Skip Navigation LinksHome > January 2012 - Volume 54 - Issue 1 > Manifestations and Evolution of Wilson Disease in Pediatric...
Journal of Pediatric Gastroenterology & Nutrition:
doi: 10.1097/MPG.0b013e318230130c
Original Articles: Hepatology and Nutrition

Manifestations and Evolution of Wilson Disease in Pediatric Patients Carrying ATP7B Mutation L708P

Peña-Quintana, Luis*; García-Luzardo, María R.; García-Villarreal, Luis; Arias-Santos, María D.§; Garay-Sánchez, Paloma; Santana, Alfredo||; González-Santana, Daniel; Ramos-Varela, Juan C.; Rial-González, Ramiro; Tugores, Antonio

Free Access
Article Outline
Collapse Box

Author Information

*Departamento de Ciencias Clínicas, Universidad de Las Palmas de Gran Canaria

Unit of Pediatric Gastroenterology, Hepatology and Nutrition

Unit of Research

§Department of Pathology

||Unit of Genetics, Complejo Hospitalario Universitario Insular Materno-Infantil, Las Palmas de Gran Canaria, Spain.

Address correspondence and reprint requests to Antonio Tugores, Unit of Research, Unidad de Investigación, Complejo Hospitalario Universitario Insular Materno-Infantil, Avenida Maritima del Sur s/n, Las Palmas de Gran Canaria 35016, Spain (e-mail: atugores@yahoo.com).

Received 28 March, 2011

Accepted 15 June, 2011

This work was supported by the Servicio Canario de Salud. Parts of the infrastructures used were provided by grants IF05/3705, IF06/3632, IF07/3616, and IF08/3620 from the Instituto de Salud Carlos III/FIS.

The authors report no conflicts of interest.

Collapse Box

Abstract

Objectives: The aim of the study was to characterize a group of 11 pediatric patients, ages 3 to 13 years, affected by Wilson disease (WD) in the island of Gran Canaria, Spain.

Patients and Methods: Genetic, biochemical, and pathological features, together with their response to treatment and clinical evolution, have been analyzed for this group of patients.

Results: Genetically, the group was rather homogeneous, with an extremely high prevalence of the L708P mutation (4 homozygotes and 5 heterozygotes). Despite being initially screened because of asymptomatic hypertransaminemia, all of the patients presented with some degree of liver damage that was never accompanied by any neurological manifestation. Hepatic damage was most severe in a compound heterozygote with a novel mutation, G1266W, affecting a motif in the ATP7B polypeptide that is greatly conserved in similar proteins among metazoans. Ceruloplasmin and copper serum levels, together with the determination of hepatic copper content, were found to be of great diagnostic value, whereas urine copper measurements were found to be much less conclusive. All of the patients responded well to treatment with D-penicillamine with no documented adverse reactions.

Conclusions: The patients in Gran Canaria constitute, overall, one of the largest groups of patients with WD with a high incidence of a single mutation, allowing us to define the early clinical symptoms and the evolution of the disease in patients carrying the ATP7B L708P mutant allele, and the study of WD in a genetically homogeneous background.

See “Wilson Disease: Lessons From an Island Population” by Tanner on page 6.

Wilson disease (WD) is a rare disorder of copper metabolism resulting in its accumulation in the liver and other organs, mainly brain and cornea, and manifests primarily as liver disease, generally evolving to neurological and/or psychiatric disorder (1,2). WD is transmitted in an autosomal recessive fashion, and is caused by mutations in the ATP7B gene (3–6), encoding for a P1-type adenosine triphosphatase (ATPase) which is a key regulator of copper homeostasis (2,7).

More than 300 mutations, including deletions, insertions, and substitutions, affect the protein product, splicing, or expression of the ATP7B gene (8). A mouse model system in which the ATP7B gene has been inactivated mimics the hepatic phenotype observed in humans affected by WD (9,10), demonstrating that the loss of function of ATP7B is sufficient to cause liver disease. It is estimated that WD appears in 1 every 30,000 births in the human population, 1 in every 90 being carriers of the disease (2,7). This frequency may be much higher in isolated populations, after the amplification of specific alleles (11–13).

The diagnosis of WD is based on the combination of clinical features, biochemical analyses, and mutation detection (14). Typical analyses of affected subjects reveal low serum ceruloplasmin and copper levels accompanied by elevated urine copper excretion and hepatic copper content (1,2). Urinary copper excretion after a penicillamine challenge test (PCT) also has been considered of great diagnostic value (15). The presence of the Kayser-Fleischer (KF) ring around the cornea is a late event that often appears when the disease evolves as a neurological disorder (1,2).

WD is easily diagnosed when patients present with a complete phenotype, but may be missed in asymptomatic individuals such as pediatric patients. More than 10% of patients may have normal ceruloplasmin and copper levels, and only <50% present with the KF ring (16–21). In these cases, measuring the amount of hepatic copper may be necessary for an accurate diagnosis. Additionally, a genetic mutation screening may be required (14), although even this test may be inconclusive.

Environmental influence, unknown genetics at other modifier loci, and the lack of large collection of homozygotes for a given mutation have made difficult a phenotype-genotype correlation (2,22–25). The age of onset of the disease and its clinical manifestations are subject to extensive heterogeneity among affected patients, between those carrying the same ATP7B gene mutation (11,13,16,26), and in siblings, even when identical (27,28). In conclusion, WD diagnosis must be made on a balanced judgment among several tests (14).

We have shown a high prevalence of WD on the island of Gran Canaria, where most of the patients present with the extremely rare L708P mutation (13). We report the study of pediatric patients with this rare mutation, allowing us to determine early clinical manifestations, including hepatic pathology and their response to treatment.

Back to Top | Article Outline

PATIENTS AND METHODS

Subjects

This is a retrospective and prospective study of 11 patients belonging to 10 independent unrelated families, diagnosed and treated at our institution between 1990 and 2010. Eight patients presented with elevated asymptomatic hypertransaminemia, 1 with acute jaundice hepatitis, and 2 were screened because of family history. Once other causes for chronic hepatic disease were discarded, a definitive WD diagnosis was established when at least 2 of the typical major clinical features were present: KF rings by slit lamp examination; low serum ceruloplasmin (<20 mg/dL); and hepatic copper content of >250 μg/g dry weight. In patients with only 1 of these criteria, diagnosis was made by the presence of 2 of the following findings or secondary criteria: urinary copper excretion >100 μg during a period of 24 hours; serum copper concentration <60 μg/dL; positive family history; typical neurological symptoms; and favorable response to a PCT as determined by an increase in cupruria ≥5 times the levels detected before the administration. For the PCT, patients were given a single 250- to 500-mg dose of penicillamine (depending on body weight) 12 to 24 hours before the concentration of urine copper was measured. This dosing pattern is sufficient to increase cupruria 5-fold or higher in most of the patients tested. Appropriate informed written consent was obtained from all of the participants, and the study was approved by an ethical clinical committee in our institution.

Back to Top | Article Outline
Genetic Analysis

Genomic DNA was extracted from venous blood by using the salting-out procedure (29). For detection of the L708P mutation, polymerase chain reaction (PCR) amplification was performed on genomic DNA (13) by using the exon 8–specific primers (5′–3′) TTGAACTCTCCTCCCTACTTGCT and GGCGTGTCGAAGAATGTCACAG, generating a 230-bp fragment. After digestion with the restriction endonuclease AluI, the wild-type allele generated 2 fragments of 180 and 50 bp, whereas the mutant allele did not, because the AluI cleavage site is destroyed by the mutation. Likewise, for the detection of the Met645Arg, the following primers were used for amplification of an exon 6–specific fragment: CTTTTTCCCCACCCCTCTCT and AGGGACTTAGATGAGAGCTGGAG. The resulting PCR product contains 158 bp, and upon digestion with PflMI, the wild-type allele generates 2 fragments of 95 and 63 bp, whereas the mutant allele remains uncut. Generated fragments were analyzed by agarose gel electrophoresis.

In those cases in which the 2 most common mutations could not be detected, all exons and exon-intron boundaries of the ATP7B gene were subjected to double-pass heterozygote sequencing (4,13).

Back to Top | Article Outline

RESULTS

Clinical Features

Eleven pediatric patients were included in the present study, and their initial clinical analysis is summarized in Table 1. Most patients (WDH_18003, WDH_19006, WDH_22003, WDH_24003, WDH_25003, WDH_26003, and WDH_28004), with ages ranging from 4 to 13 years old, presented with asymptomatic hypertransaminemia detected during routine health screenings. One patient (WDH_20003) was included because of previous family history and a single case (WDH_23003) presented with acute jaundice hepatitis. The youngest patient was 3 years old (WDH_21004), and was included because the disease was diagnosed in her sister (WDH_21003) during the present study.

Table 1
Table 1
Image Tools

Abdominal echography screening showed hepatomegaly with a difused increase in echogenicity in 5 patients (WDH_18003, WDH_22003, WDH_23003, WDH_24003, WDH_25003), with gall bladder distension in one of them (WDH_22003). The rest of the patients showed a normal asymptomatic profile.

All of the patients presented with most of the biochemical features characteristic of WD: ceruloplasmin levels <20 mg/dL (11/11), cupremia <60 μg/L (11/11), and hepatic copper content >250 μg/g of dry tissue (7/8 tested). Cupruria was only >50 μg/24 hours in 5 patients, and >100 μg/24 hours in only 2 of them. Most patients subjected to the PCT (4/5) showed elevated cupruria ≥5 times the normal levels after the administration of penicillamine. None of the patients showed evidence of KF ring nor skeletal, neurological, renal, or hematological abnormalities.

Back to Top | Article Outline
Genetic Study

Genetic screening was conducted to detect mutant variants in the ATP7B gene, starting with the L708P and M645R mutations because these are the most prevalent in our population (13). In those cases in which these mutations were not found, all of the exons and exon-intron boundaries of the ATP7B gene were sequenced.

Complete analysis of the primary structure of the ATP7B gene in our patients revealed that L708P was the most prevalent mutation (5 heterozygotes and 4 homozygotes), followed by the M645R (2 heterozygotes), previously shown to be the second most common in the island (Table 2) (13). Other mutations found include a deletion at nucleotide position 3402, causing a frameshift in exon 15 (5), also found in our previous study (13), and 1 novel putative mutation, c.3796 G>T, causing a G1266W amino acid change, not previously described to date (Table 2, Fig. 1). This particular codon is subjected to at least 2 other previously described mutations: c.3796G>A, Gly1266Arg (30), c.3797G>T, Gly1266Val (23) and c.3796_3797GG>AA, Gly1266Lys (22), and it is part of a greatly conserved motif likely involved in ATP binding and catalysis (31).

Table 2
Table 2
Image Tools
Figure 1
Figure 1
Image Tools

Several known variants of the reference sequence (NM_00053.1) were also found. These are c.1216T>G in exon 2 (Ser406Ala), ATP7B_E3_c.1366G>C in exon 3 (Val456Leu), ATP7B_E10_c.2495A>G in exon 10 (Lys832Arg), c.2855G>A in exon 12 (Arg952Lys), and c.3419C>T variant in exon 16 (Ala1140Val) (8). Two patients (siblings WDH_21.003 and 21.004) did not present with any known mutations, whereas another patient (WDH_23.003) only presented with a single mutant ATP7B allele.

Back to Top | Article Outline
Histology

Liver biopsies were obtained from all of the patients, and hepatic lesions were graded by using a semiquantitative evaluation protocol, based on a methodology previously developed for chronic hepatitis (32,33). This classification is widely accepted to evaluate hepatic damage and describes, on one hand, the damage to hepatocytes and inflammation (necroinflammatory process) and, on the other hand, the structural damage (fibrosis), shown to be more reproducible.

All of the patients presented with some degree of alterations in the hepatic biopsies. These ranged from mild alterations with micro- and macrovesicular steatosis to cirrhosis. Histological lesions were well developed before the disease was clinically evident. The results of these analyses are summarized in Table 3.

Table 3
Table 3
Image Tools

In initial stages of the disease, fatty liver degeneration (steatosis), evidenced by the presence of small and large lipid droplets (micro- and macrosteatosis, respectively), was present in all of the patients and was progressively associated with lobular activity. In elderly patients, portal/periportal activity becomes more severe, evolving to perinodular fibrosis.

Back to Top | Article Outline
Treatment and Follow-up

All of the patients were initially treated with D-penicillamine and vitamin B6 and were advised to follow a low-copper diet. Once urinary copper levels fell below 500 μg/day, D-penicillamine treatment was discontinued and zinc acetate was then administered as maintenance treatment. Treatment was well tolerated and the clinical progress had been satisfactory in all of the cases. The levels of transaminases were normalized after 15 to 16 months in all of the patients except WDH_21003, who recovered normal transaminemia levels after a 20-month treatment period. The heterozygote group includes patient WDH_25003, which showed intense hepatic alterations. Even though all of the patients showed no sign of disease after treatment, 2 L708P homozygotes (WDH_26003, WDH_24003) and 2 heterozygotes (WDH_23003, WDH_19006) still presented with a mild sustained hypertransaminemia that persisted even after treatment. Adverse drug reactions (ADRs) were not detected in any of the patients treated.

Only 2 patients from the heterozygote group showed some nondisabling symptoms such as anorexia and ponderal retardation (WDH_18003), or sustained pain on the right hypochondrium (WDH_19006). All of the patients, with the exception of WDH_18003, grew normally within the 10th to 90th weight and height percentile values for their age.

During diagnosis and follow-up, 3 heterozygotes (WDH_23003, WDH_18003, WDH_19006), 1 homozygote (WDH_26003), and 1 patient with no known mutation (WDH_21003) showed elevated cholesterol levels ≥200 mg/dL. None of these were obese, had family history of hypercholesterolemia, or were apparently subjected to other causes that could explain these elevated cholesterol levels.

During follow-up, anti-nuclear (undetectable titer 1/80) and anti-cytoplasmic antibodies with a cytoskeletal pattern (undetectable titer = 1/320) were detected in 1 patient (WDH_23003). Patient WDH_28004 had been recently diagnosed and, therefore, the response to treatment has not been fully evaluated for this patient.

Back to Top | Article Outline

DISCUSSION

In the present study, we analyzed the early clinical manifestations of WD and the response to treatment of 11 pediatric patients ages 3 to 13 years with an elevated presence of the L708P mutation. Biochemical and pathological features, together with their response to treatment and clinical evolution, have been defined for this group of patients. Additionally, these patients, in conjunction with a previously described cohort (13), constitute one of the largest groups of patients with WD with high incidence of a single mutation, allowing us to define the clinical evolution of the disease in patients carrying the ATP7B L708P mutation.

The L708P mutation affects the second transmembrane domain of the ATP7B polypeptide, involved in copper transport. This mutation is greatly represented in the island of Gran Canaria (13), and it has been also found in other populations (23,34) but not in continental Spain (35,36). Also, in agreement with our previous study (13), the second most prevalent mutation found in our patients was the M645R, the most common in continental Spain (35).

The present study had also uncovered a novel variant on exon 18, at c.3796G>T, leading to a glycine-to-tryptophan amino acid change at position 1266 in the ATP hinge region of the ATP7B protein. This particular codon is subject to mutations at all 3 positions (22,23,30) and is greatly conserved within a motif likely involved in ATP binding and catalysis (31). Consistent with its presumed important role and its degree of conservation among similar ATPase domains from all phyla (Fig. 1), this mutation appears to be severe as evidenced by liver histological analysis of the affected heterozygote (WDH_25003), which showed severe cirrhosis at a relatively early age compared with other L708P compound heterozygotes. Based on these observations, we conclude that the c.3796G>T is indeed a mutant variant of the ATP7B gene.

We failed to detect mutations in 3 ATP7B alleles. In these cases, diagnosis was clear. Patient WDH_23003, with a single L708P mutant allele, presented with typical biochemical features: low ceruloplasmin and cupremia. Although cupruria was not significantly elevated, the patient showed a positive response to the PCT, and was appropriately managed with the standard treatment. As for the 2 siblings that did not bear any mutations in the ATP7B gene sequences analyzed (WDH_21003, WDH_21004), they also showed significant accumulation of hepatic copper, as well as decreased ceruloplasmin and cupremia. Although they were not subjected to a PCT, key clinical findings, together with a positive response to treatment, were considered sufficient to diagnose WD (14,37).

Previous studies on Spanish patients have failed to detect from 26% (35) up to 40% of the mutant alleles (36). Failure to detect mutations in the ATP7B gene in patients with a clear WD phenotype could be caused by, on one hand, technical reasons owing to a direct sequencing approach. On the other hand, it is plausible that other factors may influence the outcome of the disease, such as environmental and/or genetic conditions. Indeed, mice heterozygous for a null ATP7B allele have revealed genetic haploinsufficiency, because they develop WD symptoms when fed a high-copper diet (38). Similar pressure may be applied by specific variations in modifier genes, such as those coding for proteins that participate in the process of copper transport and detoxification (39). Whether human heterozygotes may show disease symptoms is an interesting issue that has been proposed previously (40) and should be explored further.

Hypertransaminemia is a typical feature of asymptomatic WD (41). In our series, detected by routine health checks, all of the patients were asymptomatic and only 1 case presented with manifestations of acute hepatitis (WDH_23003). In pediatric patients from a previous study in Gran Canaria, both hepatic and neurological symptoms are found in those that have been diagnosed at later stages (13). In the same study, which included only symptomatic patients, mostly adults, homozygosis for the L708P mutation correlates with a moderate-to-severe clinical presentation of WD, whereas compound heterozygotes appear to present with a milder disease manifestation. In the present study, both hypertransaminemia and decreased ceruloplasmin levels were unrelated to the presence of the L708P mutation in either homo- or heterozygosis: homozygotes and heterozygotes are phenotypically similar, and so are both when compared with other pediatric patients bearing different mutations. Spanish patients younger than 18 years reveal that the diagnosis of WD occurs during the presymptomatic stage in 75% to 80% of cases. Of these, 20% to 25% show hepatic (75%–92%) and/or neurological symptoms (8%–25%) (17). In patients younger than 10 years, 83% show some symptoms of hepatopathy, whereas in adolescence, up to half of the cases start to be affected by neurological manifestations (42).

Only 2 patients presented with basal cupruria levels above the diagnostic values expected for WD. This could be explained by inappropriate sample collection, or that the levels of urinary copper may change according to diet or other factors. Moreover, in patients with short-term asymptomatic hypertransaminemia, the accumulation and release of copper from hepatocytes may not be sufficient to reach the blood and be eliminated through the urine at significant levels. These findings are in agreement with similar studies in which the patients with lowest cupruria were those diagnosed based on family history (16,21). Therefore, we conclude that cupruria has a poor diagnostic value in young asymptomatic patients.

Hepatic copper content is, for many, unequivocal diagnostic proof of WD. Most of the patients (7/8) presented with copper hepatic levels >250 μg/g dry weight, regardless of age or whether the L708P mutation was present in homo- or heterozygosis, similar to what has been found in other groups (43).

One patient (WDH_23003) presented with autoantibodies. Similar autoimmune features have been also described in other studies (43,44). The value of this diagnostic test is unclear and only affects a small fraction of patients.

In our series, the discordance between the clinical symptoms and the hepatic alterations observed is remarkable. Histological lesions were well developed before the disease was clinically evident. In similar studies, chronic inflammatory portal inflammation and lobular cytolysis are often reported, and up to 75% of the cases present with steatosis and fibrosis, whereas advanced fibrosis is reported in up to 15% of cases (37). It must be noted that hepatitis and cirrhosis are sometimes difficult to distinguish from lesions of viral origin at the histological level and can therefore be confused with other hepatic pathologies. Neither acute hepatic failure nor encephalopathy was found in our patients at the time of diagnosis or follow-up, in contrast with other studies in which up to 57% of the patients presented with acute hepatic failure, with signs of encephalopathy in half of them (43).

The rate and time of normalization of aminotransferase levels in WD-affected children adherent to therapy are not well described. Aminotransferase levels seem to be a more reliable parameter of treatment efficacy in the early phase of WD than clinical signs such as fatigue, abdominal pain, or hepatomegaly. In agreement with similar studies (45), transaminase levels were normalized in 6 patients after an average period of 16 months of treatment with penicillamine. Three patients persisted with mild sustained hypertransaminemia after the initial decrease, whereas 1 had periodical peaks. The persistence of a mild sustained hypertransaminemia even after treatment is reported in other studies (46,47). Besides rare ADRs, nonadherence is the most common cause of increased liver enzyme levels in patients with WD receiving long-term therapy (47–49). This is probably the case in our patients, as concluded by interviewing children and their parents.

There is evidence showing that up to 70% of the patients treated with penicillamine may demonstrate ADRs, including hypersensitivity, bone marrow suppression, and development of autoimmune disease, and approximately 30% may experience severe adverse effects such as neurological deterioration, pancytopenia, nephrotoxicity, polyneuropathy, optic neuritis, and polymyositis (18). In pediatric patients, up to 13% of the patients were forced to discontinue treatment because of ADRs (45). We did not observe any ADRs in any of our patients, probably because the sample size is small compared with other studies.

During diagnosis and follow-up, up to 5 patients showed elevated cholesterol levels ≥200 mg/dL. To the best of our knowledge, none of these patients had a family history of hypercholesterolemia or were subjected to other causes that could explain these elevated cholesterol levels. Additionally, none of the patients was obese. Although we have not found evidence of this feature in other series of patients with WD, it is plausible that, as suggested by others (50), hypercholesterolemia is a consequence of the hepatic damage causing a decrease in the synthesis of the low-density lipoprotein receptor and apolipoproteins, or by an inhibitory effect exerted by copper on the latter. The patients who presented with hypercholesterolemia were not the most severely affected as determined by the examination of hepatic biopsies. In 3 of these patients, both hypertransaminemia and hypercholesterolemia were detected (WDH_23003, WDH_19006, WDH_26003), whereas in 2 (WDH_21003, WDH_18003), high cholesterol levels were not accompanied by elevated transaminemia.

The clinical evolution of patients bearing the L708P mutation, found in the present study and in a previous study (13), was summarized in Table 4. The data show that, although with a variable histological lesion, hepatocellular damage appears early, causing general cytolysis (evidenced by elevated transaminases), accompanied by a decrease in both serum ceruloplasmin and copper levels. Copper release from the liver may be moderate and/or sporadic in these initial stages, thus explaining normal cuprurias and the absence of extrahepatic deposits, hence the absence of neurological features. Later in life, the disease evolves to cirrhosis and neurological damage with variable penetrance.

Table 4
Table 4
Image Tools
Back to Top | Article Outline
Acknowledgments

The authors thank the patients and their families for their participation in the present study and the excellent service provided by Dr Javier García at Sistemas Genómicos SL.

Back to Top | Article Outline

REFERENCES

1. Brewer GJ. Wilson's Disease: A Clinician's Guide to Recognition, Diagnosis and Management. Dordrecht, The Netherlands: Kluwer Academic Publishers; 2001.

2. Pfeiffer RF. Wilson's disease. Semin Neurol 2007; 27:123–132.

3. Bull PC, Thomas GR, Rommens JM, et al. The Wilson's disease gene is a putative copper transporting P-type ATPase similar to the Menkes gene. Nature Genet 1993; 5:327–337.

4. Petrukhin KE, Lutsenko S, Chernov I, et al. Characterization of Wilson's disease gene encoding a P-type copper transporting ATPase: genomic organization, alternative splicing, and structure/function predictions. Hum Molec Genet 1994; 3:1647–1656.

5. Tanzi RE, Petrukhin K, Chernov I, et al. The Wilson's disease gene is a copper transporting ATPase with homology to the Menkes disease gene. Nature Genet 1993; 5:344–350.

6. Yamaguchi Y, Heiny ME, Gitlin JD. Isolation and characterization of a human liver cDNA as a candidate gene for Wilson disease. Biochem Biophys Res Commun 1993; 197:271–277.

7. Das SK, Ray K. Wilson's disease: an update. Nat Clin Pract Neurol 2006; 2:482–493.

8. Kenney SM, Cox DW. Sequence variation database for the Wilson disease copper transporter, ATP7B. Hum Mutat 2007; 28:1171–1177.

9. Buiakova OI, Xu J, Lutsenko S, et al. Null mutation of the murine ATP7B (Wilson disease) gene results in intracellular copper accumulation and late-onset hepatic nodular transformation. Hum Mol Genet 1999; 8:1665–1671.

10. Huster D, Finegold MJ, Morgan CT, et al. Consequences of copper accumulation in the livers of the Atp7b−/− (Wilson disease gene) knockout mice. Am J Pathol 2006; 168:423–434.

11. Ferenci P. Regional distribution of mutations of the ATP7B gene in patients with Wilson disease: impact on genetic testing. Hum Genet 2006; 120:151–159.

12. Zappu A, Magli O, Lepori M, et al. High incidence and allelic homogeneity of Wilson disease in 2 isolated populations: a prerequisite for efficient disease prevention programs. J Pediatr Gastroenterol Nutr 2008; 47:334–338.

13. García-Villarreal L, Daniels S, Shaw SH, et al. High prevalence of the very rare Wilson disease gene mutation Leu708Pro in the island of Gran Canaria (Canary Islands, Spain): a genetic and clinical study. Hepatology 2000; 32:1329–1336.

14. Ferenci P, Caca K, Loudianos G, et al. Diagnosis and phenotypic classification of Wilson disease. Liver Int 2003; 23:139–142.

15. Martins da Costa C, Baldwin D, Portmann B, et al. Value of urinary copper excretion after penicillamine challenge in the diagnosis of Wilson's disease. Hepatology 1992; 15:609–615.

16. Steindl P, Ferenci P, Dienes HP, et al. Wilson's disease in patients presenting with liver disease: a diagnostic challenge. Gastroenterology 1997; 113:212–218.

17. Sánchez-Albisua I, Garde T, Hierro L, et al. High index of suspicion: the key to an early diagnosis of Wilson's disease in childhood. J Pediatr Gastroenterol Nutr 1999; 28:186–190.

18. Merle U, Schaefer M, Ferenci P, et al. Clinical presentation, diagnosis and long-term outcome of Wilson disease-a cohort study. Gut 2007; 56:115–120.

19. Abdelghaffar TY, Elsayed SM, Elsobky E, et al. Mutational analysis of ATP7B gene in Egyptian children with Wilson disease: 12 novel mutations. J Hum Genet 2008; 53:681–687.

20. Manolaki N, Nikolopoulou G, Daikos GL, et al. Wilson disease in children: analysis of 57 cases. J Pediatr Gastroenterol Nutr 2009; 48:72–77.

21. Nicastro E, Ranucci G, Vajro P, et al. Re-evaluation of the diagnostic criteria for Wilson disease in children with mild liver disease. Hepatology 2010; 52:1948–1956.

22. Thomas GR, Forbes JR, Roberts EA, et al. The Wilson's disease gene: spectrum of mutations and their consequences. Nat Genet 1995; 9:210–217.

23. Shah AB, Chernov I, Zhang HT, et al. Identification and analysis of mutations in the Wilson's disease gene (ATP7B): population frequencies, genotype-phenotype correlation, and functional analyses. Am J Hum Genet 1997; 61:317–328.

24. Kalinsky H, Funes A, Zeldin A, et al. Novel ATP7B mutations causing Wilson's disease in several Israeli ethnic groups. Hum Mutat 1998; 11:145–151.

25. Maier-Dobersberger T, Ferenci P, Polli C, et al. Detection of the His1069Gln mutation in Wilson's disease by rapid polymerase chain reaction. Ann Intern Med 1997; 127:21–26.

26. Cox DW, Fraser FC, Sass-Kortsak A. A genetic study of Wilson's disease: evidence for heterogeneity. Am J Hum Genet 1972; 24:646–666.

27. Senzolo M, Loreno M, Fagiuoli S, et al. Different neurological outcome of liver transplantation for Wilson's disease in two homozygotic twins. Clin Neurol Neurosurg 2007; 109:71–75.

28. Takeshita Y, Shimizu N, Yamaguchi Y, et al. Two families with Wilson disease in which siblings showed different phenotypes. J Hum Genet 2002; 47:543–547.

29. Miller SA, Dykes DD, Olesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1998; 16:1215–1217.

30. Curtis D, Durkie M, Balac P, et al. A study of Wilson disease mutations in Britain. Hum Mutat 1999; 14:304–311.

31. Aravind L, Galperin MY, Koonin EV. The catalytic domain of the P-type ATPase has the haloacid dehalogenase fold. Trends Biochem Sci 1998; 23:127–129.

32. Scheuer PJ. Classification of chronic viral hepatitis: a need for reassessment. J Hepatol 1991; 13:372–374.

33. Scheuer PJ, Lefkowich JH. Liver Biopsy Interpretation. 6th ed. Philadelphia: WB Saunders; 2000.

34. Deguti MM, Genschel J, Cancado EL, et al. Wilson disease: novel mutations in the ATP7B gene and clinical correlation in Brazilian patients. Hum Mutat 2004; 23:398.

35. Margarit E, Bach V, Gómez D, et al. Mutation analysis of Wilson disease in the Spanish population—identification of a prevalent substitution and eight novel mutations in the ATP7B gene. Clin Genet 2005; 68:61–68.

36. Brage A, Tomé S, García A, et al. Clinical and molecular characterization of Wilson disease in Spanish patients. Hepatol Res 2007; 37:18–26.

37. Jara Vega P, Hierro Llanillo L. Wilson's disease: forms of presentation in childhood. Gastroenterol Hepatol 2006; 29:560–567.

38. Cheah DM, Deal YJ, Wright PF, et al. Heterozygous tx mice have an increased sensitivity to copper loading: implications for Wilson's disease carriers. Biometals 2007; 20:751–757.

39. de Bie P, Muller P, Wijmenga C, et al. Molecular pathogenesis of Wilson and Menkes disease: correlation of mutations with molecular defects and disease phenotypes. J Med Genet 2007; 44:673–688.

40. Sechi G, Antonio Cocco G, Errigo A, et al. Three sisters with very-late-onset major depression and parkinsonism. Parkinsonism Relat Disord 2007; 13:122–125.

41. Iorio R, Sepe A, Giannattasio A, et al. Hypertransaminasemia in childhood as a marker of genetic liver disorders. J Gastroenterol 2005; 40:820–826.

42. Sokol RJ, Narkewicz MR. Suchy FJ, Sokol RJ, Balistreri WF. Copper and iron storage disorders. Liver Disease in Children. Philadelphia:Lippincott Williams & Wilkins; 2001. 595–647.

43. Dhawan A, Taylor RM, Cheeseman P, et al. Wilson's disease in children: 37-year experience and revised King's score for liver transplantation. Liver Transpl 2005; 11:441–448.

44. Milkiewicz P, Saksena S, Hubscher SG, et al. Wilson's disease with superimposed autoimmune features: report of two cases and review. J Gastroenterol Hepatol 2000; 15:570–574.

45. Iorio R, D’Ambrosi M, Marcellini M, et al. Serum transaminases in children with Wilson's disease. J Pediatr Gastroenterol Nutr 2004; 39:331–336.

46. Marcellini M, Di Ciommo V, Callea F, et al. Treatment of Wilson's disease with zinc from the time of diagnosis in pediatric patients: a single-hospital, 10-year follow-up study. J Lab Clin Med 2005; 145:139–143.

47. Arnon R, Calderon JF, Schilsky M, et al. Wilson disease in children: serum aminotransferases and urinary copper on triethylene tetramine dihydrochloride (trientine) treatment. J Pediatr Gastroenterol Nutr 2007; 44:596–602.

48. Masełbas W, Chabik G, Członkowska A. Persistence with treatment in patients with Wilson disease. Neurol Neurochir Pol 2010; 44:260–263.

49. Wiggelinkhuizen M, Tilanus ME, Bollen CW, et al. Systematic review: clinical efficacy of chelator agents and zinc in the initial treatment of Wilson disease. Aliment Pharmacol Ther 2009; 29:947–958.

50. Schiefermeier M, Kollegger H, Madl C, et al. The impact of apolipoprotein E genotypes on age at onset of symptoms and phenotypic expression in Wilson's disease. Brain 2000; 123:585–590.

Cited By:

This article has been cited 1 time(s).

Advances in Clinical Chemistry, Vol 60
Genetics of Gallstone Disease
Chuang, SC; Hsi, E; Lee, KT
Advances in Clinical Chemistry, Vol 60, 60(): 143-185.
10.1016/B978-0-12-407681-5.00005-2
CrossRef
Back to Top | Article Outline
Keywords:

genetics; liver pathology; pediatric; rare mutation; Wilson disease

Copyright 2012 by ESPGHAN and NASPGHAN

Login

Article Tools

Images

Share

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.

Connect With Us

 

 

Twitter

twitter.com/JPGNonline

 

Visit JPGN.org on your smartphone. Scan this code (QR reader app required) with your phone and be taken directly to the site.