Skip Navigation LinksHome > December 2011 - Volume 53 - Issue 6 > Critical Role for P-Glycoprotein Expression in Hematopoietic...
Journal of Pediatric Gastroenterology & Nutrition:
doi: 10.1097/MPG.0b013e31822860f1
Original Articles: Gastroenterology

Critical Role for P-Glycoprotein Expression in Hematopoietic Cells in the FVB.Mdr1a−/− Model of Colitis

Staley, Elizabeth M.*; Dimmitt, Reed A.; Schoeb, Trenton R.; Tanner, Scott M.§; Lorenz, Robin G.§

Free Access
Article Outline
Collapse Box

Author Information

*Department of Microbiology

Department of Pediatrics

Department of Genetics

§Department of Pathology, University of Alabama at Birmingham.

Address correspondence and reprint requests to Dr Robin G. Lorenz, Department of Pathology, University of Alabama at Birmingham, 1825 University Blvd, SHEL 602, Birmingham, AL 35243-2182 (e-mail: rlorenz@uab.edu).

Received 6 January, 2011

Accepted 8 June, 2011

Drs Staley and Dimmitt participated equally in the study.

This work was supported in part by NIH grants R01 DK059911, P01 DK071176, and the Molecular Pathology and Human Cell Tissue Core of the University of Alabama at Birmingham Digestive Diseases Research Development Center (P30 DK064400). E.M.S. received partial salary support from T32 AI07051 and R.A.D. received partial support from K08 HD046506. S.M.T. is a recipient of a UAB-Hughes Med into Grad Fellowship. Aspects of this project were conducted in biomedical research space that was constructed with funds supported in part by NIH grant C06RR020136.

The authors report no conflicts of interest.

Collapse Box

Abstract

Objective: P-glycoprotein (P-gp), the functional product of the multidrug resistance gene (MDR), is a transmembrane protein that extrudes substrates from the intracellular environment. P-gp is expressed on the apical surface of epithelial cells and on cells from the hematopoietic lineage. Human MDR polymorphisms have been associated with the increased risk of inflammatory bowel disease, and FVB/N animals deficient in mdr1a expression develop spontaneous colitis. Previous studies using adult bone marrow chimeras indicated that colitis development in this animal model was contingent on P-gp deficiency in radiation-resistant epithelial cells; however, the use of adult animals may mask the role of hematopoietic immune cells in colitis initiation, due to preexisting epithelial abnormalities.

Subjects and Methods: To assess the importance of P-gp expression in intestinal epithelial and hematopoietic-derived cells on colitis induction in FVB.mdr1a−/− animals, we developed a neonatal model of bone marrow reconstitution. FVB/N and FVB.mdr1a−/− adult and neonatal animals were lethally irradiated and reconstituted with bone marrow from FVB/N or FVB.mdr1a−/− donors. Animals were observed for 20 weeks.

Results: Adult FVB/N animals deficient in P-gp expression in hematopoietically derived immune cells developed colitis similar to adult animals deficient in P-gp expression in radiation-resistant epithelial/stromal cells. Neonatal animals deficient in P-gp expression in hematopoietically derived immune cells developed a more histologically significant colitis than those deficient in P-gp expression in epithelial tissue.

Conclusions: The use of a neonatal model of bone marrow reconstitution has revealed a critical role for P-gp expression in hematopoietically derived immune cells in colitis development in the FVB.mdr1a−/− model.

P-glycoprotein (P-gp) is a glycosylated transmembrane protein known to pump a variety of amphipathic and hydrophobic substrates from the intracellular environment (1,2). P-gp, the functional product of the multidrug resistance gene (MDR, ABCB1), is a member of the adenosine triphosphate–binding cassette superfamily of transporters. It is expressed at multiple locations including the apical surface of epithelial cells in the colon and small intestine, on epithelial cells of the pancreas, kidney, and adrenal glands, on endothelial cells at the blood–brain barrier, and on cells of the hematopoietic lineage (3–5). Expression of MDR polymorphisms has been associated with the development of inflammatory bowel disease in European and Slavic patient populations and is associated with decreased P-gp expression and function (6–8).

FVB/N animals deficient in expression of mdr1a develop a spontaneous, unremitting colitis, characterized by diarrhea, rectal prolapse, and death (9–11). Treatment of these animals with antibiotics ameliorates colitis when administered either prophylactically or therapeutically, confirming the role of the intestinal microbiota in inducing intestinal inflammation (9). Disease incidence rates have been shown to vary dramatically between animal colonies, ostensibly as a result of differences in bacterial composition within animal facilities (9–11).

To assess the role of the epithelium and other radiation-resistant cell lineages versus bone marrow–derived immune cells in mitigating the inflammatory response and resultant colitis, previous studies used adult bone marrow chimeras. Adult FVB and FVB.mdr1a−/− animals were lethally irradiated and reconstituted with bone marrow from FVB, or FVB.mdr1a−/− donors. Results indicated that only FVB.mdr1a−/− recipients developed colitis during a period of 38 to 52 weeks, highlighting the importance of P-gp expression in epithelial cell populations in preventing disease development (9). Unfortunately, these experiments were conducted in a facility with limited disease penetrance (20%–25%). We hypothesized that these experiments may have dramatically different results when conducted in a facility with greater incidence of disease/different constituent colonic flora.

It has been shown that FVB.mdr1a−/− animals demonstrate increased barrier permeability at an early stage of development, before the onset of colitis, in correlation with decreased phosphorylation of proteins involved in maintaining intestinal tight junctions (10). These data suggest that P-gp deficiency interferes with the formation of tight junctions in the intestinal epithelium, ostensibly causing a leaky barrier, and ultimately colitis.

It has also been shown that FVB.mdr1a−/− animals express increased levels of inflammatory cytokines such as interferon (IFN)-γ and interleukin (IL)-17 early in development (11,12). In vitro experiments using colonic epithelial cell lines demonstrate that tumor necrosis factor-α and IFN-γ have profound effects on expression and localization of proteins at the tight junctions, which serve to fuse intestinal epithelial cells and regulate intestinal integrity (13–16). Increased colonic barrier permeability fosters penetration of luminal bacteria and antigens promoting colonic mucosal injury and inflammation (17). Elaboration of inflammatory cytokines at an early developmental time point may induce barrier deficiencies, potentially predisposing FVB.mdr1a−/− mice to develop inflammatory bowel disease as a result of aberrant responses leading to increased bacterial exposure. Previous experiments were conducted using only adult animals, and thus the impact of P-gp deficiency on cell function during early postnatal development remains unclear.

We hypothesize that to more accurately assess the responsibility of the intestinal epithelial cells in promoting susceptibility to colitis in FVB.mdr1a−/− animals, it is necessary to reconstitute animals early in development, before any changes in the cytokine milieu. To this end we have developed a neonatal model of bone marrow reconstitution for adaptation in models in which early developmental changes may play a role in experimental outcome.

Back to Top | Article Outline

SUBJECTS AND METHODS

Animals

FVB.129P2-Abcba1tm1BorN7 (FVB.mdr1a−/−) were originally derived by Schinkel et al (18), and they and the FVB/NTac wild-type controls were purchased from Taconic Farms (Hudson, NY). Animals were bred and maintained in Thoren Isolator racks (Hazleton, PA) under positive pressure in specific pathogen-free conditions. Animals were provided sterile drinking water and autoclaved NIH-31 rodent diet (Harlan Teklad, Madison, WI) ad libitum. Mdr1a expression was confirmed as previously described by periodic genotyping using polymerase chain reaction (PCR). In brief, DNA was extracted using Sigma's RED Extract-N-Amp tissue PCR kit (St Louis, MO) from mouse tail clippings. Mdr1a phenotype expression was confirmed as indicated by Taconic using the primers MDR1A S2 CTCCTCCAAGGTGCATAGACC, MDR1A W2 CCCAGCTCTTCATCTAACTACCCTG, and MDR1A K02 CTTCCCAGCCTCTGAGCCCAG to amplify DNA using the PCR settings 1 cycle at 95°C for 15 minutes, 35 consecutive cycles of 94°C for 45 seconds, 60°C for 1 minute, and 72°C for 1 minute, followed by 1- to 5-minute cycle at 72°C. PCR products were then run on a 1.5% agarose gel, and presence or absence of mdr1a gene expression is confirmed by analyzing expression of amplification products (Invitrogen, Carlsbad, CA).

Animals were monitored for presence of colitic symptoms such as weight loss, diarrhea, and/or fecal blood. All of the experiments were approved by the institutional care and use committee of the University of Alabama at Birmingham. Specific pathogen-free conditions at the university include absence of the following organisms, as determined by serological screening: mouse parvoviruses (MPV), including MPV-1, MPV-2, and minute virus of mice; mouse hepatitis virus, Theiler murine encephalomyelitis virus; mouse rotavirus (epizootic diarrhea of infant mice), Sendai virus; pneumonia virus of mice; reovirus; Mycoplasma pulmonis; lymphocytic choriomeningitis virus; mouse adenovirus; ectromelia (mousepox) virus; K polyoma virus; and mouse polyoma virus. Testing and other methods were as described at http://main.uab.edu/Sites/ComparativePathology/surveillance.

Back to Top | Article Outline
Irradiation and Reconstitution

Adult (age between 2 and 4 months) and neonatal (day 7) FVB.mdr1a−/− and FVB/NTac wild-type recipient animals were exposed to a lethal dose (900 rads) of gamma irradiation using the GC40 γ-irradiator containing a cesium-137 core. Irradiated mice were reconstituted with donor bone marrow at a ratio of 1 donor providing for 2 recipients, or approximately 3 × 106 cells injected intraperitoneally in neonates, or retro-orbitally in adults. Irradiated animals were given Bactrim (sulfamethoxazole/trimethoprim) in drinking water for 10 days following irradiation. Animals were monitored for signs of distress: weight loss, fecal blood, or diarrhea. Animals were sacrificed at 20 weeks of age (for neonatal reconstitution) or 20 weeks following reconstitution (for adult reconstitution), or subsequent to losing more than 20% of maximal achieved body weight (if before the 20-week time point).

To generate bone marrow, FVB.mdr1a−/− and FVB/N donor animals were anesthetized with isoflurane and euthanized by cervical dislocation. Tibias and femurs were harvested and stripped of fat and muscle. Marrow was flushed from bone using a 26-gauge needle into HBSS+ (Hank's buffered saline solution containing 25 mmol/L HEPES, 1% hyclone defined fetal bovine serum, and 1% penicillin/streptomycin [Fisher, Pittsburgh, PA]). The cell suspension was mechanically dispersed by passage through a 26-gauge needle, and the suspension was then filtered using a 70-μmol/L Nitex membrane (Tetko, Elmsford, NY) to remove debris. Cells were washed twice in R1.5 (RPMI 1640, 1.5 g bovine serum albumin [Fisher], 1% glutamax, and 5 mg gentamicin (Invitrogen) and counted. Activated T cells were depleted using a Thy 1.2 antibody and rabbit complement (Cedarlane, Burlington, Canada). Cells were again washed twice in R10 and counted. Cells were resuspended at in phosphate buffered saline at 50 μL/recipient for neonates or 100 μL/recipient for adults and were injected into lethally irradiated recipients.

Back to Top | Article Outline
Histology/Injury Scoring

At time of sacrifice mice were anesthetized with isoflurane and then euthanized by cervical dislocation. Distal small intestine, colon, and cecal segments were flushed with phosphate buffered saline and the colon was assessed for changes in weight and length. The tissue was then opened longitudinally and oriented as strips, mucosa up in tissue cassettes. Tissue was fixed in 10% buffered formalin for 24 hours and embedded in paraffin. Tissue was cut into 5-μm sections and stained with standard hematoxylin and eosin for histologic examination. Experimental conditions were concealed until after the slides were examined. Cecum, proximal colon, and distal colon were evaluated separately. For each segment, crypt epithelial hyperplasia, goblet cell loss, superficial and crypt epithelial degeneration and loss, crypt exudate, inflammatory cell accumulation in lamina propria and submucosa, submucosal edema, mucosal ulceration, transmural inflammation, fibrosis, and dysplasia were evaluated. Severity of each change was scored 0, 1, 2, or 3 for absent (normal), mild, moderate, and severe, respectively. The distribution of each change present also was scored 1, 2, 3, or 4 for ≤25%, 25% to 50%, 50% to 75%, or 75% to 100%, respectively, of the segment affected. Lesion scores for each segment were calculated as the sum of severity scores multiplied by distribution scores, with changes indicating severe inflammation or injury, including crypt epithelial degeneration, ulceration, transmural inflammation, and dysplasia, weighted by a factor of 1. An overall colonic lesion score was calculated as the average of the scores for the 2 colonic segments.

Back to Top | Article Outline
Barrier Permeability

Barrier permeability was assessed by analyzing serum concentrations of FITC-dextran following oral gavage as described (19). Briefly, mice were orally gavaged 4 hours before sacrifice using an 80-mg/mL stock of FITC-dextran, for a total dose of 60 mg/100 g of body weight (MW 4000, Sigma). Total blood volume was collected at sacrifice via cardiac puncture. Neonatal animals were pooled with 2 animals providing 1 sample. Blood samples were coagulated at 4° C in the dark for 1 hour, before centrifugation and serum harvest. Samples were analyzed using the Synergy HT Multi-Mode Microplate Reader (Bio-Tek Technologies, Winooski, VT) and standardized to FITC loaded control serum. FITC was detectable between 25 and 0.195 ng/mL.

Back to Top | Article Outline
RNA Isolation

RNA was isolated from colonic tissue using Trizol (Invitrogen) as previously described by Chomczynski et al (20). Contaminating genomic DNA was removed from tissue samples using the Turbo DNA-free kit available from Applied Biosystems (Foster City, CA). The Transcriptor First Strand cDNA Synthesis Kit was used to synthesize cDNA from purified RNA samples (Roche, Pensburg, Germany). Quantitative real-time reverse-transcriptase polymerase chain reaction was performed using Applied Biosystems gene-specific primer probe sets in combination with TaqMan Universal PCR Mix (Invitrogen). RNA expression was quantified by calculating the threshold of detectable fluorescence as provided by the RT cycler MX3000P (Stratagene, La Jolla, CA). Fluorescence thresholds were averaged generating a gene-specific numeral, which then could be normalized to the average expression of the 18S housekeeping gene and further stratified by particular strain and experimental condition. We used the 18S housekeeping gene as the gene of choice for the present study as a result of recent publications indicating its relative stability of expression under inflammatory conditions (21–23). Gene expression was calculated as an average fold change when compared with control strain values, and shown on a log 2 scale as fold changes from the control baseline (=1). The protocol for this data analysis format is provided in the Applied Biosystems manufacturer's instructions (4371095 Rev A, PE Applied Biosystems). Data have been considered physiologically relevant if alterations in expression levels exceed a 2-fold change from control strain values.

Back to Top | Article Outline
Statistical Analysis

Statistical analysis was performed using the Quick Calcs program available from GraphPad (La Jolla, CA). Statistical analysis for continuous data was performed using an unpaired Student t test, or the Dunn multiple comparisons test. Statistical analysis for weight comparisons and survival was performed using the Mantel-Cox test. Comparisons having a P < 0.05 were considered statistically significant.

Back to Top | Article Outline

RESULTS

An Adult Model of Bone Marrow Reconstitution

The incidence of spontaneous colitis in the facility where initial bone marrow reconstitution experiments were conducted was 20% to 25% in FVB.mdr1a−/−(9). We have previously shown that in our facility colitis penetrance is 100%, causing a 50% mortality as early as 8 months of age (11). Given the discrepancies in reported disease incidence rates between animal facilities, we initially chose to recapitulate the original adult bone marrow reconstitution studies conducted by Panwala et al (9).

Four groups were used in the course of the present study. All donor mice were male mice 6 to 8 weeks of age, and all recipient mice were 2- to 4-month-old lethally irradiated female mice. Group 1A consisted of FVB/N mice reconstituted with bone marrow from FVB/N mice (wild-type into wild-type, WT ⇒ WT). Group 2A contained FVB/N recipients and FVB.mdr1a−/− bone marrow donors (knockout into wild-type (KO ⇒ WT). Group 3A consisted of FVB.mdr1a−/− mice reconstituted with FVB/N bone marrow (WT ⇒ KO). Finally, group 4A contained FVB.mdr1a−/− mice reconstituted with bone marrow from FVB.mdr1a−/− (KO ⇒ KO).

As expected, group 1A (WT ⇒ WT) animals maintained a stable growth curve following exposure/radiation. Group 4A (KO ⇒ KO) demonstrated significantly reduced weight shortly following reconstitution and an increased mortality during the course of the experiment (Fig. 1A and B). Interestingly, both group 3A (WT ⇒ KO, those expressing P-gp only in hematopoietically derived cells) and group 2A (KO ⇒ WT, those expressing P-gp only radiation-resistant epithelial/stromal cells) demonstrated stable growth curves following reconstitution (Fig. 1A).

Figure 1
Figure 1
Image Tools
Back to Top | Article Outline
Histological Evidence of Colitis in Adult Reconstituted Mice

To evaluate colitis development at a microscopic level, tissue was harvested at sacrifice for histological evaluation. Tissue was evaluated and histologically scored in a blinded fashion based on evidence of crypt epithelial hyperplasia, goblet cell loss, superficial and crypt epithelial degeneration and loss, crypt exudate, and inflammatory cell accumulation in lamina propria and submucosa, and incidence of mucosal ulceration. As indicated by weight data, group 1A (WT ⇒ WT) were macroscopically and histologically free of disease, whereas group 4A (KO ⇒ KO) demonstrated significant disease (Fig. 2A, D–F). As indicated by Panwala et al, FVB.mdr1a−/− animals reconstituted with FVB/N bone marrow (group 3A) demonstrated colonic disease (Fig. 2C, E–F) (9). In contrast to that report, FVB/N animals reconstituted with bone marrow from P-gp–deficient animals (group 2A) also developed significant colonic disease, indicating that hematopoietic-derived cells also play a role in the development of spontaneous disease in FVB.mdr1a−/− mice (Fig. 2B, E–F).

Figure 2
Figure 2
Image Tools
Back to Top | Article Outline
A Neonatal Model of Bone Marrow Reconstitution

Our adult data demonstrate that animals deficient in P-gp expression in both radiation-resistant epithelial cells or hematopoietically derived immune cells go on to develop spontaneous colitis. These experiments fail to take into account, however, the potential preexisting epithelial damage already present in adult animals or the developmental changes that occur in animals during the neonatal period; thus, we chose to evaluate chimeras generated during the neonatal period. It has been proposed that exposure to radiation in the course of generating chimeras may damage epithelial tissue and predispose animals toward spontaneous colitis, and that these effects may be more profound in neonatal animals, whose developing tissue may be more susceptible to the effects of radiation. To evaluate possible mitigating effects of radiation damage on neonatal as opposed to adult tissue, we quantified the effects of exposure to irradiation on barrier integrity in both groups. FVB/N mice at 6 to 8 weeks and 7 days postbirth were exposed to 900 rad radiation and were sacrificed approximately 72 hours later. Barrier integrity was evaluated by measuring serum content of FITC-dextran 4 hours following oral gavage. Exposure to radiation had no significant effect on barrier permeability in FVB/N adult or neonatal animals; however, baseline barrier permeability is inherently different between neonatal and adult tissue, with neonatal tissue being significantly more permeable (Fig. 3).

Figure 3
Figure 3
Image Tools

Because these experiments demonstrated no differential effects of irradiation on barrier function during the neonatal period, we lethally irradiated and reconstituted with donor bone marrow mouse pups at 7 days of age. Animals were routinely weighed and monitored for physiological symptoms of colitis. Group 4N (KO ⇒ KO) animals demonstrated dramatically altered growth and development, indicating reduced weight gain as early as 8 weeks of age, and consistently demonstrated reduced weight from all of the other experimental groups starting at 12 weeks of age (Fig. 4A). Animals deficient in P-gp expression in hematopoietic or epithelial tissue alone (groups 2N and 3N, respectively) showed growth and weight gain similar to controls, displaying normal growth from weaning to 10 weeks, and increased weight gain at week 20 (Fig. 4A).

Figure 4
Figure 4
Image Tools

Animals were sacrificed either at 20 weeks after reconstitution or upon evidence of weight loss >20% maximal weight or incidence of fecal blood. Group 4N (KO ⇒ KO) demonstrated 100% mortality by 18 weeks after reconstitution (Fig. 4B). Group 3N (WT ⇒ KO, animals deficient in P-gp expression in radiation-resistant epithelial cells) demonstrated a 20% mortality by 20 weeks of age, but this was not statistically different from groups 1N or 2N (Fig. 4B).

Back to Top | Article Outline
Histological Evidence of Colitis in Neonatally Reconstituted Mice

To evaluate colitis development at a microscopic level, tissue was harvested at sacrifice for histological evaluation. Tissue was evaluated and scored as described above. Group 4N (KO ⇒ KO) animals demonstrated significant disease pathology, in both cecal and colonic tissue (Fig. 5D–F), whereas group 1N (WT ⇒ WT) remained disease free (Fig. 5A, E–F). As suspected by our adult data, 50% of the group 2N (KO ⇒ WT, animals deficient in P-gp expression in hematopoietic cells) also displayed a significant disease pathology developing inflammation in both cecal and colonic tissue (Fig. 5B, E–F). Group 3N (WT ⇒ KO, animals deficient in P-gp expression in radiation-resistant epithelial cells) displayed lower histology scores, demonstrating scores not significantly different from control group 1N (WT ⇒ WT) (Fig. 5C, E–F).

Figure 5
Figure 5
Image Tools
Back to Top | Article Outline
Gene Expression of Inflammatory Cytokines in Neonatally Reconstituted Animals

It has been shown that FVB.mdr1a−/− animals display increased levels of inflammatory cytokines before the onset of colitis. Because our data clearly indicate that animals deficient in P-gp expression in hematopoietically derived tissue can develop colitis, we wanted to assess whether increased expression of inflammatory cytokines elaborated by these aberrant immune cells may be contributing to the development of disease. RNA was isolated from colonic tissue from neonatal reconstituted animals at sacrifice and reverse-transcriptase PCR analysis was conducted to evaluate gene expression. Gene expression was normalized to expression in group 1N animals (WT ⇒ WT). Not surprisingly, group 4N (KO ⇒ KO) demonstrated increased expression of a panel of inflammatory cytokines (IL-17, IFN-γ, IL-6, and macrophage inflammatory protein-2) (Fig. 6). Interestingly, animals deficient in P-gp expression in hematopoietically derived tissues (group 2N, KO ⇒ WT) expressed levels of all inflammatory cytokines similar to those elaborated by group 4N (KO ⇒ KO), despite demonstrating consistently lower histological scoring. Furthermore, animals deficient in P-gp expression in radiation-resistant epithelial/stromal tissue alone (group 3N, WT ⇒ KO) expressed significantly lower levels of inflammatory cytokines when compared with either of the other 2 groups (Fig. 6). These data support our hypothesis that P-gp deficiency in hematopoietically derived tissue contributes to the development of spontaneous colitis in the FVB.mdr1a−/− animal model, and indeed may lead to disease progression more rapidly than deficiency of P-gp expression in epithelial/stromal tissue alone.

Figure 6
Figure 6
Image Tools
Back to Top | Article Outline

DISCUSSION

Schinkel et al (18) originally derived the FVB.129P2-Abcba1tm1BorN7 (FVB.mdr1a−/−) for the purposes of studying drug extrusion and barrier integrity in epithelial cells of the blood–brain barrier. The importance of P-gp expression to intestinal function was realized when it was discovered that FVB.mdr1a−/− animals develop a spontaneous unremitting colitis when maintained in a specific pathogen-free environment. Efforts to elucidate the nature of this colitis induced by nonpathogenic commensal microbiota indicated that it was the result of aberrant reactions directed at the intestinal microbiota because it was shown that both prophylactic and therapeutic antibiotic treatments were capable of ameliorating disease in this animal model (9).

Initial studies were aimed at characterizing colitis in FVB.mdr1a−/− animals. To clarify the role of cell populations in disease induction, Panwala et al (9) derived adult bone marrow chimeras. Reconstituted animals maintained for 38 to 52 weeks indicated that FVB/N animals reconstituted with FVB.mdr1a−/− bone marrow remained clinically free of colitis, whereas FVB.mdr1a−/− animals reconstituted with FVB/N bone marrow developed colitis at an incidence rate comparable to that typically observed in FVB.mdr1a−/− animals in their facility (9). Unfortunately complete histological data from these experiments were never shown, and these experiments took place in a facility where disease incidence was low, presumably as a result of different constituent microbiota in their animal facility.

Further experiments using this animal model have identified the effects of P-pg deficiency on the intestinal epithelium. FVB.mdr1a−/− animals develop altered permeability to molecularly tagged substrates as early as 4 to 12 weeks of age, before the development of colitis (10). Permeability changes correlate with altered phosphorylation of junctional proteins (10). These data indicate that histological and phenotypic evidence of colitis occurs secondarily to the development of altered intestinal barrier function.

It has been shown that FVB.mdr1a−/− animals demonstrate an increased expression of inflammatory cytokines IFN-γ and IL-17, and an increased responsiveness to lipopolysaccharide, as early as 8 weeks of age, also before the development of inflammation (11,12). In vitro studies using human colonic cells clearly indicate that the presence of IFN-γ has a significant effect on localization and expression of tight junctional proteins, dramatically reducing barrier permeability (13,14,16). Altered elaboration of inflammatory cytokines, potentially as a result of aberrant immune function in P-gp-deficient immune cells, could predispose FVB.mdr1a−/− animals to develop an inflammatory response to luminal microbiota and subsequent colitis.

As a result of this knowledge of altered barrier function before colitis development, it was our hypothesis that the previous experiments were influenced by these preexisting barrier changes in adult animals and may not accurately reflect the individual influences of P-gp deficiency in epithelial versus hematopoietic-derived cells. Because our data clearly suggest that neonatal animals have inherently leakier epithelial barriers when compared with adult animals, it is our supposition that during the neonatal period, systemic immune cells would be exposed to more of the intestinal microbiota. Animals lacking P-gp expression in their immune cell populations may respond in an aberrant fashion, leading to the development of unregulated inflammatory response. Thus, performing the experiments during the neonatal period may provide more insight as to the role of P-gp expression in epithelial and immune cells in disease initiation and progression.

To serve as an appropriate basis for comparison, we assessed bone marrow chimeras derived from adult animals in our experimental facility. As previously reported, 100% of group 4A animals (KO ⇒ KO) developed fatal disease, whereas group 1A (WT ⇒ WT) consistently maintained weight and remained disease free. We went on to show that as expected, animals deficient in P-gp expression in radiation-resistant epithelial/stromal cells (group 3A, WT ⇒ KO) display evidence of disease at 20 weeks following reconstitution. Surprisingly, animals deficient in P-gp expression in hematopoietic tissue with normal epithelium (group 2A, KO ⇒ WT) also demonstrated increased mortality and consistently demonstrated histologic evident disease in both cecal and colonic tissue. We believe the difference in our results from those previously published is related to the increased incidence of disease found in our colony, which may be driving disease progression in a more distinct and accelerated fashion than seen in other facilities.

We then compared these results to disease development in animals reconstituted as neonates. As expected, animals deficient in P-gp expression in both epithelial and hematopoietic tissue (group 4N, KO ⇒ KO) developed rapidly fatal spontaneous colitis, with animals dying more rapidly than was observed in adults. Additionally, FVB/N animals reconstituted with FVB/N bone marrow (group 1N, WT ⇒ WT) gained weight and were disease free at sacrifice. Animals deficient in P-gp expression in radiation-resistant epithelial/stromal cells (group 3N, WT ⇒ KO) demonstrated a nonsignificant increase in mortality, and all of the animals examined 20 weeks following transplantation showed no histologic evidence of disease. Animals deficient in P-gp expression in hematopoietically derived tissue (group 2N, KO ⇒ WT) showed no increased mortality 20 weeks after transfer; however, 50% of the animals demonstrated evidence of histological disease in both the colon and cecum at sacrifice.

One potential mechanism for the increased mortality of animals deficient in P-gp in radiation-resistant epithelial cells, and the increased intensity/speed of disease progression in animals lacking P-gp expression in all of the tissues, is that P-gp may play a role in epithelial cell repair. Studies of MDR gene expression in humans have indicated that MDR plays a role in regulating cellular apoptosis. P-gp expression and function has been strongly associated with increased resistance to spontaneous apoptosis (24). Lacking P-gp expression during the sensitive neonatal period may impair intestinal regeneration following exposure to radiation. Furthermore, if cellular ability to undergo apoptosis is impaired, this may participate in the propagation of an unchecked immune response to nonpathogenic colonic microbiota.

Our neonatal model clearly demonstrates that the absence of P-gp expression in the intestinal epithelium is not the sole initiator of spontaneous colitis in the FVB.mdr1a−/− model. The presence of histologically significant colitis in animals deficient in P-gp expression in hematopoietically derived cells alone clearly indicates a role for immune cells in the initiation and progression of colitis in the FVB.mdr1a−/− disease model. Although P-gp functional activity has been shown to be expressed in multiple bone marrow–derived cell lineages, including the majority of natural killer cells and CD8+ cytotoxic T cells, little is known about its role in the development and function of lymphocytes. What has been reported is that human P-gp can pump cytokines such as IL2, IL-4 and IFN-γ; however, the functional outcome of this activity is unclear and a second report has questioned this result (25,26). It has also been demonstrated that P-gp is important in the development and function of both human dendritic cells (DCs) and monocytes (27). Specifically, P-gp antagonists alter DC and monocyte differentiation and reduce migration out of skin explants. The role of any of these potential mechanisms in the susceptibility to colitis remains under investigation.

Interestingly, data from our neonatal model demonstrate that colitis does not appear to be as severe in animals deficient in P-gp expression in either hematopoietically derived immune cells or radiation-resistant epithelial/stromal cells alone, because it appears to be in animals globally deficient in P-gp expression. Taken together, the results suggest that there exists a collaborative effect of impaired barrier function initiating and exacerbating an aberrantly excessive immune response driving an ultimately fatal response to the intestinal microbiota.

Back to Top | Article Outline
Acknowledgments

We thank Peggy R. McKie-Bell and Jamie L. McNaught for their assistance and members of the Lorenz Lab for their valuable advice. We thank Dr Chuck O. Elson for use of the Synergy Microplate Reader and Wayne Duck for experimental input and comments. We thank Dr Susanne Michaleck for use of the GC-40 irradiator and Gregg Harbor for technical assistance.

Back to Top | Article Outline

REFERENCES

1. Fromm MF. P-glycoprotein: a defense mechanism limiting oral bioavailability and CNS accumulation of drugs. Int J Clin Pharmacol Ther 2000; 38:69–74.

2. Mizutani T, Masuda M, Nakai E, et al. Genuine functions of P-glycoprotein (ABCB1). Curr Drug Metab 2008; 9:167–174.

3. Cordon-Cardo C, O’Brien JP, Casals D, et al. Multidrug-resistance gene (P-glycoprotein) is expressed by endothelial cells at blood-brain barrier sites. Proc Natl Acad Sci U S A 1989; 86:695–698.

4. Klimecki WT, Futscher BW, Grogan TM, et al. P-glycoprotein expression and function in circulating blood cells from normal volunteers. Blood 1994; 83:2451–2458.

5. Thiebaut F, Tsuruo T, Hamada H, et al. Cellular localization of the multidrug-resistance gene product P-glycoprotein in normal human tissues. Proc Natl Acad Sci U S A 1987; 84:7735–7738.

6. Fiedler T, Buning C, Reuter W, et al. Possible role of MDR1 two-locus genotypes for young-age onset ulcerative colitis but not Crohn's disease. Eur J Clin Pharmacol 2007; 63:917–925.

7. Ho GT, Nimmo ER, Tenesa A, et al. Allelic variations of the multidrug resistance gene determine susceptibility and disease behavior in ulcerative colitis. Gastroenterology 2005; 128:288–296.

8. Potocnik U, Ferkolj I, Glavac D, et al. Polymorphisms in multidrug resistance 1 (MDR1) gene are associated with refractory Crohn disease and ulcerative colitis. Genes Immun 2004; 5:530–539.

9. Panwala CM, Jones JC, Viney JL. A novel model of inflammatory bowel disease: mice deficient for the multiple drug resistance gene, mdr1a, spontaneously develop colitis. J Immunol 1998; 161:5733–5744.

10. Resta-Lenert S, Smitham J, Barrett KE. Epithelial dysfunction associated with the development of colitis in conventionally housed mdr1a−/− mice. Am J Physiol Gastrointest Liver Physiol 2005; 289:G153–G162.

11. Staley EM, Schoeb TR, Lorenz RG. Differential susceptibility of P-glycoprotein deficient mice to colitis induction by environmental insults. Inflamm Bowel Dis 2009; 15:684–696.

12. Collett A, Higgs NB, Gironella M, et al. Early molecular and functional changes in colonic epithelium that precede increased gut permeability during colitis development in mdr1a(−/−) mice. Inflamm Bowel Dis 2008; 14:620–631.

13. Clark E, Hoare C, Tanianis-Hughes J, et al. Interferon gamma induces translocation of commensal Escherichia coli across gut epithelial cells via a lipid raft-mediated process. Gastroenterology 2005; 128:1258–1267.

14. Madara JL, Stafford J. Interferon-gamma directly affects barrier function of cultured intestinal epithelial monolayers. J Clin Invest 1989; 83:724–727.

15. Mullin JM, Laughlin KV, Marano CW, et al. Modulation of tumor necrosis factor-induced increase in renal (LLC-PK1) transepithelial permeability. Am J Physiol 1992; 263 (5 Pt 2):F915–F924.

16. Youakim A, Ahdieh M. Interferon-gamma decreases barrier function in T84 cells by reducing ZO-1 levels and disrupting apical actin. Am J Physiol 1999; 276 (5 Pt 1):G1279–G1288.

17. Gassler N, Rohr C, Schneider A, et al. Inflammatory bowel disease is associated with changes of enterocytic junctions. Am J Physiol Gastrointest Liver Physiol 2001; 281:G216–G228.

18. Schinkel AH, Smit JJ, van Tellingen O, et al. Disruption of the mouse mdr1a P-glycoprotein gene leads to a deficiency in the blood-brain barrier and to increased sensitivity to drugs. Cell 1994; 77:491–502.

19. Cario E, Gerken G, Podolsky DK. Toll-like receptor 2 controls mucosal inflammation by regulating epithelial barrier function. Gastroenterology 2007; 132:1359–1374.

20. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156–159.

21. Bas A, Forsberg G, Hammarstrom S, et al. Utility of the housekeeping genes 18S rRNA, beta-actin and glyceraldehyde-3-phosphate-dehydrogenase for normalization in real-time quantitative reverse transcriptase-polymerase chain reaction analysis of gene expression in human T lymphocytes. Scand J Immunol 2004; 59:566–573.

22. Ropenga A, Chapel A, Vandamme M, et al. Use of reference gene expression in rat distal colon after radiation exposure: a caveat. Radiat Res 2004; 161:597–602.

23. Rubie C, Kempf K, Hans J, et al. Housekeeping gene variability in normal and cancerous colorectal, pancreatic, esophageal, gastric and hepatic tissues. Mol Cell Probes 2005; 19:101–109.

24. Pallis M, Turzanski J, Higashi Y, et al. P-glycoprotein in acute myeloid leukaemia: therapeutic implications of its association with both a multidrug-resistant and an apoptosis-resistant phenotype. Leuk Lymphoma 2002; 43:1221–1228.

25. Gollapudi S, Kim C, Gupta S. P-glycoprotein (encoded by multidrug resistance genes) is not required for interleukin-2 secretion in mice and humans. Genes Immun 2000; 1:371–379.

26. Drach J, Gsur A, Hamilton G, et al. Involvement of P-glycoprotein in the transmembrane transport of interleukin-2 (IL-2), IL-4, and interferon-gamma in normal human T lymphocytes. Blood 1996; 88:1747–1754.

27. Pendse SS, Behjati S, Schatton T, et al. P-glycoprotein functions as a differentiation switch in antigen presenting cell maturation. Am J Transplant 2006; 6:2884–2893.

Cited By:

This article has been cited 2 time(s).

Mucosal Immunology
Altered generation of induced regulatory T cells in the FVB.mdr1a(-/-) mouse model of colitis
Tanner, SM; Staley, EM; Lorenz, RG
Mucosal Immunology, 6(2): 309-323.
10.1038/mi.2012.73
CrossRef
Transplant Immunology
Maintenance of host leukocytes in peripheral immune compartments following lethal irradiation and bone marrow reconstitution: Implications for graft versus host disease
Staley, EM; Tanner, SM; Daft, JG; Stanus, AL; Martin, SM; Lorenz, RG
Transplant Immunology, 28(): 112-119.
10.1016/j.trim.2013.01.001
CrossRef
Back to Top | Article Outline
Keywords:

bone marrow chimera; colitis; neonatal; P-glucoprotein

Copyright 2011 by ESPGHAN and NASPGHAN

Login

Article Tools

Images

Share

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.

Connect With Us

 

 

Twitter

twitter.com/JPGNonline

 

Visit JPGN.org on your smartphone. Scan this code (QR reader app required) with your phone and be taken directly to the site.