Skip Navigation LinksHome > March 2011 - Volume 6 - Issue 3 > p63 and p73 Isoform Expression in Non-small Cell Lung Cancer...
Journal of Thoracic Oncology:
doi: 10.1097/JTO.0b013e31820b86b0
Original Articles

p63 and p73 Isoform Expression in Non-small Cell Lung Cancer and Corresponding Morphological Normal Lung Tissue

Lo Iacono, Marco PhD; Monica, Valentina MS; Saviozzi, Silvia PhD; Ceppi, Paolo MS; Bracco, Enrico PhD; Papotti, Mauro MD; Scagliotti, Giorgio V. MD

Free Access
Article Outline
Collapse Box

Author Information

Department of Clinical and Biological Sciences, University of Turin, Turin, Italy.

Disclosure: The authors declare no conflicts of interest.

Address for correspondence: Marco Lo Iacono, PhD, Department of Clinical and Biological Sciences, University of Turin, S.Luigi Hospital, Regione Gonzole 10, 10043 Orbassano, Turin, Italy. E-mail: marco.loiacono@unito.it

Collapse Box

Abstract

Background: The TP73 and TP63 genes are members of the p53 tumor suppressor family and are expressed in different N-terminal isoforms either with proapoptotic (transactivation domain, TA) and antiapoptotic (N-terminally truncated, ΔN) function. Unlike p53, the role of p73 and p63 in tumor is controversial. It has been recently hypothesized that altered ΔN:TA expression ratio, rather than single isoform overexpression, plays a role in the pathogenesis of many diseases, including lung cancer.

Methods: Isoform-specific, real-time polymerase chain reaction and immunohistochemistry analysis on matched cancer and corresponding normal tissues from surgically resected non-small cell lung cancers (NSCLCs) have been performed aiming to explore the expression levels of each p63 and p73 N-terminal isoforms and their ΔN:TA expression ratio.

Results: For both p63 and p73, a N-terminal isoform-specific modulation that alter ΔN:TA isoform balance was identified. In particular, ΔNp63 isoform was significantly up-modulated, whereas TAp63 was slightly down-modulated in NSCLC specimens. Likewise, Δ2p73 and Δ2/3p73 were up-modulated, whereas ΔNp73 and ΔN′p73 isoforms were down-modulated. Moreover, a higher TAp63 and ΔN′p73 transcripts expression, detected in the normal tissue surrounding the tumors, correlates with poor patient outcome, representing independent prognostic factors for overall survival (ΔN′p73: p = 0.049, hazard ratio = 3.091, 95% confidence interval = 1.005–9.524 and TAp63: p = 0.001, hazard ratio = 8.091, 95% confidence interval = 2.254–29.05).

Conclusion: Our findings suggest that p63 and p73 altered ΔN:TA expression ratio occurs in NSCLC likely contributing to the molecular pathogenesis of this tumor.

The tumor suppressor p53 is a key transcription factor regulating the expression of genes influencing cell senescence, proliferation, apoptosis, and differentiation. The TP73 and TP63 genes are members of the p53 tumor suppressor family, based on substantial structural and functional homologies. Unlike p53, that is a tumor suppressor, the role of p73 and p63 in tumor is controversial because of their genomic locus complexity. Through either alternative exon splicing, or a second promoter, TP73 and TP63 genes generate several N- and C-terminal isoforms. The N-terminal isoforms can be clustered into two groups: the transactivation competent TA proteins (TAp63 and TAp73) and the transactivation-defective, N-terminally truncated ΔN proteins (ΔNp63, ΔN′p73, Δ2p73, Δ2/3p73, and ΔNp73).1 TAp63 and TAp73, and p53, transactivate genes that promote either cell cycle arrest or apoptosis.2,3 Conversely, ΔN isoforms act as dominant negative inhibitors of TA counterparts and p53 functions and in turn hamper apoptosis.2,3 Different p63 and p73 N-terminal isoform expression ratio triggers proproliferative and antiproliferative signals important for cell fate and normal cell cycling, senescence, or apoptosis decision making. Therefore, these regulations could be affected on neoplastic transformation.4

Mutations within the p53 gene are the most common genetic alterations present in lung cancer. Approximately 70% of small cell lung cancer cell lines and 50% of non-small cell lung cancer (NSCLC) cell lines harbor p53 mutations.5 In contrast, p63 and p73 mutations occur rarely in cancer,2,6,7 supporting the recent hypothesis that altered ΔN:TA expression ratio, rather than gene mutations, plays a role in cancer pathogenesis. Gene expression de-regulation of both p63 and p73 N-terminal isoforms is commonly observed in bladder, ovarian, breast, and colon cancers.8–11 In NSCLC, ΔNp73 protein expression correlates with poor prognosis.12 ΔNp63α overexpression, both at protein and messenger RNA (mRNA) levels, has been frequently reported to be associated with squamous histotype.13,14 Moreover, TAp73 up-modulation has been reported after cell exposure to a large variety of chemotherapeutic agents, and if its activity is blocked, an enhancement of chemoresistance is observed.15 In this article, we report quantitative evaluation of N-terminal p63 and p73 isoforms in tumor tissues and corresponding morphological normal tissues, obtained from the same resected lobe in patients with early stage NSCLC.

Back to Top | Article Outline

PATIENTS AND METHODS

Patients and Samples

Primary tumor and paired corresponding normal lung specimens of 46 consecutive NSCLC patients who underwent radical surgery at the San Luigi Hospital, Division of Thoracic Surgery, between December 2003 and March 2004, were analyzed. Median age of patients (34 men and 12 women) was 69 years (range 41–82 years), and none of them received either preoperative or postoperative chemotherapy or radio-therapy according to the institutional treatment policy for resectable rescue in those years. Histological examination was performed on formalin-fixed tissue in all cases, and tumors were diagnosed according to World Health Organization classification,16 including 26 adenocarcinomas, 17 squamous cell carcinomas, and 3 large cell carcinomas. Differentiation grade (grade 1: 9, grade 2: 18, and grade 3: 19 cases), pT status (pT1: 10, pT2: 33, pT3: 2, and pT4: 1 cases), and pN status (pN0: 32, pN1: 8, and pN2: 6 cases) were also recorded. According to the tumor, node, metastasis classification for solid tumors,17 29 cases resulted to be pathological stage I, 10 stage II, and 7 stage III. Follow-up was available in all cases. Informed consent was obtained from each patient, and the study was approved by the institutional review board of the San Luigi Hospital. All samples were deidentified and cases anonymized by a staff member not involved in the study. Clinical data were compared and analyzed through coded data.

Back to Top | Article Outline
RNA Extraction, Complementary DNA Synthesis, and Quantitative Polymerase Chain Reaction

Total RNA (totRNA) was isolated from all tissue specimens with the RNeasy 96 Kit and Biorobot 8000 (Qiagen, Hilden, Germany) according to the manufacturer's instructions. RNA was extracted from 15 to 25 mg and 60 to 80 mg of tumor and normal lung tissues specimens, respectively. Genomic DNA contamination was removed by on-column-DNAseI treatment (Qiagen). totRNA was then quantified with an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA) and stored at −80°C. Two micrograms of totRNA were finally retrotranscribed with random hexamer primers and Multiscribe Reverse transcription contained in the High Capacity complementary DNA Archive Kit (Applied Biosystems, Foster City, CA), in accordance with manufacturer's suggestions.

Expression levels of all target genes and ß-actin reference gene were evaluated with SYBR green (Applied Biosystems) technology with optimized polymerase chain reaction (PCR) condition and primer concentrations. Primer sequences were as follow: p53.FW:GCATTCTGGGACAGCCAAGT, p53.RW:CAGTTGGCAAAACATCTTGTTGA, p63.FW:GTCGAGCACCGCCAAGTC, p63.RW: TGGCAGTAGAGTTTCTTCAGTTCAGT, p73.FW:CCAGCACGGCCAAGTCA, p73.RW:CTTGGCGATCTGGCAGTAGAG, TAp63.FW:GGTTTTCCAGCATATCTGGGA, TAp63.RW:CAAGTCAATGGGCTGAACTGA, DNp63.FW:GAAAACAATGCCGAGACTCAATT, DNp63.RW:TGTTCAGGAGCCCCAGGTT, TAp73.FW:CGCCACCTCCCCTGATG, TAp73.RW:GTCGAAGTAGGTGCTGTCTGGTT, Dex2p73FW:GCTGCGACGGCTGCAGGG, Dex2p73.RW:TTCCGCCCACCACCTCATTATTC, Dex2/ex3p73.FW:CGATGCCCGGGGCT, Dex2/ex3p73.RW:GCGCGGCTGCTCATCT, DNp73.FW:CCACCTGGAGGGCATGACTA, DNp73.RW:CGCTTTTCCCATCTCCCTTAG, DN′p73.FW:CACGGCACCTCGCCAC, DN′p73.RW:ATCTGGTCCATGGTGCTGCT, ACTB.FW:GAGTCCGGCCCCTCCAT, and ACTB.RW: GCAACTAAGTCATAGTCCGCCTAGA. Melting curve analysis was performed for all the amplicons. Quantitative PCR was carried out on an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems) in 384-wells plates assembled by Biorobot 8000, and reactions were performed in a final volume of 20 μl. All quantitative PCR mixtures contained 1 μl of complementary DNA template, 1× SYBR Universal PCR Master Mix (2×, Applied Biosystems). Cycle conditions were as follows: after an initial 2-minute hold at 50°C to allow AmpErase: UNG (Applied Biosystems) activity, and 10 minutes at 95°C, the samples were cycled 40 times at 95°C for 15 seconds and 60°C for 1 minute. For Δ2/3p73 primers, annealing time was reduced down to 30 seconds and temperature was increased up to 65°C to obtain a specific amplicon. Baseline and threshold for Ct calculation were set manually with the ABI Prism SDS version 2.1 software (Applied Biosystems).

Back to Top | Article Outline
Immunohistochemistry

Formalin-fixed, paraffin-embedded tissues were cut into 4-μm thick sections and collected onto charged slides for immunohistochemical staining. After deparaffination and rehydration through graded alcohols and phosphate-buffered saline (pH 7.5), the endogenous peroxidase activity was blocked by incubation with absolute methanol and 0.3% hydrogen peroxide for 15 minutes. Sections were incubated at the optimal conditions with the following primary antibodies: (1) mouse monoclonal antibody anti-ki67 (1:300; MIB-1, DakoCytomation, Glostrup, Denmark); (2) rabbit polyclonal p73 (1:500; AB14430, Abcam, Cambridge, UK) epitope corresponding to the NH2-terminal region (this antibody recognizes the TAp73 isoforms but does not detect the ΔNp73 variant or p53); (3) mouse monoclonal ΔNp73 (1:500; AB13649, Abcam, Cambridge, UK) developed against a peptide corresponding to amino acids 2 to 13 of human ΔNp73 (LYVGDPARHLAT), and this antibody does not cross react with any TAp73 isoforms or p53; (4) goat polyclonal ab TA*p63 (1:100; sc-7254, Santa Cruz, CA); and (5) mouse monoclonal ΔNp63 (1:800; p40, Zymed Laboratories, San Francisco, CA). Immunoreaction was revealed by a dextran-chain (biotin-free) detection system (EnVision; DakoCytomation), using 3,3′-diaminobenzidine (DakoCytomation) as a chromogen. The sections were lightly counterstained with hematoxylin. Negative control reactions were obtained by omitting the primary antibody. ki67 proliferation index was calculated as the percentage of positive nuclei among at least 200 nuclei counted at high magnification in the areas of highest labeling.

Back to Top | Article Outline
Statistical Analysis

Isoform expression levels have been dichotomized into two groups of “high” and “low” expression using k-means algorithm and median cutoff for transcripts and protein expression, respectively. For each isoform, staining intensity and percentage of cells with nuclear and cytoplasmic expression were evaluated. Significant associations between patients' clinicopathological features and both transcript and protein expression levels were evaluated by the Pearson's χ2 test with Yates' continuity correction. Differential transcript expression between tumor and corresponding normal tissue samples were evaluated using t test for paired data. Using a threshold of ΔΔCt ±1 (fold change ±2), the expression ratios of N-terminal isoforms between tumor/normal tissues were clustered into three groups (up-regulation, down-regulation, or not regulated), and the association with clinicopathological variables was evaluated using the Kruskal-Wallis test. Kaplan-Meier plots and Log-rank tests were used for survival analysis. Overall survival time was calculated from the date of surgery to death or last follow-up date. Cox regression was used in the univariate survival analysis to determine the association of N-terminal isoform expression or tumor modulation with overall survival. All significant associations with p < 0.05 were subsequently subjected to the multivariate Cox regression analysis to determine the hazard ratios (HRs) and the independence of effects. Statistical analysis was performed using R statistical software (R Foundation for Statistical Computing, http://www.r-project.org/foundation/).18

Back to Top | Article Outline

RESULTS

In both tumor and paired morphological normal lung samples, p53 gene showed the highest transcript level and p73 the lowest (Figure 1A). In terms of N-terminal isoforms TAp63, TAp73, and ΔNp73 were highly expressed, whereas ΔN′p73 had the lowest transcript levels (Figures 1B, C).

Figure 1
Figure 1
Image Tools

Modulation of p63/p73 N-terminal isoforms was evaluated comparing expression in tumoral versus matched normal tissue (Figure 2). No difference in p63 and p73 mRNA expression was detected when whole transcript amplicons were evaluated. By contrast, when N-terminal isoforms were analyzed, ΔNp63 was significantly up-modulated (p = 0.02), whereas TAp63 was slightly down-modulated (p = 0.01). Likewise, Δ2p73 and Δ2/3p73 were up-modulated (all p < 0.001), whereas ΔNp73 and ΔN′p73 isoforms were down-modulated (all p < 0.001). These results suggest a complex TP63 and TP73 gene expression tuning in N-terminal isoforms modulation in NSCLC.

Figure 2
Figure 2
Image Tools

Correlations between p63/p73 N-terminal isoform transcripts levels and clinicopathological features were evaluated dichotomizing the results obtained in tumor specimens, in “high” and “low” expression, according to ΔCt levels. Moreover, clinicopathological variables were also correlated to p63 and p73 transcript modulation clustering tumors in up-regulated, down-regulated, and not-regulated, according to their ΔΔCt levels using a cutoff ΔΔCt ±1 (corresponding to fold change ±2). These results are summarized in Table 1. High p63 transcript levels in tumor specimens and p63 up-modulation were observed in elderly patients (p = 0.002 and p = 0.02, respectively, Table 1), and this correlation was also confirmed for ΔNp63 (p = 0.04, Table 1). Moreover, tumor grade II and III showed a significantly higher ΔNp63 expression (p = 0.04, Table 1). For both p63 and p73, a significant association was found with squamous histotype (all p < 0.01, Table 1). Indeed, ΔNp63 was highly expressed and significantly up-modulated in squamous histotype and Δ2p73 (p = 0.01, Table 1). Furthermore, TAp73 expression was significantly higher in squamous tumors, whereas TAp63 level was lower in nonsquamous histotype (p = 0.009 and p = 0.03, respectively, Table 1). Considering proproliferative and antiproliferative activity of both p63 and p73 isoforms, we also evaluated the correlation among isoform expression levels and proliferation marker ki67. Tumor with high proliferative rate showed high levels of TAp73, ΔNp63, and Δ2p73 isoforms (all p < 0.01, Table 1). To corroborate the transcript analysis data, 29 NSCLC samples were evaluated by immunohistochemistry with N-terminal p63/p73 isoforms commercial antibodies. TAp63, ΔNp63, TAp73, and ΔNp73 immunoreactivity was observed in 89, 41, 93, and 48% lung cancer specimens, respectively (Figure 3). Immunohistochemistry analysis revealed that only TAp73 isoforms was localized in both nuclear and cytoplasmic compartment. No correlation was identified among TAp73 protein and TAp73 transcript, although a trend was observed between nuclear TAp73 staining and Δ2p73 mRNA expression in NSCLC (p = 0.08). TAp63 and ΔNp73 decorated the nuclear and the cytoplasmic compartment, respectively. No concordance with transcript analysis was observed. ΔNp63 protein isoform was localized at the nuclear level correlating with ΔNp63 mRNA expression in tumor samples (p < 0.01). No correlation was observed between the patient's clinicophatological features and either the p63 or p73 protein expression. The association previously identified between ΔNp63 mRNA expression and both the patient's diagnosis age and the squamous histotype was also confirmed for ΔNp63 protein isoform (p = 0.04, p < 0.01, respectively).

Table 1
Table 1
Image Tools
Table 1
Table 1
Image Tools
Figure 3
Figure 3
Image Tools

Neither transcript expression level nor gene modulation of both p63 and p73 N-terminal isoforms were significantly associated with survival in the overall cohort of NSCLC patients. However, in nonsquamous carcinoma patients, high expression of Δ2p73 transcript and TAp73 protein was associated with an unfavorable outcome (p = 0.009 and p = 0.03, respectively; Figure 4, upper panel). Moreover, in nonsquamous tumors, down-modulation of TAp63, ΔNp63, and ΔN′p73 were significantly associated with poor patients' survival (p = 0.005, p = 0.03, and p = 0.04, respectively; Figure 4, lower panel). Interestingly, TAp63 and ΔN′p73 transcript expression levels had prognostic relevance also when their expression was evaluated in morphologically normal lung tissue. Indeed, high transcript levels of TAp63 and ΔN′p73 were significantly correlated with adverse prognosis (p = 0.002 and p = 0.005, respectively, Figure 5, upper panel), and the prognostic significance was even more statistically significant when patients were stratified according to tumor histotype (Figure 5, lower panel). Multivariate analyses showed that ΔN′p73 (p = 0.049, HR = 3.091, 95% confidence interval = 1.005–9.524) and TAp63 (p = 0.001, HR = 8.091, 95% confidence interval = 2.254–29.05) in morphological normal tissues were independent prognostic factors of overall survival.

Figure 4
Figure 4
Image Tools
Figure 5
Figure 5
Image Tools
Back to Top | Article Outline

DISCUSSION

The results of our research support the hypothesis that altered ΔN:TA expression ratio for p63 and p73 genes, rather than single isoform deregulation, could play a role in cancer pathogenesis.19,20 Indeed, both p63 and p73 genes showed no differential expression between tumor and corresponding normal lung tissue when transcript expression levels were measured using amplicons generated from all N-terminal isoforms. Conversely, the assessment of specific N-terminal isoforms revealed that ΔNp63 was overexpressed, whereas TAp63 was reduced. Similarly, for p73 gene, up-modulation of both Δ2p73 and Δ2/3p73 and down-modulation of ΔNp73 and ΔN′p73 isoforms were observed, whereas TAp73 level remained unchanged. Therefore, it seems that in NSCLC, an isoform shift might occur, which promotes expression of p63 and p73 antiapoptotic isoforms, suggesting an etiological role of p73/p63 in lung carcinogenesis and tumor proliferation. In support of this hypothesis, we identified a correlation between high proliferative tumor index and increased mRNA expression level of TAp73, Δ2p73, and ΔNp63 isoforms (Table 1). Since most of the p73 N-terminal isoforms showing opposite regulation are generated by alternative splicing, the p73 gene modulation observed in our cohort suggest a tampered splicing process that has recently linked to a variety of human cancers.21 Moreover, in transgenic mouse model of hepatocarcinogenesis, a Δ2/3p73 oncogenic potential has already been documented.22 At the protein level, NSCLC tumors express TAp73 N-terminal isoforms, but p73 commercial antibody directed against N-terminal epitope cannot distinguish among the various TAp73 isoforms (TAp73, Δ2p73) and cannot recognize the isoform coding by Δ2/3p73. According to literature, TAp73 protein staining (Δ2p73 and TAp73) were observed in both cytoplasmic and nuclear subcellular compartments, whereas the ΔNp73 isoform was expressed predominantly in cytoplasm.12,23 This difference in the subcellular localization of the p73 N-terminal isoforms further complicates the fine tuning of the ΔN:TA ratio, and highlights the existence of a nuclear import/export mechanism24 that could be de-regulated by tumor.

Neither transcript expression level nor gene modulation of both p63 and p73 N-terminal isoforms were significantly associated with survival in the overall cohort of NSCLC patients. However, in nonsquamous carcinoma patients, down-modulation of ΔN′p73 and TAp63 isoforms were correlated with poor prognosis. Conversely, a prognostic role of high transcript levels of these isoforms in morphologically normal lung tissue was documented, suggesting a potential role of ΔN′p73 and TAp63 isoform transcripts analysis for the detection of subjects at higher lung cancer risk. Intriguingly, in H1299 lung carcinoma cell line, the expression of ΔNp73ß isoform led to genomic instability.25 In nonsquamous tumors, a poor patient survival correlate to Δ2p73 high transcript level and to TAp73 nuclear staining and (p ≪ 0.01 and p = 0.03, respectively). It is likely that the TAp73 nuclear staining is predominantly generated by Δ2p73 transcript because the antibody used cannot discriminate between TAp73 and Δ2p73 proteins, and a trend between nuclear TAp73 staining and Δ2p73 mRNA expression in NSCLC (p = 0.08) was observed. These results could also suggest the use of this antibody to better stratify nonsquamous carcinoma patients. Our results highlight the importance of identifying new molecular markers to improve tumor subtype definition. The discrepancy in survival analysis observed between squamous and nonsquamous histotypes could result from molecular differences of these tumors subtypes. The higher ΔNp63 transcript and protein levels detected in squamous versus nonsquamous (medium fold change 33 and 0.4, respectively) could be due to 3q amplification, which is a common molecular alteration in squamous cell lung cancer.13 These molecular differences could entail different responsiveness to chemotherapy. Indeed, coexpression of high mRNA levels in squamous histotype of both ΔNp63 and TAp73 is particularly intriguing because a cross-talk between these isoforms has been recently reported and correlated with the sensitivity to cisplatin. It has been found that ΔNp63α is an essential survival factor in head and neck squamous cell carcinoma through its ability to suppress p73-dependent apoptosis and that loss of TAp73 activity attenuated cellular sensitivity to cisplatin,26 which is a backbone agent for systemic therapy for NSCLC. Moreover, in triple-negative primary breast carcinoma, it has been shown that platinum-triggered apoptosis requires the dissociation of ΔNp63/TAp73 complex mediated by c-ABL-dependent phosphorylation of TAp73.27 Therefore, further studies in NSCLC platinum-treated patients are worth of consideration to explore if ΔN:TA ratio may be a useful predictive marker of a differential sensitivity to platinum compounds.

In conclusion, our findings suggest that p63 and p73 altered ΔN:TA expression ratio occurs in NSCLC and could contribute to the molecular pathogenesis/aggressiveness of NSCLC tumors. Future studies on the fine regulation of both p63 and p73 N-terminal isoforms and their potential role in the different lung cancer subtypes could be helpful for further understanding neoplastic transformation of lung epithelium, suggesting new pathways to develop future personalized therapy.

Back to Top | Article Outline

ACKNOWLEDGMENTS

The study was supported, in part, by the University of Turin. ML belongs to the fellowship of Regione Piemonte.

Back to Top | Article Outline

REFERENCES

1.Murray-Zmijewski F, Lane DP, Bourdon JC. p53/p63/p73 isoforms: an orchestra of isoforms to harmonise cell differentiation and response to stress. Cell Death Differ 2006;13:962–972.

2.Irwin MS, Kaelin WG. p53 family update: p73 and p63 develop their own identities. Cell Growth Differ 2001;12:337–349.

3.Pietsch EC, Sykes SM, McMahon SB, et al. The p53 family and programmed cell death. Oncogene 2008;27:6507–6521.

4.Müller M, Schleithoff ES, Stremmel W, et al. One, two, three–p53, p63, p73 and chemosensitivity. Drug Resist Updat 2006;9:288–306.

5.Brambilla C, Fievet F, Jeanmart M, et al. Early detection of lung cancer: role of biomarkers. Eur Respir J Suppl 2003;39:36s–44s.

6.Deyoung MP, Ellisen LW. p63 and p73 in human cancer: defining the network. Oncogene 2007;26:5169–5183.

7.Melino G, Lu X, Gasco M, et al. Functional regulation of p73 and p63: development and cancer. Trends Biochem Sci 2003;28:663–670.

8.Koga F, Kawakami S, Fujii Y, et al. Impaired p63 expression associates with poor prognosis and uroplakin III expression in invasive urothelial carcinoma of the bladder. Clin Cancer Res 2003;9:5501–5507.

9.Urist MJ, Di Como CJ, Lu ML, et al. Loss of p63 expression is associated with tumor progression in bladder cancer. Am J Pathol 2002;161:1199–1206.

10.Domínguez G, García JM, Peña C, et al. DeltaTAp73 upregulation correlates with poor prognosis in human tumors: putative in vivo network involving p73 isoforms, p53, and E2F-1. J Clin Oncol 2006;24:805–815.

11.Wager M, Guilhot J, Blanc JL, et al. Prognostic value of increase in transcript levels of Tp73 DeltaEx2–3 isoforms in low-grade glioma patients. Br J Cancer 2006;95:1062–1069.

12.Uramoto H, Sugio K, Oyama T, et al. Expression of deltaNp73 predicts poor prognosis in lung cancer. Clin Cancer Res 2004;10:6905–6911.

13.Massion PP, Taflan PM, Jamshedur Rahman SM, et al. Significance of p63 amplification and overexpression in lung cancer development and prognosis. Cancer Res 2003;63:7113–7121.

14.Reis-Filho JS, Simpson PT, Martins A, et al. Distribution of p63, cytokeratins 5/6 and cytokeratin 14 in 51 normal and 400 neoplastic human tissue samples using TARP-4 multi-tumor tissue microarray. Virchows Arch 2003;443:122–132.

15.Irwin MS, Kondo K, Marin MC, et al. Chemosensitivity linked to p73 function. Cancer Cell 2003;3:403–410.

16.Travis WD, Brambilla E, Müller-Hermelink HK, et al. World Health Organization Classification of Tumors: Pathology and Genetics of Tumors of the Lung, Pleura, Thymus and Heart. Lyon: IARC Press, 2004.

17.Sobin LH, Wittekind C. TNM Classification of Malignant Tumours. New York: Wiley-Liss, 2002.

18.R: A Language and Environment for Statistical Computing [Computer Program]. Version 8.0. Vienna, Austria: R Foundation for Statistical Computing, 2009.

19.Buhlmann S, Pützer BM. DNp73 a matter of cancer: mechanisms and clinical implications. Biochim Biophys Acta 2008;1785:207–216.

20.Marchini S, Marabese M, Marrazzo E, et al. DeltaNp63 expression is associated with poor survival in ovarian cancer. Ann Oncol 2008;19:501–507.

21.Grosso AR, Martins S, Carmo-Fonseca M. The emerging role of splicing factors in cancer. EMBO Rep 2008;9:1087–1093.

22.Tannapfel A, John K, Mise N, et al. Autonomous growth and hepatocarcinogenesis in transgenic mice expressing the p53 family inhibitor DNp73. Carcinogenesis 2008;29:211–218.

23.Bozzetti C, Nizzoli R, Musolino A, et al. p73 and p53 pathway in human breast cancers. J Clin Oncol 2007;25:1451–1453; author reply 1453–1454.

24.Inoue T, Stuart J, Leno R, et al. Nuclear import and export signals in control of the p53-related protein p73. J Biol Chem 2002;277:15053–15060.

25.Marrazzo E, Marchini S, Tavecchio M, et al. The expression of the DeltaNp73beta isoform of p73 leads to tetraploidy. Eur J Cancer 2009;45:443–453.

26.Rocco JW, Leong CO, Kuperwasser N, et al. p63 mediates survival in squamous cell carcinoma by suppression of p73-dependent apoptosis. Cancer Cell 2006;9:45–56.

27.Leong CO, Vidnovic N, DeYoung MP, et al. The p63/p73 network mediates chemosensitivity to cisplatin in a biologically defined subset of primary breast cancers. J Clin Invest 2007;117:1370–1380.

Cited By:

This article has been cited 3 time(s).

International Journal of Surgical Pathology
Delta Np63 (p40) Distribution Inside Lung Cancer: A Driver Biomarker Approach to Tumor Characterization
Pelosi, G; Rossi, G; Cavazza, A; Righi, L; Maisonneuve, P; Barbareschi, M; Graziano, P; Pastorino, U; Garassino, M; de Braud, F; Papotti, M
International Journal of Surgical Pathology, 21(3): 229-239.
10.1177/1066896913476750
CrossRef
Bmc Genomics
An expression atlas of human primary cells: inference of gene function from coexpression networks
Mabbott, NA; Baillie, JK; Brown, H; Freeman, TC; Hume, DA
Bmc Genomics, 14(): -.
ARTN 632
CrossRef
Genes Chromosomes & Cancer
The TP73 Complex Network: Ready for Clinical Translation in Cancer?
Soldevilla, B; San Millan, C; Bonilla, F; Dominguez, G
Genes Chromosomes & Cancer, 52(): 989-1006.
10.1002/gcc.22095
CrossRef
Back to Top | Article Outline
Keywords:

p63; p73; Isoform; Quantitative PCR; Immunohistochemistry; Molecular marker; Non-small cell lung cancer

© 2011International Association for the Study of Lung Cancer

Login

Article Tools

Images

Share

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.

Other Ways to Connect

Twitter
twitter.com/JTOonline

 



Visit JTO.org on your smartphone. Scan this code (QR reader app required) with your phone and be taken directly to the site.

 For additional oncology content, visit LWW Oncology Journals on Facebook.