Assessment of mutations in KCNN2 and ZNF135 to patient neurological symptoms

Raghuram, Vijeta; Weber, Sydney; Raber, Jacob; Chen, Dong-Hui; Bird, Thomas D.; Maylie, James; Adelman, John P.

doi: 10.1097/WNR.0000000000000754
Cellular, Molecular and Developmental Neuroscience

Exome sequencing from a patient with neurological and developmental symptoms revealed two mutations in separate genes. One was a homozygous transition mutation that results in an in-frame, premature translational stop codon in the ZNF135 gene predicted to encode a transcriptional repressor. Another mutation was heterozygous, a single nucleotide duplication in the KCNN2 gene that encodes a Ca2+-activated K+ channel, SK2, and leads to a translational frame shift and a premature stop codon. Heterologous expression studies, brain slice recordings, and coordination tests from a transgenic mouse line carrying the SK2 mutation suggest that it does not contribute to the patient’s symptoms. ZNF135 is expressed in human brain and it is likely that the homozygous mutation underlies the human phenotype.

aVollum Institute

bDepartment of Behavioral Neuroscience

cDepartment of Obstetrics and Gynecology, Oregon Health and Science University, Portland, Oregon

dDepartment of Neurology, Geriatric Research (GRECC), VA Puget Sound Healthcare System, University of Washington, Seattle, Washington, USA

Correspondence to John P. Adelman, Vollum Institute, L474, Oregon Health and Science University, 3181 SW Sam Jackson Park Road, Portland, OR 97239 3098, USA Tel: +1 503 494 5450; fax: +1 503 494 4590; e-mail: adelman@ohsu.edu

This is an open access article distributed under the Creative Commons Attribution License 4.0 (CCBY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. http://creativecommons.org/licenses/by/4.0/

Received January 25, 2017

Accepted January 30, 2017

Article Outline
Back to Top | Article Outline

Introduction

SK2 channels are tetrameric assemblies of subunits that are also coassembled with the Ca2+ sensor calmodulin that serves as the gating switch 1. The SK channels are selectively blocked by the bee venom toxin apamin and affect neuronal excitability, synaptic transmission, and synaptic plasticity 2. The c.581dupA mutation in SK2 produces a truncated subunit. Neither parent carries the c.581dupA in KCNN2.

The ZNF135 gene encodes a putative transcriptional repressor protein. The mutation found in the patient (c.1156 C>T; R386X) would abolish the Zn2+ finger region and likely abrogate function. Both parents were heterozygous for the mutation, but did not present an obvious phenotype.

Back to Top | Article Outline

Methods

Exome sequencing

Exome sequencing was carried out and analyzed using GeneDx (Gaithersburg, Maryland, USA).

Back to Top | Article Outline

SK2 knock in mice

To generate SK2 knock in mice, CRISPR/Cas9 gene editing was used. An optimal target site for the CRISPR complex in the second exon of the mouse KCNN2 gene was identified using the online tool at crispr.mit.edu. The single-guide RNA design and synthesis using pX330 (Addgene, Cambridge, Massachusetts, USA) was carried out as described by Yang et al. 3.

A 181 nucleotide single-stranded oligodeoxynucleotide of the sequence: gctgtattctttagctctgaaatgccttatcagtctctccacgatcatc ctgcttggtctgatcatcgtgtatcatgctagagaaatacaAggtaacacaggctc cactgttttctgaataaccagaagccatgcaggcagcataggagaaaagc aagacagcaaggggcctttaccaagc was purchased as an Ultramer (Integrated DNA Technologies Inc., Coralville, Iowa, USA) and dissolved in RNase-free water to a concentration of 10 μM. An injection cocktail of Cas9 mRNA (100 ng/μl; Trilink Biotechnologies Inc., San Diego, California, USA), SK2 single-guide RNA (50 ng/μl), single-stranded oligodeoxynucleotide (100 ng/μl), and SCR7 (1 mM; Xcess Biosciences Inc., San Diego, California, USA) was injected into the cytoplasm of 218 zygotes of C57BL/6 mice. From them, 46 pups were born and three pups harbored the targeted mutation.

Genotyping was accomplished using the Surveyor assay and DNA sequencing. Mice harboring the desired mutation were bred to assure germ-line transmission, and offspring of the appropriate genotypes were used for experiments (Fig. 1).

Back to Top | Article Outline

Motor coordination

Motor coordination in 10–12-week-old wild-type mice and SK2-L195VfsX10 heterozygotes was assessed on an accelerating rotarod. Mice were placed on an elevated rotating rod (diameter: 3 cm, elevated: 45 cm, Rotamex-5; Columbus Instruments, Columbus, Ohio, USA), initially rotating at 5.0 rpm. The rod accelerated 1.0 rpm every 3 s. A line of photobeams beneath the rod recorded the latency to fall (s). Each mouse received 10 trials over 4 days – one trial on day 1 and three trials each on days 2, 3, and 4 with an average of 60 min delay between trials.

Back to Top | Article Outline

Molecular biology

The DNA coding for the hSK2-S wild type and hSK2-S-L195VfsX10 mutation (SK2-WT and SK2-L195VfsX10) were purchased as synthetic gene fragments with codon optimization from IDT. These gene fragments were then cloned into pCAG-Ires-GFP, pCAG-Ires-Apple or pJPA5 vectors by Gibson Assembly with the help of the Gibson Assembly kit (New England Biolabs, Ipswich, Massachusetts, USA). A triple myc epitope was incorporated between amino acids 246 and 247 of the wild-type sequence in the loop region between transmembrane (TM) domains 3 and 4. A HA-tag was introduced between the amino acids 162 and 163 in the hSK2-L195VfsX10 protein (loop region between TMs 1 and 2) by site-directed mutagenesis.

The RT-PCR on human brain mRNA used poly A+RNA from adult and fetal brains purchased from Clontech Laboratories Inc. (Mountain View, California, USA). Expression of hZNF135 mRNA was tested using gene-specific primers and AccessQuick RT-PCR system (Promega Corp., Madison, Wisconsin, USA) followed by DNA sequencing of the PCR product.

Back to Top | Article Outline

Transfection and immunostaining

Transfections into HEK293 cells used Lipofectamine (Thermo Fisher Scientific Inc., Waltham, Massachusetts, USA) on poly-D-lysine-coated microscopic cover glasses in 12-well tissue culture plates. Immunocytochemistry was carried out 24–48 h post-transfection 4.

Back to Top | Article Outline

Slice preparation and electrophysiology

All procedures were carried out in accordance with the IACUC guidelines of Oregon Health and Science University (Portland, Oregon, USA). Animals were anesthetized with isoflurane and decapitated. Transverse hippocampal slices were prepared from 4–5-week-old SK2-L195VfsX10 heterozygous mice and wild-type littermates 5. Whole-cell, patch-clamp recordings were obtained from CA1 pyramidal cells using a HEKA EPC 10 plus patch clamp, digitized using the built-in ITC-18 analog-to-digital converter, and transferred to a computer using Patchmaster software (Heka Instruments Inc., Bellmore, New York, USA). Patch pipettes (open pipette resistance, 2–4 MΩ) were filled with (in mM) 133 K-gluconate, 4 KCl, 4 NaCl, 1 MgCl2, 10 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, 4 MgATP, 0.3 Na2-guanosine triphosphate, and 10 phosphocreatine (pH 7.2). Series resistance was electronically compensated to greater than 70%. All the recordings were carried out at room temperature (22–24°C). CA1 neurons were clamped at −55 mV and stepped to 20 mV for 200 ms; tail currents were elicited upon stepping back to −55 mV. Data were not corrected for a junction potential of ∼18 mV.

For HEK293 cell recordings, cells were transfected with hSK2-S wild-type pCAGIG and L195VfsX10 pCAGIA. Recordings were carried out at room temperature (22–24°C) 1–3 days after transfection 4. Transfected cells were identified by the presence of dual fluorescence from eGFP and mApple. Currents were evoked using 2 s voltage ramps from −100 to 60 mV. Apamin-sensitive current was measured at −100 mV as the difference current before and after the addition of 100 nM apamin to the bath through a perfusion pencil.

Data were analyzed using IGOR (WaveMetrics, Lake Oswego, Oregon, USA). Data are expressed as mean±SEM. The nonparametric Wilcoxon Mann–Whitney two-sample rank test was used to determine significance between groups of data; P value of less than 0.05 was considered significant.

Back to Top | Article Outline

Results

Patient description

The patient is presently a 43-year-old woman. She was born 1 month premature and had an initial Apgar score of 0. She was quickly resuscitated and spent 2 weeks in the neonatal ICU. Her developmental milestones were moderately slow, crawling at 10 months and walking at 16 months. She had tonic–clonic seizures starting at the age of 5 that have been well controlled on medication. She was able to ride a bicycle and graduated from high school with average grades. Her intellectual abilities were thought to be normal or low-normal. Because of mild persistent incoordination she was considered to have cerebral palsy. At age 17 because of stiff legs and brisk reflexes a neurology consultant considered dopa-responsive dystonia and placed her on levodopa/carbidopa with mild but incomplete improvement in her walking. In her 20s she began to use ankle–foot orthoses, in her early 30s she was using a four-wheel walker, and in her late 30s she had to use a wheelchair. At age 40 her positive findings were marked ataxia of gait, dysarthria, bilateral finger to nose dysmetria, decreased tendon reflexes in her arms, increased tone, and exaggerated tendon reflexes in her legs with ankle clonus but down going plantar responses. The best clinical diagnosis is spastic ataxia with seizures. Mental status, eye movements, and sensory testing were normal. She did not have Parkinsonian features. Brain MRI showed normal cerebellum, brainstem, and cerebral cortex with mild nonspecific white matter intensities on T2 imaging in posterior regions. At age 42 she developed persistent vomiting, was found to have gastric paresis, and required a feeding tube. The spasticity in her legs worsened, she became confined to a bed, and a baclofen pump lessened the stiffness in her lower limbs. Her parents were normal with no family history of neurologic disorders.

Back to Top | Article Outline

Identification of mutations by whole exome sequencing

Exome sequencing revealed a homozygous mutation in ZNF135 (c.1156 C>T; accession number: P52742) that results in a premature translational stop codon (p.R386X). The SK2 mutation is heterozygous, a single nucleotide duplication (c.581dupA) in the KCNN2 gene (NM_021614.3) (accession numbers: NP_067627.2, XP_006714676.1), and results in a translational frame shift and a premature translational stop codon (p.L195VfsX10). No other mutation was found in the exome.

Back to Top | Article Outline

SK2-L195VfsX10 do not act as dominant negative subunits

The L195VfsX10 mutation predicts an SK2 subunit containing the intracellular N-terminal domain and the first two TMs. To test whether the mutant subunits confer a dominant negative effect, the SK2-L195VfsX10 subunit was expressed alone or together with wild-type subunits in HEK293 cells. When SK2-L195VfsX10 subunits (or the empty vector) were expressed alone, whole cell recordings with an internal pipet solution containing 111 µM free Ca2+ failed to detect SK channel currents in response to voltage ramp commands (−0.1±0.0 nA, n=6; Fig. 2a). When expressed together with wild-type SK2, the ramp currents reversed near the predicted K+ reversal potential of −38 mV, and the apamin-sensitive SK current amplitudes measured at −100 mV (−4.7±1.3 nA, n=5; Fig. 2b) were not different from those recorded from HEK293 cells expressing wild-type SK2 alone (−4.1±0.9 nA, n=6; P=0.75; Fig. 2c). In addition, live cell staining for an external epitope tag (see Methods section) failed to detect the L195VfsX10 subunit in the plasma membrane, whether expressed alone or together with wild-type SK2 subunits (Fig. 2e). Rendering the cells permeable revealed intracellular L195VfsX10 expression (Fig. 2f). Thus, in a heterologous system, SK2-L195VfsX10 subunits do not exert a dominant negative effect.

Back to Top | Article Outline

KCNN2 L195VfsX10 mice

To test whether SK2-L195VfsX10 resulting in haploinsifficiency contributes to symptoms consistent with the human patient carrying the heterozygous mutation, CRISPR-Cas9 gene editing was used to knock in the mutation in the mouse KCNN2 gene (c.566 dupA). Cohorts of 10–12 weeks old, adult SK2-L195VfsX10 heterozygous mice or wild-type mice were tested for coordination performance using the accelerating rotarod test. No differences in performance were seen between SK2-L195VfsX10 heterozygous mice and wild-type littermates (Fig. 3a). Similar to SK2-/- mice, SK2-L195VfsX10 homozygous mice displayed a tremor and were not studied further as the patient is heterozygous.

SK2 channels are expressed in CA1 pyramidal neurons in the hippocampus 6. To determine whether expression of L195VfsX10 in mice altered SK2 channel function, whole cell recordings from CA1 pyramidal neurons were carried out on hippocampal brain slices. Tail currents evoked following a depolarizing command yielded apamin-sensitive SK component that was not different between wild-type (95.0±10.3 pA, n=12) and heterozygous L195VfsX10 mice (78.2±12.8 pA, n=14; P=0.37; Fig. 3b and c). Taken together with the results described above, it is unlikely that the SK2-L195VfsX10 mutation is the primary cause of the symptoms displayed by the human patient.

Back to Top | Article Outline

The ZNF135 gene

ZNF135 is predicted to encode a transcriptional repressor proteins 7. To determine whether ZNF135 is expressed in human brain, RT-PCR was carried out on mRNA isolated from human fetal and adult brain. PCR product size and DNA sequencing confirmed the identity of the band. These results show that ZNF135 is expressed in both fetal and adult human brain (Fig. 4). Testing whether the homozygous mutation in ZNF135 underlies the human patient disorder using mouse model proved problematic as database searches did not reveal the existence of a ZNF135 ortholog in mouse or rat. However, ZNF135 expression in human brain, taken together with the lack of effect of L195VfsX10 in KCNN2 when present in a mouse model suggests that the human patient’s symptoms are caused by homozygous c.1156 C>T mutation in ZNF135.

Back to Top | Article Outline

Discussion

The c.581dupA mutation appears to be a de-novo mutation, as neither parent carries the mutation. Moreover, the c.581dupA mutation was not observed in ∼6500 individuals of European and African American ancestry and was not reported in any single nucleotide polymorphism database including ExAc, indicating it is not a common benign variant in these populations. Examining heterologously coexpressed mutant and wild-type subunits indicated that the mutant subunit does not act as a dominant negative. In addition, heterozygous c.581dupA (L195VfsX10) mice showed no change in the SK-mediated component of tail currents or behavioral performance in the rotarod test. Thus, it is unlikely that the c.581dupA mutation is responsible for the symptoms in the human patient.

The other mutation was in the ZNF135 gene that is expressed in human fetal and adult brain. The mutation is a single nucleotide transition (c.1156 C>T), is homozygous in the patient, and each parent carries one allele with the mutation. However, neither parent exhibited symptoms. While the patient is the first known homozygote, the R386X variant was observed with a frequency of 0.19% (17/8600 allele) in individuals of European ancestry and thus may underlie neurological deficits in other patients for which the specific mutation has not been established. The most parsimonious conclusion from these results is that the homozygous c.1156 C>T mutation in ZNF135 is responsible for the symptoms in the human patient.

Back to Top | Article Outline

Acknowledgements

The authors thank Dr Fuki Hisama for support with patient evaluation and Lori Vaskalis for expert graphics. They also thank Dr Lev Fedorov and the transgenics core facility of OHSU for their help in gene targeting of mice.

This work was supported by NIH grants to J.M. and J.P.A.

Back to Top | Article Outline

Conflicts of interest

Dr Bird discloses two patents broadly related to this work (SCA14 and CMT1) for which he receives licensing fees. For the remaining authors there are no conflicts of interest.

Back to Top | Article Outline

References

1. Xia XM, Fakler B, Rivard A, Wayman G, Johnson-Pais T, Keen JE, et al. Mechanism of calcium gating in small-conductance calcium-activated potassium channels. Nature 1998; 395:503–507.
2. Adelman JP, Maylie J, Sah P. Small-conductance Ca2+-activated K+ channels: form and function. Annu Rev Physiol 2012; 74:245–269.
3. Yang L, Yang JL, Byrne S, Pan J, Church GM. CRISPR/Cas9-directed genome editing of cultured cells. Curr Protoc Mol Biol 2014; 10731:1–17.
4. Lee WS, Ngo-Anh TJ, Bruening-Wright A, Maylie J, Adelman JP. Small conductance Ca2+-activated K+ channels and calmodulin: cell surface expression and gating. J Biol Chem 2003; 278:25940–25946.
5. Lin MT, Luján R, Watanabe M, Adelman JP, Maylie J. SK2 channel plasticity contributes to LTP at Schaffer collateral-CA1 synapses. Nat Neurosci 2008; 11:170–177.
6. Bond CT, Herson PS, Strassmaier T, Hammond R, Stackman R, Maylie J, et al. Small conductance Ca2+-activated K+ channel knock-out mice reveal the identity of calcium-dependent afterhyperpolarization currents. J Neurosci 2004; 24:5301–5306.
7. Bellefroid EJ, Poncelet DA, Lecocq PJ, Revelant O, Martial JA. The evolutionarily conserved Krüppel-associated box domain defines a subfamily of eukaryotic multifingered proteins. Proc Natl Acad Sci USA 1991; 88:3608–3612.
Keywords:

apamin; ataxia; CRISPR-Cas system; human exome sequencing; neuroscience; SK potassium channel; transgenic mice; ZNF135

© 2017 Wolters Kluwer Health | Lippincott Williams & Wilkins