Skip Navigation LinksHome > February 2013 - Volume 39 - Issue 2 > Activation of the Heat Shock Response Attenuates the Interle...
Shock:
doi: 10.1097/SHK.0b013e31827e8ea3
Basic Science Aspects

Activation of the Heat Shock Response Attenuates the Interleukin 1β–Mediated Inhibition of the Amiloride-Sensitive Alveolar Epithelial Ion Transport

Howard, Marybeth*; Roux, Jérémie*; Iles, Karen E.∥¶**; Miyazawa, Byron*; Christiaans, Sarah; Anjum, Naseem; Dickinson, Dale A.**; Goolaerts, Arnaud*; Matthay, Michael A.‡§; Pittet, Jean Francois†∥

Free Access
Article Outline
Collapse Box

Author Information

Laboratory of Surgical Research, Departments of *Anesthesia, Surgery, Medicine, and §Cardiovascular Research Institute, University of California, San Francisco, California; and Departments of Anesthesiology, Nutrition, and **Environmental Health Sciences, University of Alabama at Birmingham, Birmingham, Alabama

Received 21 Sep 2012; first review completed 8 Oct 2012; accepted in final form 16 Nov 2012

Address reprint requests to Jean Francois Pittet, MD, Department of Anesthesiology, University of Alabama at Birmingham, 619 S 19th St, JT926, Birmingham, AL 35249. E-mail: pittetj@uab.edu.

Funding support was received from the Academic Senate Grant UCSF (to M.H.), American Lung Association Fellowship Award and NIH T32 Training Grant (to J.R.), and NIH RO1 GM62188 (to J.F.P.).

M.H. and J.R. contributed equally to this work.

Collapse Box

Abstract

ABSTRACT: Acute lung injury (ALI) is a clinical syndrome characterized by hypoxia, which is caused by the breakdown of the alveolar capillary barrier. Interleukin 1β (IL-1β), a cytokine released within the airspace in ALI, downregulates the α subunit of the epithelial sodium channel (αENaC) transcription and protein expression via p38 MAP kinase–dependent signaling. Although induction of the heat shock response can restore alveolar fluid clearance compromised by IL-1β following the onset of severe hemorrhagic shock in rats, the mechanisms are not fully understood. In this study, we report that the induction of the heat shock response prevents IL-1β–dependent inhibition of αENaC mRNA expression and subsequent channel function. Heat shock results in IRAK1 detergent insolubility and a disruption of Hsp90 binding to IRAK1. Likewise, TAK1, another client protein of Hsp90 and signaling component of the IL-1β pathway, is also detergent insoluble after heat shock. Twenty-four hours after heat shock, both IRAK1 and TAK1 are again detergent soluble, which correlates with the IL-1β–dependent p38 activation. Remarkably, IL-1β–dependent p38 activation 24 h after heat shock did not result in an inhibition of αENaC mRNA expression and channel function. Further analysis demonstrates prolonged preservation of αENaC expression by the activation of the heat shock response that involves inducible Hsp70. Inhibition of Hsp70 at 24 h after heat shock results in p38-dependent IL-1β inhibition of αENaC mRNA expression, whereas overexpression of Hsp70 attenuates the p38-dependent IL-1β inhibition of αENaC mRNA expression. These studies demonstrate new mechanisms by which the induction of the heat shock response protects the barrier function of the alveolar epithelium in ALI.

Back to Top | Article Outline

INTRODUCTION

Acute lung injury (ALI) is a clinical syndrome characterized by alveolar flooding of a protein-rich edema due to the breakdown of the alveolar capillary barrier (1). In severe lung injury, the alveolar epithelial vectorial fluid transport is inhibited by the development of the inflammatory response within the airspace of the lung (2). Interleukin 1β (IL-1β), one of the most biologically active cytokines in the airspace of patients with ALI (3–5), contributes to ALI development by downregulating expression of the apical epithelial sodium channel (ENaC) α subunit (αENaC) through a p38 MAP kinase–dependent signaling, thereby impairing vectorial sodium transport and removal of edema fluid from the alveolar space (6).

The heat shock or stress protein response (SPR) has been classically defined as a highly conserved cellular defense mechanism characterized by increased expression of stress proteins (7). This allows the cell to withstand a subsequent insult or “second hit” that would otherwise be lethal, a phenomenon referred as “thermotolerance” or “preconditioning” (8). The activation of SPR is characterized by an early phase defined by the inhibition of proinflammatory cell signaling pathways within minutes after onset of SPR. The inhibition of these intracellular pathways early after onset of SPR is due in large part to the dissociation of Hsp90 from its client proteins, as we have published previously (9–11). Indeed, Hsp90 functions as a positive regulator of multiple cell signaling pathways by modifying the conformation of its client proteins into active signaling proteins (12). Blocking the ATPase site of Hsp90 by geldanamycin inhibits the function of these client proteins, making them detergent insoluble and targeting them for degradation via the proteasome (13).

Stress protein response is also associated with the expression of inducible heat shock proteins such as Hsp70. Several studies that include our own work have shown that the lung inflammatory response is inhibited in animals or cells that have been preconditioned by stress (14–19). For example, prior SPR induction with either heat or geldanamycin inhibits the development of ALI due to ischemia-reperfusion, hemorrhagic shock, or sepsis (2, 20, 21). In addition, the inhibitory effect of SPR can be reproduced in part by the adenoviral gene transfer of Hsp70 into the distal airspace of the lung, suggesting that the expression of intracellular Hsp70 may participate to the anti-inflammatory effect induced by SPR (22).

Previous work from our laboratory has shown that some patients with ALI undergo SPR activation that is associated with the maintenance of the alveolar epithelial fluid transport (23). We have also found that prior SPR activation prevents the IL-1β–mediated decrease in transepithelial current by maintaining the expression of αENaC in alveolar epithelial type II cells, although the mechanism by which SPR activation prevents the inhibition of alveolar fluid clearance by IL-1β is still unknown. In the present study, we show that the attenuation of IL-1β signaling by SPR activation is due to the detergent insolubility of IRAK-1 and TAK1 as well as disruption of Hsp90 from IRAK1. However, the IL-1β signaling pathway leading to p38 MAP kinase activation is reconstituted within 24 h after heat shock, and yet αENaC transcription is still preserved. Further analysis showed that the prolonged attenuation of IL-1β signaling by SPR activation is due to upregulation of inducible Hsp70.

Back to Top | Article Outline

MATERIALS AND METHODS

Isolation and culture of rat alveolar type II cells

Rat alveolar type II (ATII) cells were isolated as described previously (24) after obtaining approval from the University of California, San Francisco, Committee on Animal Research or the University of Alabama at Birmingham Institutional Animal Care and Use Committee. Male Sprague-Dawley rats (150–200 g) were used for the isolation of ATII cells.

Back to Top | Article Outline
Isolation and culture of human ATII cells

Human alveolar ATII cells were isolated by a modification of methods previously described (24) after obtaining approval from the University of California, San Francisco, Committee on Human Research.

Back to Top | Article Outline
SPR activation using heat (heat shock)

The incubation time for cells placed in a 43°C CO2 incubator was determined based on the absence of cell death, using the Alamar blue assay, and the efficiency of SPR activation by measuring the intracellular increase in inducible Hsp70 protein by Western blotting (data not shown). Type II alveolar epithelial cells were heat shocked for 45 min and returned to 37°C, as previously published (23).

Back to Top | Article Outline
Short-circuit measurements

Freshly isolated rat or human ATII cells (0.75 × 106) were seeded on polycarbonate Snapwell membranes (pore size 0.4 μm, surface area 1.13 cm2). At 120 to 144 h, the Snapwell inserts were mounted in an Ussing chamber system (Physiologic Instruments Inc, San Diego, Calif) as we have done before (24).

Back to Top | Article Outline
Enzyme-linked immunosorbent assay

P38 phosphorylation was measured using enzyme-linked immunosorbent assay (ELISA) (eBioscience, San Diego, Calif) following the manufacturer’s instructions.

Back to Top | Article Outline
Western blotting

Cells were washed three times with phosphate-buffered saline (PBS) on ice and either lysed with 25 mM Tris buffer (pH 7.5) containing 100 mM NaCl, 5 mM MgCl2, 1 mM EDTA, 1% Triton, 1 mM sodium orthovanadate, 1 mM NaF, and protease inhibitors to determine solubility/insolubility of IRAK1 and TAK1 or lysed in 1× Laemmli sample buffer (LSB). Nuclei were pelleted at 14,000 g for 5 min when cells were lysed in the Tris/Triton buffer. When cells were lysed in LSB, the DNA was sheared using an 18-gauge needle. The protein concentrations of the samples were determined in triplicate using an adaptation of the Bradford protein assay (Bio-Rad, Hercules, Calif). The OD595 was determined using a Wallac Victor2 counter (PerkinElmer, San Jose, Calif), and the protein concentrations determined using a standard curve. Equal amounts of protein were separated by gel electrophoresis using sodium dodecyl sulfate (SDS)–polyacrylamide for all experiments including both detergent-soluble and -insoluble fractions, as we have done before (11). Proteins were visualized using the Odyssey Infrared Imaging System from LI-COR (LI-COR Biosciences, Lincoln, Neb). Antibodies were as follows: inducible Hsp70 (clone 92; StressGen, Plymouth Meeting, Pa), Hsp90 (#SPA-830F; Assay Designs, Plymouth Meeting, Pa), IRAK1 (#SC5288; Santa Cruz Biotechnology, Santa Cruz, Calif), TAK1 (#4505; Cell Signaling, Danvers, Mass), phosphop38 (#9211S; Cell Signaling), p38 (#9212; Cell Signaling), and actin (#4967; Cell Signaling). IRAK1 1:500; TAK1 1:500; Hsp70 1:1,000; Hsp90 1:500; phosphorylated p38 1:500; p38 1:1,000; and actin 1:1,000. LICOR goat anti–rabbit and anti–mouse secondary antibodies were used at a dilution of 1:10,000.

Back to Top | Article Outline
Isolation of membrane-enriched fraction

Type II cells were scraped into a hypotonic buffer (10 mM HEPES, 10 mM NaCl, 5 mM MgCl2, 1 mM DTT, protease inhibitors, phosphatase inhibitors). Cells were allowed to swell by rotation for 30 min at 4°C. Cells were broken by dounce using a loose-fitting pestle and 18 strokes. Nuclei were removed by centrifugation at 1,000 revolutions/min for 3 min at 4°C. The supernatant was subjected to centrifugation at 15,000 g for 15 min at 4°C to pellet an enriched membrane fraction (9). This pelleted fraction was either resuspended in LSB and further analyzed by SDS–polyacrylamide gel electrophoresis (PAGE) and Western blotting or resuspended in 50 mM HEPES, 150 mM NaCl, 1% NP40, 1 mM EDTA, 10% glycerol, and 1 mM DTT for immunoprecipitation before SDS-PAGE and Western blotting analysis.

Back to Top | Article Outline
Immunoprecipitations

Rat primary type II alveolar epithelial cells were lysed as described above for isolation of membrane-enriched fraction with the addition of 40 mM sodium molybdate for the immunoprecipitation of IRAK1/Hsp90 complexes. The membrane-enriched fraction was incubated with primary antibodies to Hsp90 for 1 h at 4°C. Antigen-antibody (Ag-Ab) complexes are captured using protein G sepharose. The protein G sepharose–Ag-Ab complex was pelleted at 3,000 revolutions/min for 4 s. The Ag-Ab complexes were washed three times and subjected to SDS-PAGE and Western blotted for the presence of the IRAK1 protein before stripping and reprobing for Hsp90.

Back to Top | Article Outline
Adenovirus infection

Rat type II alveolar epithelial cells grown on transwell permeable supports were incubated in PBS containing 5.3 mM EDTA on both the basolateral and apical compartments for 60 min. The PBS/EDTA solution was removed, and cells were placed in 1 mL of PBS in the basolateral compartment and 0.3 mL of PBS in the apical compartment containing recombinant adenovirus expressing Hsp70 subcloned downstream from the CMV promoter (Clifford S. Deutschman, MD, University of Pennsylvania), MOI 50. Plates were incubated at 37°C for 1 h with rocking to evenly distribute the virus over the cells every 10 min. Viral inoculum was removed after 1 h, and cells were placed in media containing heat-inactivated serum. Cells were lysed 48 h after infection and analyzed for protein and mRNA expression.

Back to Top | Article Outline
siRNA transfections

Primary rat type II alveolar epithelial cells were transfected with siRNA using X-tremeGENE transfection reagent (Roche, Indianapolis, Ind) according to manufacturers’ instructions. The ratio of lipid to siRNA was 10 μL to 150 pmol. Cells seeded on transwells were heat shocked for 45 min at 43°C and allowed to recover for 1 h before the addition of the lipid/siRNA transfection complex on the cells. Twenty-four hours after transfection, cells were lysed, and inducible Hsp70 expression determined by SDS-PAGE and Western blotting. For analysis of ENaC mRNA, cells were stimulated with IL-1β from 21 to 24 h after transfection before RNA isolation. siRNA sequence to inducible Hsp70 (Ambion, Austin, Tex) was as follows: sense 5′-AACAAGAUCACCAUCACCAACtt-3′ (Silencer negative control siRNA; #AM4635; Ambion).

Back to Top | Article Outline
Measurement of αENaC mRNA

Real-time reverse transcriptase–polymerase chain reaction (RT-PCR) primers and probes were designed using Primer Express software (PE–Applied Biosystems, Warrington, UK). The real-time RT-PCR probes were labeled with a fluorophore reporter dye (6-carboxy-fluorescein, FAM) at the 5′ end and a quencher dye (BHQ; Biosearch Technologies, Inc, Novato, Calif) at the 3′ end. Quantitative real-time RT-PCR was performed as previously published. Reverse transcriptase–PCR was carried out in a 25-μL reaction mixture containing 1× TaqMan Universal PCR Master Mix (PE-Biosystems, Foster City, Calif), 10 pmol of primers, 5 pmol of TaqMan probe, and an equivalent of 100 ng of total RNA for 40 cycles at 95°C for 15 s and 60°C for 1 min. The number of cycles to threshold (CT) of fluorescence detection was normalized to the CT of glyceraldehyde 3-phosphate dehydrogenase for each sample tested. Rat RT-PCR glyceraldehyde 3-phosphate dehydrogenase primers were as follows: TAGF: CTGCCAAGTATGATGACATCAAGAA, TAGR: AGCCCAGGATGCCCTTTAGT, TAGP: TCGGCCGCCTGCTTCACCA; rat RT-PCR primers: αENaC TAGF: TGATTGAATTCCACCGCTCC, αENaC TAGR: CCCGTGGATGGTGGTGTT, αENaC TAGP: CGGGAGCTCTTCCAGTTCTTCTGCAA.

Back to Top | Article Outline
Statistical analysis

For the statistical analysis, we used Statview 5.0 (SAS Inc Cary, NC) and MedCalc 7.2.0.2 (MedCalc Software Inc, Mariakerke, Belgium). All data were tested for normality, and because of nonuniform distribution, the data were subsequently analyzed with nonparametric tests. Data were calculated as medians ± interquartile ranges (IQRs). The data are presented in the figures as box plots with IQRs and lower and upper ranges. The Kruskal-Wallis test followed by the Dunn test was used to compare three or more experimental groups. The Mann-Whitney U test was used to compare two experimental conditions. P < 0.05 was considered statistically significant.

Back to Top | Article Outline

RESULTS

SPR activation prevents IL-1β–dependent inhibition of amiloride-sensitive current in rat and human alveolar epithelial type II cell monolayers

In our prior studies, we reported that IL-1β, a biologically active cytokine in patients with ALI, decreased the amiloride-sensitive transepithelial current as well as mRNA expression of the αENaC via a p38-dependent pathway (6). Further studies also showed that SPR activation prevented the IL-1β–mediated decrease in transepithelial current across ATII cell monolayers, although the mechanism of this effect is not fully understood (23). In the current study, we first determined the time required for attenuation of IL-1β inhibition of the amiloride-sensitive ENaC current in alveolar epithelial cells following activation of the SPR. A time course of recovery after heat shock shows that the preservation of the amiloride-sensitive ENaC current in the presence of IL-1β stimulation persists as long as 24 h, showing a range of 40% to 90% protection (Fig. 1A). By 48 h after heat shock, the preservation of the amiloride-sensitive ENaC current was reversed, as IL-1β inhibited the transepithelial current at the same extent as that seen in the non–heat shock control monolayers (Fig. 1A). The same time course of protection was also observed in human type II alveolar epithelial cells, indicating that the protection due to heat shock was not unique to rat alveolar epithelial type II cells (Fig. 1B).

Fig. 1
Fig. 1
Image Tools

The SPR can also be activated in ATII cell monolayers with pharmacological agents, such as 17-allylamino-17-demothoxy-geldanamycin (17-AAG) (11). Thus, we tested whether 17-AAG would attenuate IL-1β–mediated downregulation of the amiloride-sensitive ENaC current across ATII cell monolayers. Incubation of both rat and human type II alveolar epithelial cell monolayers with 10 μg/mL of 17-AAG showed a 25% protection as early as 1 h before treatment and demonstrated a time-dependent increase in protection of ENaC channel function from IL-1β inhibition with the maximum level of protection of 50% to 60% of control (Fig. 1, C and D). These results support the hypothesis that attenuation of IL-1β inhibition of the amiloride-sensitive current is due to SPR activation and not to a nonspecific effect of heat.

Back to Top | Article Outline
SPR activation with heat and 17-AAG preserves αENaC mRNA expression from IL-1β–dependent inhibition in rat alveolar epithelial type II cell monolayers

As the amiloride-sensitive fraction of the vectorial current across the alveolar epithelium is largely ENaC dependent, we examined the effect of prior SPR activation on IL-1β–mediated inhibition of αENaC mRNA expression in ATII cell monolayers. The preservation of αENaC mRNA expression induced by SPR activation followed a similar time course to that observed for the preservation of the amiloride-sensitive ENaC current. The αENaC mRNA expression after heat shock and in the presence of IL-1β averaged 75% of the mRNA expression of the non–heat-shocked control for time points up to and including 24 h. However, by 48 h after heat shock, this protection was reversed, as IL-1β inhibited αENaC mRNA expression at a level comparable to that seen in cells that were not heat shocked (Fig. 2A). Likewise, the preservation of αENaC mRNA expression after 17-AAG treatment and IL-1β stimulation also showed a time-dependent effect. One-hour incubation with 17-AAG showed a 10% increase in αENaC mRNA expression in the presence of IL-1β compared with the control (Fig. 2B) that continued to increase to 40% to 60% after 3- or 6-h exposure to 17-AAG and IL-1β stimulation. Finally, there was a good correlation between the protective effect of SPR induced by heat or 17-AAG on the amiloride-sensitive current and αENaC mRNA expression (Figs. 1 and 2).

Fig. 2
Fig. 2
Image Tools
Back to Top | Article Outline
SPR activation with heat and 17-AAG prevents IL-1β–dependent p38 activation in a time-dependent manner in rat alveolar epithelial type II cell monolayers

Our previous studies have shown that SPR activation causes the disruption of Hsp90 binding to its client proteins (9, 11). Interleukin 1β–dependent p38 activation is known to signal through both IRAK1 and TAK1, which are both Hsp90 client proteins (25–27). Analysis of the time course after SPR activation showed a time-dependent expression of Hsp70 (Fig. 3A) and an attenuation of IL-1β–dependent activation of p38 MAP kinase, as indicated by the inhibition of the phosphorylation of this MAP kinase at 1 and 6 h, but not at 24 and 48 h after SPR activation with heat (Fig. 3B), but at the 24-h time point, IL-1β–dependent inhibition of the amiloride-sensitive ENaC current and αENaC mRNA expression was still attenuated (Fig. 1A). This result suggests that 24 h after SPR activation, the IL-1β signaling pathway upstream of p38 activation has been reconstituted and that the inhibition of the effect of IL-1β on ENaC current and mRNA expression involves another cellular mechanism. Likewise, treatment of type II alveolar epithelial cells with 17-AAG shows a time-dependent effect of 17-AAG on p38 activation (Fig. 3C) that correlates with a time-dependent preservation of ENaC current and mRNA expression.

Fig. 3
Fig. 3
Image Tools
Back to Top | Article Outline
SPR activation with heat and 17-AAG promotes the detergent insolubility of IRAK1 and TAK1 proteins in rat alveolar epithelial type II cell monolayers

Our previous studies have shown that disruption of Hsp90 from its client protein results in detergent insolubility of the client protein (9, 11). Hsp90 binds both IRAK1 and TAK1, two proteins that are upstream of p38 activation in the IL-1β signaling pathway (25–27). Both IRAK1 and TAK1 are shown to be in a Triton X-100–soluble fraction under nonstimulated (Fig. 4, A and B) and IL-1β–stimulated conditions (data not shown). Stress protein response activation with heat followed by 1-h recovery resulted in the Triton X-100 insolubility of both IRAK1 and TAK1 proteins (Fig. 4, A and B). Treatment with MG132, a proteasome inhibitor, had no effect on the solubility of TAK1 or IRAK1. Both IRAK1 and TAK1 protein were found in a detergent-soluble fraction 24 h after heat shock, a time point at which IL-1β–dependent p38 activation is restored. Treatment of alveolar epithelial type II cell monolayers with 17-AAG also showed a time-dependent increase in IRAK1 and TAK1 Triton X-100 insolubility (Fig. 4, C and D). Lastly, coimmunoprecipitation of IRAK1/Hsp90 was performed from membrane-enriched fractions. IRAK1 was found to bind Hsp90 at basal conditions (Fig. 5) as previously reported (3). After SPR activation with heat, there was a disruption of the binding of Hsp90 to its client protein IRAK1 (Fig. 5).

Fig. 4
Fig. 4
Image Tools
Fig. 5
Fig. 5
Image Tools
Back to Top | Article Outline
Overexpression of Hsp70 and inhibition of SPR-induced Hsp70 expression inversely affect αENaC mRNA expression in rat alveolar epithelial type II cell monolayers

Our previous studies have shown a role for intracellular inducible Hsp70 in attenuating proinflammatory signaling pathways (9). Because of the fact that 24 h after SPR activation IL-1β–dependent p38 activation did not result in a downregulation of αENaC mRNA, the role of inducible Hsp70 expression in contributing to this effect was examined. Hsp70 was overexpressed in rat alveolar epithelial type II cell monolayers using a recombinant Hsp70 adenovirus in the absence of SPR activation (Fig. 6A). In the presence of Hsp70 overexpression in ATII cell monolayers, IL-1β phosphorylated p38 MAP kinase (Fig. 6A). However, overexpression of Hsp70 resulted in the preservation of αENaC mRNA expression in the presence of IL-1β stimulation (Fig. 6B). Conversely, treatment of the type II alveolar epithelial cell monolayers with Hsp70 siRNA after heat shock caused the inhibition of inducible Hsp70 expression and restored the inhibitory effect of IL-1β on αENaC mRNA expression (Fig. 6, C and D).

Fig. 6
Fig. 6
Image Tools
Back to Top | Article Outline

DISCUSSION

In this study, we demonstrate that in rat and human alveolar epithelial type II cells, (a) prior SPR activation prevents the IL-1β–mediated inhibition of the amiloride-sensitive short-circuit current and αENaC mRNA expression; (b) SPR-mediated attenuation of IL-1β–dependent p38 MAP kinase activation is associated with the reversible detergent insolubility of IRAK-1 and TAK-1 (both Hsp90 client proteins); (c) detergent solubility of IRAK1 and TAK1 24 h after heat stress correlates with p38 MAP kinase activation, but not with IL-1β–dependent inhibition of αENaC mRNA expression and channel function; (d) inducible Hsp70 plays an important role in SPR-mediated prolonged attenuation of IL-1β–dependent inhibition of αENaC mRNA expression.

Activation of the SPR has been shown to attenuate cell and organ response to inflammatory stimuli induced by several pathological conditions (15–19, 28). For example, we previously reported that prior SPR activation restored the cAMP-mediated stimulation of the vectorial alveolar fluid transport (2) that was completely inhibited after severe hemorrhagic shock by an IL-1β–dependent mechanism (29). In further work, we also found that IL-β inhibited ENaC gene and protein expression and channel function via a p38 MAP kinase–dependent mechanism (6). However, the molecular mechanism(s) by which SPR activation prevents the inhibitory effect of IL-1β on ENaC expression and function were still unknown.

In the present study, we found that SPR activated by heat or pharmacologically by 17-AAG, an Hsp90 inhibitor that is known to activate a heat shock response (and induces upregulation of Hps70 in ATII cells (2), prevented the IL-1β–mediated inhibition of the amiloride-sensitive short-circuit current and αENaC mRNA expression in rat and human alveolar epithelial type II cell monolayers This indicates that the SPR effect was not due to a nonspecific effect of heat. We have previously reported that there is a good correlation between the IL-1β–mediated inhibition of αENaC mRNA, plasma membrane protein expression, and ENaC channel function at the cell membrane of ATII cells (6). What are the mechanisms by which SPR preserves αENaC mRNA expression and function in ATII cells after exposure to IL-1β? There are several mechanisms that can explain this SPR effect. First, SPR activation has been shown to cause the dissociation of Hsp90 from its client proteins, resulting in the temporary inhibition of the function of the particular client protein, its detergent insolubility, and thus its degradation via the proteasomal pathway (13, 25–27). We have previously reported that SPR activation inhibits several inflammatory signaling pathways via this mechanism (9–11). Importantly, once the client protein becomes detergent insoluble, the enzymatic activity of this protein is inhibited until the protein becomes detergent soluble again provided that it is not fully degraded by the proteasomal pathway. These results are consistent with a mechanism that we have previously reported in alveolar epithelial cells for the Hsp90 client protein IκB kinase (11).

Several proteins that are upstream of p38 MAP kinase in the IL-1β–dependent signaling pathway, such as IRAK-1 and TAK-1, have recently been shown to be client proteins of Hsp90 (17, 25). We found that activation of SPR using heat, which disrupts Hsp90 binding to IRAK-1, results in the immediate detergent insolubility of both IRAK-1 and TAK1 with the concomitant inhibition of p38 MAP kinase phosphorylation and correlates with maximal preservation of αENaC mRNA expression and amiloride-sensitive current. In contrast, SPR activation using 17-AAG instead of heat shows a slower kinetics of attenuation of IL-1β–dependent p38 MAP kinase activation as a 1-h treatment with 17-AAG before exposure to IL-1β inhibits p38 MAP kinase phosphorylation by 50% compared with the non–heat-shocked cell monolayers treated with IL-1β. This reduction in p38 MAP phosphorylation correlates with a 50% preservation of both αENaC mRNA expression and amiloride-sensitive current observed in the cell monolayers treated with 17-AAG before exposure to IL-1β. Interestingly, our results indicate that a 1-h treatment with 17-AAG results in the complete insolubility of IRAK-1 whereas only a fraction of TAK1 is insoluble under these conditions. Our data showing partial insolubility of TAK1 are consistent with the work by Liu et al. (26), which reported that Hsp90 binding to TAK1 is required for its folding and stability but is released when TAK1 binds to TAB1. Thus, the soluble fraction of TAK1 likely represents a stable form of TAK1 that does not form a protein complex with Hsp90. By 24 h after heat shock, the IL-1β signaling pathway upstream of p38 MAP kinase is restored, as both IRAK-1 and TAK1 are found in the detergent-soluble fraction, and IL-1β phosphorylates p38 MAP kinase in ATII cell monolayers. However, IL-1β does not inhibit αENaC mRNA expression and amiloride-sensitive current in ATII cell monolayers up to 48 h after SPR activation, indicating that other mechanism(s) are implicated in the inhibition of IL-1β cell signaling by SPR in ATII cells.

What are the mechanism(s) by which SPR preserves αENaC mRNA expression and function in the presence of p38 MAP kinase activation? It has previously been shown that heat stress attenuates IL-1β signaling by dephosphorylating p38 MAP kinase through the induction of MAP kinase phosphatase (MKP-1) expression (30). MAP kinase phosphatase 1 is indeed upregulated in response to heat shock via transcriptional and posttranscriptional mechanisms (31, 32). In addition, studies by Lee and colleagues (33) reported that, after heat shock, Hsp70 binds to MKP-1, increasing the levels of phosphorylated MKP-1 and accelerating MAP kinase inactivation. Thus, the simplest model explaining our results at the 24-h time point after SPR activation would be that, once the p38 MAP kinase is phosphorylated and translocates to the nucleus, it is dephosphorylated by MKP-1, allowing transcription of αENaC. For example, Nimah et al. (34) have shown in THP-1 cells, a monocyte cell line, that there is a significant increase in nuclear MKP-1 protein expression 24 h after SPR activation that is associated with an absence of p38 phosphorylation by Escherichia coli endotoxin in THP-1 cells. In contrast, our results demonstrate that IL-1β phosphorylates p38 MAP kinase 24 h after SPR activation with the same intensity as in non–heat-shocked cell monolayers. Thus, it is unlikely that the induction of nuclear expression of MKP-1 protein would fully explain the inhibition of IL-1β signaling during the late phase of SPR in alveolar epithelial type II cell monolayers. We have previously reported that the induction of Hsp70 plays an important role in the prolonged SPR-mediated inhibition of the Stat1-iNOS pathway in alveolar macrophages (9). In the present study, we found that Hsp70 was expressed up to 24 h after SPR activation in ATII cell monolayers. Furthermore, adenoviral gene transfer of Hsp70 prevented the inhibitory effect on ENaC mRNA expression and channel function without inhibiting p38 MAP kinase activation by IL-1β. These results are consistent with those from Shi et al. (35), who reported in RAW cells that overexpression of Hsp70 had no inhibitory effect on p38 MAP kinase activation. Conversely, the inhibition of Hsp70 protein expression by siRNA in heat-shocked ATII cells prevented the SPR-mediated effect on inhibition of αENaC gene expression by IL-1β. What mechanism(s) could then explain the effect of Hsp70 protein overexpression on the attenuation of IL-1β–dependent inhibition of αENaC gene expression in ATII cells? Published work from Rubenstein’s laboratory has shown that overexpression of Hsp70, but not Hsc70, increases murine ENaC (mENaC) channel expression and activity at the plasma membrane of oocytes (14). Other investigators have reported comparable results for the effect of Hsp70 on CFTR expression and function at the plasma membrane in lung epithelial cells (36). Taken together, these published studies as well as our present results suggest that the induction of Hsp70 following SPR activation preserves αENaC mRNA levels and increases targeting of ion channels to the plasma membrane of lung epithelial cells without modulating the cell signaling pathways of inflammatory mediators, such as IL-1β. However, further studies are needed to understand the mechanism(s) by which Hsp70 modulates expression and function of ion channels in lung epithelial cells.

Back to Top | Article Outline
Clinical implications

We had previously reported that the release of extracellular inducible Hsp70, a marker of an intracellular SPR, in the pulmonary edema fluid of patients with ALI preserves alveolar fluid clearance and is associated with survival (23). The present study provides a new potentially clinically relevant mechanism to explain the protective effect of SPR activation on the vectorial alveolar epithelial fluid transport after onset of ALI because IL-1β is one of the most biologically active cytokines in the distal airspaces of ALI patients (3–5) and causes increased lung vascular permeability and inhibits the vectorial fluid transport across the distal lung epithelium (6). However, it should be pointed out that there is a large body of evidence that IL-1β signaling is only one of multiple signaling pathways that can negatively affect the removal of the pulmonary edema fluid by the alveolar epithelium after onset of ALI in humans (reviewed in Matthay et al. (37)). The multiplicity of the signaling pathways involved in inhibiting the function of the alveolar epithelial ion channels may explain in part why most of the phase 3 clinical trials that included a single drug to treat ALI patients have produced negative results.

In summary, our studies demonstrate that SPR activation significantly attenuates IL-1β inhibition of αENaC mRNA expression and the amiloride-sensitive current via multiple mechanisms. It has previously been shown that heat shock increases the nuclear expression of MKP-1, a phosphatase that inhibits the nuclear activity of p38 MAP kinase. Herein, we found that SPR activation also attenuates IL-1β–dependent p38 MAP kinase activation by disrupting the binding of IRAK-1 and TAK1 to Hsp90, resulting in their detergent insolubility and targeting them for degradation via the proteasomal pathway. Furthermore, SPR activation also causes a prolonged attenuation of p38-dependent inhibition of αENaC mRNA expression via the expression of the inducible Hsp70. These results provide additional understanding about the mechanisms by which SPR activation is associated with better survival in patients with ALI or severe trauma (23, 38).

Back to Top | Article Outline

REFERENCES

1. Ware LB, Matthay MA: The acute respiratory distress syndrome. N Engl J Med 342: 1334–1349, 2000.

2. Pittet JF, Lu LN, Geiser T, Lee H, Matthay MA, Welch WJ: Stress preconditioning attenuates oxidative injury to the alveolar epithelium of the lung following haemorrhage in rats. J Physiol 538: 583–597, 2002.

3. Olman MA, White KE, Ware LB, Simmons WL, Benveniste EN, Zhu S, Pugin J, Matthay MA: Pulmonary edema fluid from patients with early lung injury stimulates fibroblast proliferation through IL-1 beta–induced IL-6 expression. J Immunol 172: 2668–2677, 2004.

4. Pugin J, Ricou B, Steinberg KP, Suter PM, Martin TR: Proinflammatory activity in bronchoalveolar lavage fluids from patients with ARDS, a prominent role for interleukin-1. Am J Respir Crit Care Med 153: 1850–1856, 1996.

5. Pugin J, Verghese G, Widmer MC, Matthay MA: The alveolar space is the site of intense inflammatory and profibrotic reactions in the early phase of acute respiratory distress syndrome. Crit Care Med 27: 304–312, 1999.

6. Roux J, Kawakatsu H, Gartland B, Pespeni M, Sheppard D, Matthay MA, Canessa CM, Pittet JF: Interleukin-1beta decreases expression of the epithelial sodium channel alpha-subunit in alveolar epithelial cells via a p38 MAPK–dependent signaling pathway. J Biol Chem 280: 18579–18589, 2005.

7. Welch WJ: Heat shock proteins functioning as molecular chaperones: their roles in normal and stressed cells. Philos Trans R Soc Lond B Biol Sci 339: 327–333, 1993.

8. Minowada G, Welch WJ: Clinical implications of the stress response. J Clin Invest 95: 3–12, 1995.

9. Howard M, Roux J, Lee H, Miyazawa B, Lee J, Gartland B, Howard AJ, Matthay MA, Carles M, Pittet JF: Activation of the stress protein response inhibits the STAT1 signaling pathway and iNOS function in alveolar macrophages: role of Hsp90 and Hsp70. Thorax 65: 346–353, 2010.

10. Pespeni MH, Hodnett M, Abayasiriwardana KS, Roux J, Howard M, Broaddus VC, Pittet JF: Sensitization of mesothelioma cells to tumor necrosis factor–related apoptosis-inducing ligand–induced apoptosis by heat stress via the inhibition of the 3-phosphoinositide-dependent kinase 1/Akt pathway. Cancer Res 67: 2865–2871, 2007.

11. Pittet JF, Lee H, Pespeni M, O’Mahony A, Roux J, Welch WJ: Stress-induced inhibition of the NF-kappaB signaling pathway results from the insolubilization of the IkappaB kinase complex following its dissociation from heat shock protein 90. J Immunol 174: 384–394, 2005.

12. Zhao R, Davey M, Hsu YC, Kaplanek P, Tong A, Parsons AB, Krogan N, Cagney G, Mai D, Greenblatt J, et al.: Navigating the chaperone network: an integrative map of physical and genetic interactions mediated by the hsp90 chaperone. Cell 120: 715–727, 2005.

13. Kamal A, Boehm MF, Burrows FJ: Therapeutic and diagnostic implications of Hsp90 activation. Trends Mol Med 10: 283–290, 2004.

14. Goldfarb SB, Kashlan OB, Watkins JN, Suaud L, Yan W, Kleyman TR, Rubenstein RC: Differential effects of Hsc70 and Hsp70 on the intracellular trafficking and functional expression of epithelial sodium channels. Proc Natl Acad Sci U S A 103: 5817–5822, 2006.

15. Kim K, Kim W, Rhee JE, Jo YH, Lee JH, Kim KS, Kwon WY, Suh GJ, Lee CC, Singer AJ: Induced hypothermia attenuates the acute lung injury in hemorrhagic shock. J Trauma 68: 373–381, 2010.

16. Koh Y, Lim CM, Kim MJ, Shim TS, Lee SD, Kim WS, Kim DS, Kim WD: Heat shock response decreases endotoxin-induced acute lung injury in rats. Respirology 4: 325–330, 1999.

17. McCormick PH, Chen G, Tlerney S, Kelly CJ, Bouchier-Hayes DJ: Clinically relevant thermal preconditioning attenuates ischemia-reperfusion injury. J Surg Res 109: 24–30, 2003.

18. Ribeiro SP, Villar J, Downey GP, Edelson JD, Slutsky AS: Sodium arsenite induces heat shock protein-72 kilodalton expression in the lungs and protects rats against sepsis. Crit Care Med 22: 922–929, 1994.

19. Villar J, Ribeiro SP, Mullen JB, Kuliszewski M, Post M, Slutsky AS: Induction of the heat shock response reduces mortality rate and organ damage in a sepsis-induced acute lung injury model. Crit Care Med 22: 914–921, 1994.

20. Chatterjee A, Dimitropoulou C, Drakopanayiotakis F, Antonova G, Snead C, Cannon J, Venema RC, Catravas JD: Heat shock protein 90 inhibitors prolong survival, attenuate inflammation, and reduce lung injury in murine sepsis. Am J Respir Crit Care Med 176: 667–675, 2007.

21. Hiratsuka M, Yano M, Mora BN, Nagahiro I, Cooper JD, Patterson GA: Heat shock pretreatment protects pulmonary isografts from subsequent ischemia-reperfusion injury. J Heart Lung Transplant 17: 1238–1246, 1998.

22. Weiss YG, Maloyan A, Tazelaar J, Raj N, Deutschman CS: Adenoviral transfer of Hsp-70 into pulmonary epithelium ameliorates experimental acute respiratory distress syndrome. J Clin Invest 110: 801–806, 2002.

23. Ganter MT, Ware LB, Howard M, Roux J, Gartland B, Matthay MA, Fleshner M, Pittet JF: Extracellular heat shock protein 72 is a marker of the stress protein response in acute lung injury. Am J Physiol Lung Cell Mol Physiol 291: L354–L361, 2006.

24. Roux J, Carles M, Koh H, Goolaerts A, Ganter MT, Chesebro BB, Howard M, Houseman BT, Finkbeiner W, Shokat KM, et al.: Transforming growth factor beta1 inhibits cystic fibrosis transmembrane conductance regulator–dependent cAMP-stimulated alveolar epithelial fluid transport via a phosphatidylinositol 3-kinase-dependent mechanism. J Biol Chem 285: 4278–4290, 2010.

25. De Nardo D, Masendycz P, Ho S, Cross M, Fleetwood AJ, Reynolds EC, Hamilton JA, Scholz GM: A central role for the Hsp90.Cdc37 molecular chaperone module in interleukin-1 receptor–associated kinase–dependent signaling by Toll-like receptors. J Biol Chem 280: 9813–9822, 2005.

26. Liu XY, Seh CC, Cheung PC: Hsp90 is required for TAK1 stability but not for its activation in the pro-inflammatory signaling pathway. FEBS Lett 582: 4023–4031, 2008.

27. Shi L, Zhang Z, Fang S, Xu J, Liu J, Shen J, Fang F, Luo L, Yin Z: Heat shock protein 90 (Hsp90) regulates the stability of transforming growth factor beta–activated kinase 1 (TAK1) in interleukin-1beta-induced cell signaling. Mol Immunol 46: 541–550, 2009.

28. Godzich M, Hodnett M, Frank JA, Su G, Pespeni M, Angel A, Howard MB, Matthay MA, Pittet JF: Activation of the stress protein response prevents the development of pulmonary edema by inhibiting VEGF cell signaling in a model of lung ischemia-reperfusion injury in rats. FASEB J 20: 1519–1521, 2006.

29. Laffon M, Lu LN, Modelska K, Matthay MA, Pittet JF: alpha-Adrenergic blockade restores normal fluid transport capacity of alveolar epithelium after hemorrhagic shock. Am J Physiol Lung 1277: L760–L768, 1999.

30. Wang X, Liu Y: Regulation of innate immune response by MAP kinase phosphatase-1. Cell Signal 19: 1372–1382, 2007.

31. Sanlorenzo L, Zhao B, Spight D, Denenberg AG, Page K, Wong HR, Shanley TP: Heat shock inhibition of lipopolysaccharide-mediated tumor necrosis factor expression is associated with nuclear induction of MKP-1 and inhibition of mitogen-activated protein kinase activation. Crit Care Med 32: 2284–2292, 2004.

32. Wong HR, Dunsmore KE, Page K, Shanley TP: Heat shock–mediated regulation of MKP-1. Am J Physiol Cell Physiol 289: C1152–C1158, 2005.

33. Lee KH, Lee CT, Kim YW, Han SK, Shim YS, Yoo CG: Preheating accelerates mitogen-activated protein (MAP) kinase inactivation post-heat shock via a heat shock protein 70-mediated increase in phosphorylated MAP kinase phosphatase-1. J Biol Chem 280: 13179–13186, 2005.

34. Nimah M, Zhao B, Denenberg AG, Bueno O, Molkentin J, Wong HR, Shanley TP: Contribution of MKP-1 regulation of p38 to endotoxin tolerance. Shock 23: 80–87, 2005.

35. Shi Y, Tu Z, Tang D, Zhang H, Liu M, Wang K, Calderwood SK, Xiao X: The inhibition of LPS-induced production of inflammatory cytokines by Hsp70 involves inactivation of the NF-kappaB pathway but not the MAPK pathways. Shock 26: 277–284, 2006.

36. Choo-Kang LR, Zeitlin PL: Induction of Hsp70 promotes DeltaF508 CFTR trafficking. Am J Physiol Lung Cell Mol Physiol 281: L58–L68, 2001.

37. Matthay MA, Ware LB, Zimmerman A: The acute respiratory distress syndrome. J Clin invest 122: 2731–2740, 2012.

38. Pittet JF, Lee H, Morabito D, Howard MB, Welch WJ, Mackersie RC: Serum levels of Hsp 72 measured early after trauma correlate with survival. J Trauma 52: 611–617, 2002.

Keywords:

Lung; stress protein response; αENaC; p38 MAP kinase; IRAK-1; TAK-1

©2013The Shock Society

Follow Us

Login

Article Tools

Images

Share

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.