having had a Pap smear in the past, and 169 (47%) were symptomatic (Table 1). Chlamydia was diagnosed in 37 women (10%); however, no women were diagnosed with gonorrhea or syphilis. Although there was a reasonable distribution of both Aboriginal and non-Aboriginal women in both more and less remote areas, women living in remote areas were significantly more likely to be Aboriginal (100 [77%] vs. 82 [36%], P < 0.001) and less likely to be symptomatic (37 [29%] vs. 132 [58%], P < 0.001).

Table 1
Table 1
Image Tools

Overall, 30 women (8.4%; 95% CI, 5.9%–11.7%) tested positive for Trichomonas. On univariate analysis Trichomonas was more likely in Aboriginal women, women living in more remote areas, and women who reported never having had a Pap smear before.

After multivariate analysis, Trichomonas was found to be significantly more likely with older age, never having a previous Pap smear, and living in a more remote area (Table 2).

Table 2
Table 2
Image Tools
Back to Top | Article Outline

DISCUSSION

The prevalence of Trichomonas among women attending sexual health clinics in rural and remote NSW was much higher than that previously reported in major urban clinics.1–3 Women living in the most remote regions of NSW had a prevalence of disease that approaches that described in the most remote Aboriginal communities in Northern Australia.4 Trichomonas is clearly associated with unpleasant symptoms, preterm birth, although causality remains disputed, and human immunodeficiency virus transmission.9 The high prevalence of infection that we found strongly supports screening women attending sexual health clinics in rural and remote areas of Australia.

Trichomonas was associated with increasing remoteness in both Aboriginal and non-Aboriginal women. Indeed, non-Aboriginal women resident of remote areas had a higher prevalence than those of Aboriginal women resident of less remote areas. Although Aboriginality was not found to be independently associated with Trichomonas in our logistic regression model, it is important to recognize that the small sample size limited our ability to clearly distinguish between the effect of Aboriginality and remoteness, reflected in the relatively wide adjusted odds ratio confidence intervals. Despite this limitation, that Trichomonas was more common in non-Aboriginal women resident of remote areas than in Aboriginal women resident of nonremote areas suggests that Aboriginality would not make a good marker for screening.

Australia has a nationwide publicly funded cervical cancer screening program using Pap smears. Trichomonas was significantly less common among women who had previously participated in the cervical cancer screening program. Because Pap smears detect Trichomonas with a sensitivity of 57%10 and participation in screening programs reflects access to health care, it is unclear whether our finding directly reflects previous treatment or alternatively reflects a population with less access to health care in general. People living in more remote areas visit health care services less frequently and use hospital-based rather than primary care services for a greater proportion of their health care.11 As Trichomonas has a long duration of infection, this difference in health care access may be sufficient to lead to a significant difference in prevalence between urban and remote areas.

There are a number of potential limitations in this study. It is most important to note that the sample was limited to women attending sexual health clinics in rural and remote NSW. Although the large and varied region area covered by the clinics suggest our findings would apply to patients attending sexual health clinics across rural and remote areas of Australia, they may not reflect the general population of these regions, particularly given the far greater proportion of Aboriginal women in our sample compared with the local population. This clinic bias is likely to have overestimated the Trichomonas prevalence; however, we do not believe it would significantly effect the association with increasing remoteness. Second, the small samples size limited our ability to adequately control for potential confounding limiting the extent to which the effects of remoteness and Aboriginality can be untangled. Because 30% of the eligible women were not tested, there is a potential for selection bias. The lack of association with symptoms likely reflects both the broad definition of symptoms to include any symptom and the effect of a clinic-based sample with a high proportion of symptomatic attendees. Finally the retrospective self-reported nature of some variables could result in recall bias. The high Trichomonas prevalence that we found suggests that women in rural and remote Australia who attend sexual health clinics or request testing for STIs should be tested for Trichomonas. Trichomonas infection may be more common in women in remote areas regardless of Aboriginal status. To confirm this finding, further studies from population-based samples are needed before considering population-based Trichomonas screening in these regions.

Back to Top | Article Outline

REFERENCES

1. Uddin RN, Ryder N, McNulty AM, et al.. Trichomonas vaginalis infection among women in a low prevalence setting. Sex Health 2011; 8: 65–68.

2. Marrone J, Fairley CK, Saville M, et al.. Temporal associations with declining Trichomonas vaginalis diagnosis rates among women in the state of Victoria, Australia, 1947 to 2005. Sex Transm Dis 2008; 35: 572–576.

3. Lusk MJ, Naing Z, Rayner B, et al.. Trichomonas vaginalis: Under-diagnosis in urban Australia could facilitate re-emergence. Sex Transm Infect 2010; 86: 227–230.

4. Guy R, Garton L, Taylor-Thompson D, et al.. The 2010 baseline prevalence study conducted by the STRIVE trial. Canberra, Australia: 23rd Australasian Sexual Health Conference, 2011.

5. Johnston VJ, Mabey DC. Global epidemiology and control of Trichomonas vaginalis. Curr Opin Infect Dis 2008; 21: 56–64.

6. Bowden FJ, Garnett GP. Trichomonas vaginalis epidemiology: Parameterising and analysing a model of treatment interventions. Sex Transm Infect 2000; 76: 248–256.

7. Australian Institute of Health and Welfare 2004. Rural, regional and remote health: A guide to remoteness classifications. AIHW cat. no. PHE 53. Canberra, Australia: AIHW, 2004.

8. Caliendo AM, Jordan JA, Green AM, et al.. Real-time PCR improves detection of Trichomonas vaginalis infection compared with culture using self-collected vaginal swabs. Infect Dis Obstet Genycol 2005; 13: 145–150.

9. Soper D. Trichomoniasis: Under control or undercontrolled? Am J Obstet Gynecol 2004; 190: 281–290.

10. Wiese W, Patel SR, Patel SC, et al.. A meta-analysis of the Papanicolaou smear and wet mount for the diagnosis of vaginal trichomoniasis. Am J Med 2000; 108: 301–308.

11. Australian Institute of Health and Welfare 2010. Australian health expenditure by remoteness: A comparison of remote, regional and city health expenditure. Health and welfare expenditure series no. 50. Cat. no. HWE 50. Canberra, Australia: AIHW, 2010.

© Copyright 2012 American Sexually Transmitted Diseases Association

Login