Skip Navigation LinksHome > October 2013 - Volume 1 - Issue 7 > HSL Attenuates the Follicular Oxidative Stress and Enhances...
Plastic and Reconstructive Surgery - Global Open:
doi: 10.1097/GOX.0000000000000000
Ideas and Innovations

HSL Attenuates the Follicular Oxidative Stress and Enhances the Hair Growth in ob/ob Mice

Minematsu, Takeo PhD*; Nishijima, Yoshimi PhD*; Huang, Lijuan PhD*; Nakagami, Gojiro PhD*; Ohta, Yasunori PhD; Kurata, Sotaro PhD; Sanada, Hiromi PhD*

Open Access
Japan
Article Outline
Collapse Box

Author Information

From the *Department of Gerontological Nursing/Wound Care Management, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan; Department of Pathology, Research Hospital, The Institute of Medical Science, The University of Tokyo, Tokyo, Japan; and Kurata Clinic, Beppu, Oita, Japan.

Received for publication July 31, 2013; accepted August 30, 2013.

Disclosure: The authors have no financial interest to declare in relation to the content of this article. This study was supported by the Adaptable and Seamless Technology Transfer Program of the Japan Science and Technology Agency. This study was funded by Aderans (Tokyo, Japan). The sponsor of the study had no role in the study design, conduct of the study, data collection, data interpretation, or preparation of the report. The Article Processing Charge was paid for by the authors.

Hiromi Sanada, Department of Gerontological Nursing/Wound Care Management, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan. E-mail: hsanada-tky@umin.ac.jp

Reprints: Takeo Minematsu, PhD, Department of Gerontological Nursing/Wound Care Management, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan, E-mail: tminematsu-tky@umin.ac.jp

This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License, where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially.

Collapse Box

Abstract

Summary: We demonstrated enhanced hair regeneration following topical administration of N-(3-oxododecanoyl)-L-homoserine lactone (HSL) in ob/ob mice. The ob/ob mice showed delayed hair regeneration (more than 6 wk) after depilation, which rapidly induced transition to anagen in the hair cycle in wild-type mice. Vehicle and HSL solutions were applied to the depilated dorsal skin of ob/ob mice. The depilated skin of the HSL-treated mice was fully covered with hair, whereas no macroscopic alteration was observed in vehicle-treated group by the fourth week after depilation. Oxidative stress was drastically decreased and the expression of the antioxidative enzymes PON1 and PON3 was increased in the HSL-treated skin with highly proliferative anagen follicles. These results suggest that HSL is a candidate therapeutic agent for alopecia in metabolic syndrome.

Alopecia markedly reduces a patient’s quality of life1 and is thus an important topic in nursing science. Administrations of minoxidil and finasteride are the most established treatments for androgenetic alopecia at present.2,3 However, their efficacy varies among individuals,4 suggesting that some intrinsic factors affect the pathology and/or treatment of androgenetic alopecia. Recently, some researchers have identified an association between alopecia and metabolic syndrome (MS).5 We and other researchers have shown elevated oxidative stress in the skin of patients with MS6–8 and in the scalp of patients with alopecia areata.9 Furthermore, reduced activity of paraoxonases (PONs, antioxidant enzymes) has been shown in patients with alopecia areata.10 Therefore, we hypothesized that the administration of the substrate of PONs would attenuate oxidative stress and enhance progression in the hair cycle in the skin of MS model mice. In this study, we demonstrated the promoting effects of N-(3-oxododecanoyl)-L-homoserine lactone (HSL), a substrate of PONs, applied topically to the back of ob/ob mice on hair growth through the attenuation of oxidative stress.

Back to Top | Article Outline

MATERIALS AND METHODS

All animal experiments were approved by the Animal Research Committee of The University of Tokyo.

Back to Top | Article Outline
Depilation and HSL Treatment

We purchased 8-week-old male MS model (ob/ob) and wild-type (+/+) mice from Japan SLC (Hamamatsu, Japan). After removal of the hair from the dorsal skin using depilatory cream (day 0), 5 +/+ mice and 5 ob/ob mice were regularly monitored until the depilated area was mostly covered with hair.

HSL (Sigma-Aldrich, St. Louis, Mo.) was dissolved in dimethyl sulfoxide at a concentration of 10 mM and diluted to 10 µM using a 30% glycerol solution. Glycerol solution supplemented with 0.1% dimethyl sulfoxide was used as a vehicle solution. HSL or vehicle solution (50 µl) was applied to the dorsal skin of the ob/ob mice the day after depilation. The animals treated with HSL or vehicle (5 animals in each treatment) were regularly monitored until day 28 or killed on day 21. Skin was removed from the center of the back and the skin from each mouse was divided into 2 pieces.

Back to Top | Article Outline
Histological Analysis

One piece of tissue was fixed with 4% paraformaldehyde and embedded in paraffin. Four-micrometer-thick serial sections were stained with hematoxylin and eosin for immunofluorescence using rabbit polyclonal anti-Ki67 antibody (Novus Biologicals, Littleton, Colo.) and immunohistochemistry using mouse anti-8OHdG monoclonal antibody (JaICA, Shizuoka, Japan).

Back to Top | Article Outline
Reverse Transcription-Polymerase Chain Reaction

Total RNA was extracted from the homogenate of the other piece of harvested tissue using an RNeasy Plus mini kit (Qiagen, Venlo, the Netherlands). Reverse transcription-polymerase chain reaction was performed using a QuantiTect Reverse Transcription kit (Qiagen), AmpliTaq Gold PCR Master Mix (Life Technologies, Carlsbad, Calif.), and specific primer pairs for the following genes:

18S ribosomal RNA (18S rRNA): forward, TCAAGAACGAAAGTCGGAGG; reverse, CCCTTCCGTCAATTCCTTTA

Pon1: forward, TGTACCTACTGGTGGTAAAC; reverse, AAAAGCTCTCAGGTCCAATA

Pon2: forward, GTAAACCACCCACAATTCAA; reverse, CCCAGTGTAGGTTCAAGTAT

Pon3: forward, CCAAAAGAGGTCAAAGTTGT; reverse, GATCAACGGTCAAGTTATCC

The target sequences were amplified by a standard 3-step protocol: preheating at 95°C for 10 minutes, 25 (18S rRNA) or 40 (other genes) cycles of denaturation (95°C for 15 s), annealing (60°C for 15 s) and extension (72°C for 30 s), and a final extension step at 72°C for 1 minute. The amplicons were separated by 2% agarose gel electrophoresis (50 V, 40 min), stained with SYBR Green I, and visualized under ultraviolet light.

Back to Top | Article Outline

RESULTS

The hair-cycle phase is known to reach the second telogen phase in wild-type mice at the age of 8 weeks.11 Depilation induced a rapid transition to anagen as shown by skin pigmentation by the first week and abundant hair regeneration by the fourth week in +/+ mice (Fig. 1A). Conversely, only slight pigmentation was observed and not until the sixth week after depilation in ob/ob mice (Fig. 1B).

Fig. 1
Fig. 1
Image Tools

When the HSL solution was applied to the dorsal skin of ob/ob mice, pigmentation was observed by the third week and the regenerated hair fully covered the depilated skin by the fourth week, whereas no pigmentation or hair regeneration was observed in vehicle-treated ob/ob mice (Fig. 2A). Histological examination revealed that the elongated hair follicles reached the deeper layer of subcutaneous fat tissue, the dermal papilla was completely enclosed by the developed hair bulb, and hair shaft regeneration was observed in HSL-treated skin tissue (Fig. 2B). Immunofluorescence for Ki67 revealed activated cell proliferation in the inner and outer root sheaths of HSL-treated follicles (Fig. 2C).

Fig. 2
Fig. 2
Image Tools

The level of oxidative stress was examined by immunohistochemistry for 8OHdG. A large number of follicular cells were positive for 8OHdG in the vehicle-treated ob/ob mice. HSL treatment drastically reduced the number of positive cells (Fig. 2D). Expression of Pon1 mRNA was slightly higher in HSL-treated samples than in vehicle-treated samples. Pon3 was expressed weakly in HSL-treated samples but was completely negative in vehicle-treated samples. Pon2 was stably expressed in both groups (Fig. 2E).

Back to Top | Article Outline

DISCUSSION

This study identified HSL as a novel reagent able to promote hair growth in a mouse model of MS. The findings suggest that attenuation of oxidative stress was a mechanism by which HSL treatment enhanced hair growth.

HSL is an interbacterial signaling molecule in Pseudomonas quorum sensing, which is a regulatory system that induces the expression of virulence genes depending on bacterial density.12 PONs protect against bacterial infection by degrading HSL.13 Pon2 is dominantly expressed in a wide range of tissues, and Pon1 and Pon3 are mainly expressed in the liver and secreted into the serum.14 We found that Pon1 was expressed in the skin of MS mice, probably owing to the response to the elevated oxidative stress in MS skin.6–8 HSL administration slightly increased the expression of Pon1 and Pon3 in the skin of ob/ob mice. However, elevation in expression of Pon1 and Pon3 was not enough to explain the drastic reduction in oxidative stress in hair follicles of ob/ob mice. Further studies to examine PON enzyme activities and the expression of other antioxidative enzymes are required.

Because HSL is a small lipid-soluble molecule (approximately 300 Da), it can be delivered topically and noninvasively to the skin.15 HSL is a potential novel therapeutic agent for alopecia in MS.

Back to Top | Article Outline

REFERENCES

1. Sawant N, Chikhalkar S, Mehta V, et al. Androgenetic alopecia: quality-of-life and associated lifestyle patterns. Int J Trichol. 2010;2:81–85

2. Vermorken AJ. Reversal of androgenic alopecia by minoxidil: lack of effect of simultaneously administered intermediate doses of cyproterone acetate. Acta Derm Venereol. 1983;63:268–269

3. Diani AR, Mulholland MJ, Shull KL, et al. Hair growth effects of oral administration of finasteride, a steroid 5 alpha-reductase inhibitor, alone and in combination with topical minoxidil in the balding stumptail macaque. J Clin Endocrinol Metab. 1992;74:345–350

4. Olsen EA, Whiting D, Bergfeld W, et al. A multicenter, randomized, placebo-controlled, double-blind clinical trial of a novel formulation of 5% minoxidil topical foam versus placebo in the treatment of androgenetic alopecia in men. J Am Acad Dermatol. 2007;57:767–774

5. Su LH, Chen TH. Association of androgenetic alopecia with metabolic syndrome in men: a community-based survey. Br J Dermatol. 2010;163:371–377

6. Nagase T, Akase T, Sanada H, et al. Aging-like skin changes in metabolic syndrome model mice are mediated by mineralocorticoid receptor signaling. Aging Cell. 2013;12:50–57

7. Ibuki A, Akase T, Nagase T, et al. Skin fragility in obese diabetic mice: possible involvement of elevated oxidative stress and upregulation of matrix metalloproteinases. Exp Dermatol. 2012;21:178–183

8. Akase T, Nagase T, Huang L, et al. Aging-like skin changes induced by ultraviolet irradiation in an animal model of metabolic syndrome. Biol Res Nurs. 2012;14:180–187

9. Akar A, Arca E, Erbil H, et al. Antioxidant enzymes and lipid peroxidation in the scalp of patients with alopecia areata. J Dermatol Sci. 2002;29:85–90

10. Bilgili SG, Ozkol H, Karadag AS, et al. Serum paraoxonase activity and oxidative status in subjects with alopecia areata. Cutan Ocul Toxicol. 2013;32:290–293

11. Alonso L, Fuchs E. The hair cycle. J Cell Sci. 2006;119(Part 3):391–393

12. Miller MB, Bassler BL. Quorum sensing in bacteria. Annu Rev Microbiol. 2001;55:165–199

13. Ozer EA, Pezzulo A, Shih DM, et al. Human and murine paraoxonase 1 are host modulators of Pseudomonas aeruginosa quorum-sensing. FEMS Microbiol Lett. 2005;253:29–37

14. Simanski M, Babucke S, Eberl L, et al. Paraoxonase 2 acts as a quorum sensing-quenching factor in human keratinocytes. J Invest Dermatol. 2012;132:2296–2299

15. Bos JD, Meinardi MM. The 500 Dalton rule for the skin penetration of chemical compounds and drugs. Exp Dermatol. 2000;9:165–169

© 2013 American Society of Plastic Surgeons