Skip Navigation LinksHome > February 2009 - Volume 36 - Issue 2 > Prevalence of Gardnerella vaginalis in Male Sexual Partners...
Sexually Transmitted Diseases:
doi: 10.1097/OLQ.0b013e3181886727
Note

Prevalence of Gardnerella vaginalis in Male Sexual Partners of Women With and Without Bacterial Vaginosis

Schwebke, Jane R. MD*; Rivers, Charles PhD*; Lee, Jeannette PhD†

Free Access
Article Outline
Collapse Box

Author Information

From the *Department of Medicine University of Alabama, Birmingham, Alabama; and the †Department of Biostatistics, University of Arkansas for Medical Sciences, Little Rock, Arkansas

The authors thank Marquita W. Lewis, MS-PHLS for her technical work on this project.

This work was supported by National Institutes of Health grants Concordance Rates of Mobiluncus spp. Among Sexual Partners 1R03 HD42112-01 and Therapy and Prevention of Bacterial Vaginosis, R01 AI048044.

The authors have no conflicts of interest to declare.

Correspondence: Jane R. Schwebke, MD, University of Alabama at Birmingham, ZRB 239 703 19th Street South, Birmingham, AL. E-mail: schwebke@uab.edu.

Received for publication May 2, 2008, and accepted July 29, 2008.

Bacterial vaginosis (BV) is the most common form of vaginitis worldwide and has been linked to multiple reproductive tract complications including preterm birth and increased risk of acquiring STD/HIV.1–3 The pathogenesis of BV is poorly understood and there is lack of consensus on a possible etiologic agent, if any. The majority of epidemiologic data, however, suggests that BV is an STD.4–7 Early on, in the recognition of this syndrome it was accepted that Gardnerella vaginalis was the causative organism; however, this fell out of favor when it was reported that G. vaginalis could be cultured from women who did not meet the Amsel criteria for BV.8 In retrospect, although these women did not meet the clinical criteria for the diagnosis of BV, they also may have not had normal vaginal flora. Although BV flora is characterized by a multitude of organisms, the presence of G. vaginalis in the vaginal flora of women with BV is universal. Studies of G. vaginalis in men have been limited and few studies of concordance among sexual partners have been published and none using polymerase chain reaction (PCR). We determined the presence or absence of this organism from genitourinary specimens of male sexual partners of women with and without normal vaginal flora using G. vaginalis-specific PCR.

Women attending the Jefferson County Department of Health STD Clinic for screening or a new problem were invited to participate in the study. Women were classified as having BV if they met the clinical criteria of Amsel et al.9 or as negative for BV if they did not fulfill this criteria. Women were administered standardized questionnaires regarding sexual behavior and a vaginal smear was obtained for Gram stain using the method of Nugent et al.10 Women were asked to refer sexual partners with whom they had had sexual intercourse within the past 2 weeks to the study for enrollment in the study. Men were also administered a questionnaire and examined for signs of STD. First fraction urine (15–20 mL) was collected, centrifuged, and the pellet resuspended in 5 mL of urine. The pellet mixture was refrigerated on-site then stored at −20 °C before processing. Swabs were obtained from the coronal sulcus and the urethra, placed into a dry sterile screw-capped tube, refrigerated on-site then stored at −20 °C before processing.

Total DNA was extracted from urine sediment, urethral, and coronal sulcus swab specimens by inorganic extraction (Wizard Genomic Purification Kit, Promega, Madison, WI).11 Amplification of a conserved sequence within the G. vaginalis 16 S rRNA gene was carried out using previously reported primers: GV-V6-U2 5′ GACCATGCACCACCTGTGAA 3′ and GV-V2-R1 5′ TCGTGGAGGGTTCGATTCTG 3′.12 Reactions were carried out in 20 μL containing template DNA, 1 × CoralLoad Buffer (Qiagen, Valencia, CA), 200 μmol/L of each dNTP, 0.5 μmol/L of each primer, and 0.025 U/μL of HotStarTaq Plus (Qiagen, Valencia, CA). Amplification conditions on an iCycler (BioRad Laboratories, Hercules, CA) were as follows: 95 °C × 5′/(94 °C × 30′; 60 °C × 30′; 72 °C × 30′) × 30/72 °C × 5′/4°C pause. Two negative controls were run on each amplification batch: water as template for reagent check and Mobiluncus mulieris. The positive control was laboratory cultured G. vaginalis. Amplicons were electrophoresed on 2% agarose/1 × tris acetic acid EDTA (TAE) gels prestained with ethidium bromide, followed by photodigital documentation. G. vaginalis positivity (a band of 1041 base pairs) was defined as a positive PCR from at least 1 sampling of the specimen set.

For comparisons of categorical data, Fisher exact test, and the χ2 test were used. The Wilcoxon rank sum test was used to compare groups about continuous variables because a number of variables were not normally distributed.

A total of 68 men were enrolled into the study, 29 (43%) as partners of women with BV and 39 (57%) as partners of women without BV. For the present analysis we limited inclusion to only those 47 (69.1%) men who had available specimens from all 3 sampling sites (urine, urethral swab, coronal sulcus swab). Women with BV by Amsel criteria had a median baseline Nugent score of 8 versus 2 for the women without BV (P <0.001). The only significant difference other than the baseline Nugent scores of the female partners was race. There was a significantly higher proportion of black subjects who were partners of women with BV than those who were partners to women without BV (Table 1). There were no significant differences between the 47 men who had samples available and the larger cohort (data not shown).

Table 1
Table 1
Image Tools

G. vaginalis was detected in 12 patients [25%, 95% confidence interval (CI) from 14% to 40%]. Urethral specimens were positive in 8/12 (66.6%) of the infected subjects. One patient had a positive result only from the coronal sulcus and 3 patients were positive only in the urine (Table 2). Twenty-six percent of partners of women with BV tested positive for Gardnerella versus 25% of partners of women without BV. There was no significant difference in the rates of G. vaginalis between men who were sexual partners of women with and without BV by Amsel criteria, women with and without normal Nugent scores of 0 to 3, or women with and without bacterial morphotypes on vaginal Gram stain that were consistent with G. vaginalis.

Table 2
Table 2
Image Tools

None of the 11 participants who stated that they had used a condom at the last sexual encounter tested positive for G. vaginalis in contrast to 12/36 (33%) of those who did not use a condom at the last sexual encounter (P = 0.04). None of the 5 participants who stated that they always used a condom in the previous 3 months were positive for G. vaginalis. In comparison, 12/42 (29%) of those who did not always use a condom in the past 3 months were positive for G. vaginalis (P = 0.31) (Table 3).

Table 3
Table 3
Image Tools

The significance of G. vaginalis in the pathogenesis of BV remains controversial; however, nearly all women with BV have high concentrations of this organism.13 Like Neisseria gonorrhoeae, it is a fastidious bacterium that is recovered primarily from genitourinary sites in both sexes and is unstable when removed from its natural environment.14 The human vagina provides an especially rich culture medium, the presence of glycogen being an in vivo growth requirement.15 In males, G. vaginalis has been repeatedly recovered from the urethra and from seminal fluid.16–20

Sexual contact studies point to the sexual transmissibility of G. vaginalis. In 1955, Gardner and Dukes reported that they had isolated Gardnerella from the urethras of 86% of husbands of women with BV.16 Similarly, in 1978, Pheiffer et al. demonstrated the concordance of Gardnerella among 79% of couples in which the woman had BV versus 0% of couples in which the woman did not have BV.21 Biotyping of G. vaginalis has yielded compelling results supporting the sexual transmission of this bacterium. Piot et al. found that biotypes isolated from women with BV and from the urethras of their sexual partners were identical 90% of the time.22 In a longitudinal study of G. vaginalis biotypes, Briselden and Hillier found that lipase-producing strains were associated with BV and that although not statistically significant there was an association between acquisition of a new biotype and new sex partners.23 Ninety percent of women who developed BV acquired a new biotype suggesting a new infection rather than relapse.23 Holst cultured the urethra, coronal sulcus, and seminal fluid of male partners of women with and without BV. They found that 17% of male partners of women with BV were infected versus 2% of partners of women without BV. Further, among men who had specimens taken within 20 hours of unprotected sex with women with BV and then 2 weeks later after interval condom usage, G. vaginalis was only isolated from specimens taken after recent unprotected intercourse.24

In our study, using PCR, we found an overall prevalence of G. vaginalis of 25% but found no difference in the prevalence rates between male sexual partners of women with and without BV. This unexpected finding may be the result of the fact that both groups of men were recruited from the same high risk cohort of patients attending an STD clinic. In fact, the overall prevalence of BV among women attending the clinic is between 50% and 60% (unpublished data). It is therefore possible that the male partners of women without BV were either exposed to abnormal vaginal flora in their referring partners at an earlier time or that they were exposed via a second partner. Although a few men had G. vaginalis detected externally from the coronal sulcus, most cases were detected using either urethral swab specimens or urine. Condom use with the last sexual encounter was significantly associated with a reduced rate of G. vaginalis detection and there was a similar trend for those men who reported always using condoms in the previous 3 months. Condom use has been shown in several recent studies to be protective for acquisition of BV in women.25,26 Additional studies examining concordance of BV-related pathogens in couples, especially couples at lower risk of STD, may be beneficial in contributing to our knowledge of the pathogenesis of BV.

Back to Top | Article Outline

References

1.Eschenbach DA. Bacterial vaginosis and anaerobes in obstetric-gynecologic infection. Clin Infec Dis 1993; 16:S282–S287.

2.Martin H, Richardson BA, Nyange PM, et al. Vaginal lactobacilli, microbial flora, and risk of human immundodeficiency virus type 1 and sexually transmitted disease acquisition. J Infect Dis 1999; 180:1863–1868.

3.Wiesenfeld H, Hillier S, Krohn MA, et al. Bacterial vaginosis is a strong predictor of Neisseria gonorrhoeae and Chlamydia trachomatis infection. Clin Infect Dis 2003; 36:663–668.

4.Moi H. Prevalence of bacterial vaginosis and its association with genital infections, inflammation and contraceptive methods in women attending sexually transmitted disease and primary health clinics. Int J STD AIDS 1990; 1:86–94.

5.Barbone F, Austin H, Louv WC, et al. A follow-up study of methods of contraception, sexual activity and rates of trichomoniasis, candidiasis and bacterial vaginosis. Am J Obstet Gynecol 1990; 163:510–514.

6.Hawes SE, Hillier SL, Benedetti J, et al. Hydrogen peroxide-producing lactobacilli and acquisition of vaginal infections. J Infect Dis 1996; 174:1058–1063.

7.Schwebke J, Desmond RA. Risk factors for bacterial vaginosis in women at high risk for STDs. Sex Transm Dis 2005; 32:654–658.

8.Totten P, Amsel R, Hale J, et al. Selective differential human blood bilayer media for isolation of Gardnerella (Haemophilus) vaginalis. J Clin Microbiol 1982; 15:141–147.

9.Amsel R, Totten PA, Spiegel CA, et al. Non-specific vaginitis: diagnostic and microbial and epidemiological associations. Am J Med 1983; 74:14–22.

10.Nugent RP, Krohn MA, Hillier SL. Reliability of diagnosing bacterial vaginosis is improved by a standardized method of Gram stain interpretation. J Clin Microbiol 1991; 29:297–301.

11.Schwebke J, Lawing L. Improved detection of Trichomonas vaginalis in males using DNA amplification. J Clin Microbiol 2002; 3681–3683.

12.Nath K, Sarosy J, Stylianou S. Suitability of a unique 16S rRNA gene PCR product as an indicator of Gardnerella vaginalis. Biotechniques 2000; 28:222–224.

13.Hillier SL. Diagnostic microbiology of bacterial vaginosis. Am J Obstet Gynecol 1993; 169:455–459.

14.Funke G, Bernard KA. Coryneform Gram-positive rods. In: Murray P, ed. Manual of Clinical Microbiology. Washington, DC: ASM Press, 1999; 319–345.

15.Lam M, Birch DF. Survival of Gardnerella vaginalis in human urine. Am J Clin Pathol 1991; 95:234–239.

16.Gardner HL, Dukes CD. Haemophilus vaginalis vaginitis. A newly defined specific infection previously classified “nonspecific vaginitis.” Am J Obstet Gynecol 1955; 69:962–976.

17.Keane FE, Thomas BJ, Whitaker L, et al. An association between non-gonococcal urethritis and bacterial vaginosis and the implications for patients and their sexual partners. Genitourin Med 1997; 73:373–377.

18.Masfari AN, Kinghorn GR, Duerden BI. Anaerobes in genitourinary infections in men. Br J Vener Dis 1983; 59:255–259.

19.Kinghorn GR, Jones BM, Chowdhury FH, et al. Balanoposthitis associated with Gardnerella vaginalis infection in men. Br J Vener Dis 1982; 58:127–129.

20.Hillier SL, Rabe LK, Muller CH, et al. Relationship of bacteriologic characteristics to semen indices in men attending an infertility clinic. Obstet Gynecol 1990; 75:800–804.

21.Pheiffer TA, Forsyth PS, Durfee MA, et al. Non-specific vaginitis: role of Haemophilus vaginalis and treatment with metronidazole. N Engl J Med 1978; 298:1429–1434.

22.Piot P, VanDyck E, Peeters M, et al. Biotypes of Gardnerella vaginalis. J Clin Microbiol 1984; 20:677–679.

23.Briselden AM, Hillier SL. Longitudinal study of the biotypes of Gardnerella vaginalis. J Clin Microbiol 1990; 28:2761–2764.

24.Holst E. Reservoir of four organisms associated with bacterial vaginosis suggests lack of sexual transmission. J Clin Microbiol 1990; 28:2035–2039.

25.Sanchez S, Garcia PJ, Thomas KK, et al. Intravaginal metronidazole gel versus metronidazole plus nystatin ovules for bacterial vaginosis: a randomized controlled trial. Am J Obstet Gynecol 2004; 191:1898–1906.

26.Schwebke J, Desmond RA. A randomized trial of metronidazole in asymptomatic BV to prevent acquisition of STDs. Am J Obstet Gynecol 2007; 196:517–522.

Cited By:

This article has been cited 4 time(s).

Clinical Infectious Diseases
Recurrence of Bacterial Vaginosis Is Significantly Associated With Posttreatment Sexual Activities and Hormonal Contraceptive Use
Bradshaw, CS; Vodstrcil, LA; Hocking, JS; Law, M; Pirotta, M; Garland, SM; De Guingand, D; Morton, AN; Fairley, CK
Clinical Infectious Diseases, 56(6): 777-786.
10.1093/cid/cis1030
CrossRef
Bmc Infectious Diseases
The epidemiology of bacterial vaginosis in relation to sexual behaviour
Verstraelen, H; Verhelst, R; Vaneechoutte, M; Temmerman, M
Bmc Infectious Diseases, 10(): -.
ARTN 81
CrossRef
Epidemiologie Mikrobiologie Imunologie
Bacterial Infection as a Cause of Infertility in Humans
Sleha, R; Bostikova, V; Salavec, M; Mosio, P; Kusakova, E; Kukla, R; Mazurova, J; Splino, M
Epidemiologie Mikrobiologie Imunologie, 62(1): 26-32.

Sexually Transmitted Diseases
Race of Male Sex Partners and Occurrence of Bacterial Vaginosis
Klebanoff, MA; Andrews, WW; Zhang, J; Brotman, RM; Nansel, TR; Yu, K; Schwebke, JR
Sexually Transmitted Diseases, 37(3): 184-190.
10.1097/OLQ.0b013e3181c04865
PDF (258) | CrossRef
Back to Top | Article Outline

© Copyright 2009 American Sexually Transmitted Diseases Association

Login