Skip Navigation LinksHome > October 2007 - Volume 45 - Issue 4 > Cryptosporidium Infection in Patients With Primary Immunodef...
Journal of Pediatric Gastroenterology & Nutrition:
doi: 10.1097/MPG.0b013e318054b09b
Original Articles: Hepatology and Nutrition

Cryptosporidium Infection in Patients With Primary Immunodeficiencies

Wolska-Kusnierz, Beata*; Bajer, Anna; Caccio, Simone; Heropolitanska-Pliszka, Edyta*; Bernatowska, Ewa*; Socha, Piotr*; van Dongen, Jacques§; Bednarska, Malgorzata; Paziewska, Anna; Sinski, Edward

Free Access
Article Outline
Collapse Box

Author Information

*Gastroenterology, Hepatology and Immunology Clinic, Children's Memorial Health Institute, Italy

Department of Parasitology, Faculty of Biology, University of Warsaw, Poland, Italy

Department of Infectious, Parasitic and Immunomediated Diseases, Istituto Superiore di Sanità, Rome, Italy

§Department of Immunology, Erasmus University, Rotterdam, The Netherlands

Received 28 June, 2006

Accepted 30 January, 2007

Address correspondence and reprint requests to Beata Wolska-Kusnierz, MD, Children's Memorial Health Institute, Av Dzieci Polskich 20, Warsaw 04-730, Poland (e-mail: bwolska@interia.pl).

This work was supported by the State Committee for Scientific Research, KBN, through the Faculty of Biology, Warsaw University intramural grant, BW no.1601/53 (A.B.); and KBN grant no. 2PO4C09827 (E.S.) and grant EURO-POLICY-PID SP23-CT-2005-006411.

Collapse Box

Abstract

Background: Cryptosporidium species infection is usually self-limited in immunocompetent populations, but can be severe and life-threatening among immunocompromised individuals, particularly in patients with AIDS and in these patients with primary immunodeficiencies (PIDs).

Patients and Methods: A group of 5 patients with genetically confirmed hyper-IgM syndrome type 1 (XHIM) and one patient with primary CD4 lymphopenia were enrolled in the study. At least 2 stool samples and a bile sample in one patient were examined for Cryptosporidium oocysts by a modified Ziehl-Neelsen technique, by immunofluorescence assay using a commercial kit, as well as by molecular analysis followed by genotyping. Immunological status at the time of PID diagnosis and the complex picture of disease are presented.

Results: Chronic cryptosporidiosis was confirmed in 3 patients with XHIM and in one patient with primary CD4 lymphopenia. Molecular diagnosis showed the presence of C parvum, C hominis, and C meleagridis in analyzed specimens.

Conclusions: Cryptosporidium infection with serious clinical symptoms observed in patients with hyper-IgM syndrome calls for regular, repeated screening in this group of patients.

Back to Top | Article Outline

INTRODUCTION

Cryptosporidiosis refers to infection caused by the oocyst-forming parasites of the genus Cryptosporidium. Cryptosporidium infections are increasingly recognized as a cause of diarrhea not only in children (1,2) but also in elderly people (3) and in a range of immunodeficient patients. Among patients with primary immunodeficiencies (PIDs), particular susceptibility to Cryptosporidium infection is observed in children with X-linked hyper-IgM syndrome type 1 (XHIM) resulting from CD40 ligand (CD40L) deficiency, hyper-IgM syndrome type 3 (HIGM3) caused by CD40 deficiency (4–6), primary CD4 lymphopenia, severe combined immunodeficiency syndrome, and interferon-γ deficiency. In secondary immunodeficiencies such as HIV infection and acute leukemia, the increased risk of infection is also noted (7). Transmission is carried out through the fecal/oral route following direct or indirect contact with the infective stages (Cryptosporidium oocysts), including person-to-person, zoonotic, waterborne, food-borne and, possibly airborne transmission (8,9).

The parasite usually infects epithelial cells of the small intestine, but in immunocompromised individuals it can be found along the whole gastrointestinal tract, on the surface of the respiratory tract, and in the bile duct (10). Diarrhea is the typical clinical manifestation of cryptosporidiosis. It lasts longer in immunocompromised individuals as a result of their inability to clear the infection. In such patients, malabsorption, steatorrhea, and extraintestinal manifestations develop with time (11). The bile tract is the most common site of extraintestinal infection, which may result in chronic liver inflammation (6,12) or even lead to liver cirrhosis. We present results of a long-term survey of Cryptosporidium infection in patients with selected PIDs and provide the complex clinical picture of cryptosporidiosis in infected children attending the Department of Immunology of Children's Memorial Health Institute in Warsaw, Poland.

Back to Top | Article Outline

PATIENTS AND METHODS

Between 1980 and 2006, we recognized 6 cases of XHIM among the group of 987 patients with PIDs. Of these, 5 boys between 13 months and 11 years old were involved in the study. One patient with primary CD4 lymphopenia of unknown genetic cause was also investigated.

We present a retrospective analysis of immunological status at the time of PID diagnosis and the complex picture of disease. Particular attention was given to the clinical and laboratory features, potentially associated with Cryptosporidium infection.

Back to Top | Article Outline
Detection of Cryptosporidium Oocysts by Microscopy

Fecal or bile specimens from patients were collected 2 or more times and examined for Cryptosporidium oocysts by a modified Ziehl-Neelsen technique (13) and by immunofluorescence assay using a commercial kit (MeriIFluor Cryptosporidium/Giardia; Meridian Diagnostics, Cincinnati, OH).

Back to Top | Article Outline
Molecular Analysis of Cryptosporidium Species

Oocyst disruption and DNA purification were carried out using two methods: extraction from the whole feces using the FastPrep homogenizer and the FastDNA Spin Kit (Bio 101, Carlsbad, CA), as described by da Silva et al (14); and extraction from the concentrated samples using Stool Genomic Mini AX Stool kit (A & A Biotechnology, Gdynia, Poland). Purified DNA samples were stored at −20°C until analysis.

Amplification of an N-terminal fragment of the Cryptosporidium oocyst wall (COWP) gene was performed using a nested polymerase chain reaction (PCR) protocol (15,16). In the primary PCR primers BCOWPF (5′ ACCGCTTCTCAACAACCATCTTGTCCTC 3′) and BCOWPR (5′ CGCACCTGTTCCCACTCAATGTAAACCC 3′) were used to produce a ∼769-bp fragment. In the nested PCR reaction, primers Cry15 (5′ GTAGATAATGGAAGAGATTGTG 3′) and Cry9 (5′ GGACTGAAATACAGGCATTATCTTG 3′) were used to produce a ∼550-bp fragment.

Cryptosporidium species were identified by a PCR/restriction fragment length polymorphism (RFLP) method (16,17). The nested PCR COWP amplicons were digested with the endonuclease Rsa I and the resulting fragments were separated by electrophoresis in 2% agarose gels.

Back to Top | Article Outline

RESULTS

Clinical Presentation of Patient 1 (E.N.)

The boy, born in 2000, presented with recurrent otitis, bronchitis, and pneumonias since the seventh month of life. He was hospitalized for sepsis of unknown etiology in the 13th month of life and at that time hypogammaglobulinemia was recognized. One month later, diagnosis of XHIM syndrome was established on the basis of low IgG and IgA levels, increased IgM level, and lack of CD40L expression on lymphocytes. It was finally confirmed by the detection of point mutation in the CD40L gene (Table 1). The boy started intravenous Ig substitution therapy and Pneumocystis carinii prophylaxis with trimethoprim/sulfamethoxazole. As a result of the lack of a matched family donor, the searching for an unrelated donor for hematopoietic stem cell transplantation (HSCT) was started. Since the third year of life, hepatitis of unknown origin began with increased levels of alanine aminotransferase, γ-glutamyltransferase, and alkaline phosphatase (Table 2). An increased eosinophil number was also observed. Enlargement of the gallbladder and dilation of intra- and extrahepatic bile ducts on ultrasound were found. Endoscopic retrograde cholangiopancreatography (ERCP) examination revealed sclerosing cholangitis features (Table 2; Fig. 1). Neither protracted or chronic diarrhea, nor malnutrition or stunted growth of the patient, were noticed. After confirmation of cryptosporidiosis at the age of 4 years, the boy started prolonged azithromycin therapy. The boy underwent the HSCT procedure twice from matched unrelated donors (MUDs; March 2004 and February 2005), but the transplants were rejected. After the second transplantation, exacerbation of liver function with cholestasis was observed, with improvement after steroid therapy, which was probably caused by a local graft-versus-host reaction. Currently, the boy is in good clinical condition waiting for the next HSCT from another donor. Despite the long-term combined azithromycin and paromomycin therapy, cryptosporidiosis did not resolve (Table 3), and chronic cholangitis is still observed.

Table 1
Table 1
Image Tools
Table 2
Table 2
Image Tools
Fig. 1
Fig. 1
Image Tools
Table 3
Table 3
Image Tools
Back to Top | Article Outline
Clinical Presentation of Patient 2 (K.N.)

The brother of patient E.N., born in 2003, was diagnosed with XHIM at the first month of life due to a positive family history. The lack of expression of CD40L on lymphocytes and the same point mutation as in his brother allowed confirmation of the diagnosis (Table 1). Intravenous Ig substitution therapy and P carinii prophylaxis were started. Next, a search for an MUD for HSCT was commenced. Neither signs of liver or bile duct dysfunction, nor diarrhea or malnutrition, were observed before the time of transplantation (Tables 2 and 4). He was screened for Cryptosporidium infection at the age of 11 months with negative microscopic examination (Table 4). At the age of 13 months the boy received HSCT from an MUD with full donor chimerism and good hematological reconstitution. Four weeks after the procedure, acute grade III graft-versus-host disease (GVHD) with skin and intestine involvement occurred. It was complicated by intestine perforation and development of a generalized fatal infection. After the patient's death, we retrospectively obtained positive PCR results for Cryptosporidium species from stool samples collected before transplantation (Table 4).

Table 4
Table 4
Image Tools
Back to Top | Article Outline
Clinical Presentation of Patient 3 (H.C.)

The boy, born in 1995, presented with recurrent diarrhea which started at the age of 5 months. Since the first year of life, a constantly elevated eosinophil number was observed, followed 2 years later by chronic hepatitis of unknown etiology. Other clinical manifestations were severe chronic otitis, recurrent labial herpes infection, and skin abscesses. The diagnosis of primary CD4 lymphopenia was established on the basis of the immunological status (Table 1). Genetic analysis did not reveal any mutation in the SAP gene (Table 1), CD40L expression was normal, and the molecular background of his PID remains unknown. Intravenous Ig substitution therapy and antiviral prophylaxis were started. Stunted growth, followed by chronic diarrhea and malnutrition with intestinal mucosal atrophy of grade III, were indicators for partial parenteral nutrition since the age of 9 years. At that time the boy was qualified for HSCT, but his parents refused to give consent. At the age of 10 years, he presented with recurrent bile duct inflammation followed by sclerosing cholangitis symptoms confirmed by ERCP (Table 2). At this time diagnostic tests for Cryptosporidium infection were performed and the oocysts were found in bile and fecal samples (Table 4). Azithromycin therapy was applied, with no improvement in clinical and laboratory status of the patient. Severe gallbladder inflammation was the reason for surgery. Histopathological investigation of the gallbladder showed B cell lymphoma infiltration. The first course of chemotherapy was complicated by intestine perforation, and during the surgery, intervention further dissemination of malignancy was noted. The patient underwent palliative care and died 5 months later.

Back to Top | Article Outline
Clinical Presentation of Patient 4 (A.K.)

The boy, born in 1998, was the brother of patient D.K. and presented with relevant family history (there were boys' deaths in early childhood in the maternal pedigree). The first manifestation of PID was observed in the 12th month of life, when he started to experience recurrent bronchitis. There was no suspicion of PID until the third year of life, when the boy was screened as a result of XHIM diagnosis in his brother. A deletion in the CD40L gene confirmed the diagnosis (Table 1). Despite intravenous Ig substitution therapy, chronic bronchitis is still observed.

No Cryptosporidium infection and no signs of liver or bile duct damage have been observed during follow-up (Tables 2 and 4). There is a lack of a family donor, and HSCT from an MUD is being considered.

Back to Top | Article Outline
Clinical Presentation of Patient 5 (D.K.)

The boy, born in 1994, was doing well until his 12th month of life when he started to experience recurrent upper and lower respiratory tract infections. At the age of 6 years he was hospitalized as a result of sepsis and candidiasis, and then hypogammaglobulinemia was recognized. The XHIM diagnosis was established 6 months later, with typical immunological features, and was confirmed by the detection of deletion in the CD40L gene (Table 1). Clinical improvement with a low incidence of infection was observed after intravenous Ig substitution therapy was started. No Cryptosporidium infection and no signs of liver or bile duct damage have been observed (Tables 2 and 4). There is a lack of a family donor, and HSCT from an MUD is being considered.

Back to Top | Article Outline
Clinical Presentation of Patient 6 (R.M.)

The boy, born in 2000, had recurrent bronchitis and pneumonias since his ninth month of life. Hypogammaglobulinemia was recognized at 20 months of age; 4 months later, an XHIM diagnosis was established based on detection of deletion in the CD40L gene (Table 1). Liver abnormalities were noted for the first time at the age of 3 years with periodically elevated liver enzymes and γ-glutamyltransferase. Further investigation revealed enlargement of the gallbladder, dilation of the intra- and extrahepatic bile ducts as shown by ERCP, and mild cholangitis described on liver biopsy, but no typical sclerosing cholangitis features were found (Table 4). A high eosinophil number was observed. Repeated analysis of stool samples performed at the age of 5 years revealed Cryptosporidium infection. Despite intravenous Ig therapy, there are still recurrences of respiratory infections. There is no chronic diarrhea or malnutrition present (Table 4). Long-term azithromycin treatment did not eradicate Cryptosporidium infection. In this case there is no matched family or unrelated donor for HSCT. Nevertheless, because of the severe course of XHIM, a mismatched unrelated HSCT will be performed in the near future.

Back to Top | Article Outline
Cryptosporidium Infection

Cryptosporidium infection was recognized in 4 of 6 investigated patients (Tables 3 and 4). Three sets of samples from 3 boys were positive by both methods: microscopic examination of fecal specimens and nested PCR amplification of a COWP gene fragment; however, the microscopic methods were less sensitive than the PCR assay. In patient 1, all samples (n = 11) were positive by nested PCR, whereas only 6 were positive by microscopy (Table 4). In patient 2, infection was detected only by PCR, with negative microscopic examination in 3 sets of samples.

Among these 4 infected cases, three different parasite species were identified by COWP PCR/RFLP assay (Fig. 1; Tables 3 and 4). The prolonged infection in patient 1 was caused by C meleagridis, whereas C hominis was identified in stool and bile samples from patient 3, and C parvum was associated with infections in patients 2 and 6.

The expected RFLP patterns from these species were as follows: for C meleagridis fragments of 372, 147, and 34 bp; for C hominis fragments of 284, 129, 106, and 34 bp; and for C parvum fragments of 413, 106, and 34 bp (Fig. 1).

Back to Top | Article Outline

DISCUSSION

In selected immunocompromised individuals, Cryptosporidium infection cannot be eliminated by the host (7,18). Experimental studies in severe combined immunocompromised or nude mice have shown that resolution of Cryptosporidium infection requires the activation of B and/or T lymphocytes (19). The 2 crucial factors of immune response necessary for prevention and/or resolution of cryptosporidiosis, are CD4+ lymphocytes and interferon-γ (19–22). It seems that a defective activation route for macrophages, especially the CD40–CD40L route of activation, may be the cause for the increased susceptibility to opportunistic infections (23). The lack of CD40–CD40L interaction caused by a mutation in the CD40L or in the CD40 protein in individuals with XHIM or HIGM3 syndromes is probably the main reason for their increased susceptibility to cryptosporidiosis. XHIM is a rare inherited immunodeficiency disorder characterized by recurrent sinopulmonary, bacterial, and opportunistic infections, and associated with low IgG, IgA, and IgE serum levels and normal to increased IgM serum levels (24).

In our group of patients with XHIM, no history of acute, prolonged diarrhea or malnutrition of a suspected or proven Cryptosporidium origin was recorded before the study. Chronic Cryptosporidium infection probably played an important role in chronic diarrhea, mucosal atrophy, and malabsorption requiring parenteral nutrition in a patient with CD4 lymphopenia (patient 3). In the further course of infection, the bile ducts were involved, with fatal complications. In this patient infection was caused by C. hominis, a strictly anthroponotic parasite.

Five different Cryptosporidium species have been described in immunocompromised patients all over the world (9,15,25,26). The zoonotic species C parvum (identified in 23%–88% of cases), and the human-specific C hominis (in 12%–57% of cases) are the most commonly identified ones. The other 3 species, C felis, C canis, and C meleagridis, are less common (0.2%–11% cases), but they are frequently found in their specific animal hosts, namely cat, dog, and turkey, respectively (27–29). For the first time in Polish patients with PIDs, Cryptosporidium species, including C meleagridis, were identified. Interestingly, patients 1 and 2, who are brothers, were infected with different species of Cryptosporidium (C meleagridis and C parvum; Table 3), suggesting different sources of infection.

In a recent analysis of 126 patients with XHIM syndrome reported to the European Society for Immunodeficiency registry, approximately one sixth developed liver disease, and in more than 50% cases this was associated with Cryptosporidium infection (30). In 2 boys (patients 1 and 6), the infection was correlated with the clinical course of sclerosing cholangitis and bile duct inflammation as the only manifestation.

In patient 2, infection with C parvum, which was confirmed only retrospectively, probably influenced the fatal complication of intestinal problems in the course of GVHD after hematopoietic stem cell transplantation. Fatal exacerbation of Cryptosporidium infection early after transplantation was reported in the literature (31).

Chronic infection or inflammation of bile ducts caused by Cryptosporidium species probably plays an important role in the development of malignancy. The tumors in most cases are preceded by chronic cholangiopathy and/or liver cirrhosis (32). Other mechanisms that are not well recognized are probably involved in cancer pathogenesis. It is likely that Cryptosporidium infection, which lasted many years in patient 3, was the main cause of intestinal and liver abnormalities, and was also a trigger for the development of malignancy. Several antibiotics (azithromycin, paromomycin, nitazoxanide) have shown some efficacy against the parasite. Unfortunately, clinical trials on the efficacy of treatment are discouraging: in a percentage of patients there is an improvement in the clinical condition, but it is difficult to eradicate infection. Better treatment results are achieved in HIV-infected patients presenting with intestinal involvement, but there is no relevant improvement in patients with sclerosing cholangitis (33). Symptoms may also resolve spontaneously within the restoration of immune status (eg, with antiviral therapy in HIV-infected patients). It seems that the best way to treat cryptosporidiosis in patients with PID is to correct the underlying PID syndrome. The only curative therapy for XHIM seems to be correction of the immune defect by hematopoietic stem cell transplantation (34). In long-term observation there is an extremely high risk of liver disease, leading to liver insufficiency and malignancy development requiring additional liver transplantation procedure (5,35). The 2 last factors are the main causes of deaths and are important indicators for HSCT in this group of PIDs.

It was observed in some patients that correction of immune defects yields a chance to eliminate infection and also resolve liver and bile duct inflammation (36). Immunosuppressive conditioning therapy in such children before HSCT may result in acute cryptosporidiosis and cholangiopathy associated with oocyst excretion, and can occur in patients without previous episodes of diarrhea (6,25). In the absence of a simultaneous treatment against Cryptosporidium species, this may lead to a massive amplification of the parasite, which results in rapid progress in liver disease and even death (25), as mentioned earlier. Early diagnosis of Cryptosporidium species infection, particularly during the asymptomatic phase and possibly with the use of molecular techniques, is extremely important for patients with PID who may undergo transplantation and receive proper treatment to avoid serious complications. In our group of patients, after diagnosis of cryptosporidiosis, 2 started azithromycin therapy (patients 3 and 6) and patient 1 was given combined treatment with azithromycin and paromomycin. During several months of observation, neither resolution of bile duct abnormalities nor elimination of the parasite was observed.

Conversely, children with symptoms of bile duct inflammation or hepatitis of unknown origin should be monitored for PID disorders. If possible, every case of Cryptosporidium-associated prolonged diarrhea in children should be screened for XHIM (in boys) or HIGM3 (in both sexes) (36).

In summary, this study underlines the need for a regular screening of selected patients with PID for infection by Cryptosporidium species. Unrecognized cases of cryptosporidiosis in children with PIDs may lead to serious consequences with development of sclerosing cholangitis, liver cirrhosis, and cholangiocarcinoma (32). Cryptosporidium species that are rarely found in humans, such as C meleagridis, can play an important role in the pathogenesis of cholangitis and diarrhea in PID. In agreement with a previous study (25), our data confirmed that microscopy is less sensitive than nested PCR for the detection of the parasite in asymptomatic cases (Tables 3 and 4). Therefore, molecular diagnostic tools should be considered the method of choice in screening of PIDs. Stool samples from such patients should be checked regularly, at least 3 times per year, even in the absence of diarrhea or other symptoms. Finally, because the eradication of cryptosporidial infection is difficult to obtain, even under long-lasting therapeutic regimes, new efficacious drugs are urgently needed.

Back to Top | Article Outline

REFERENCES

1. Huang DB, Chappell C, Okhuysen PC. Cryptosporidiosis in children. Semin Pediatr Infect Dis 2004; 15:253–259.

2. Siński E, Szklarczyk J, Oralewska B, et al. Cryptosporidium sp. infection in children with symptoms of gastro-enteritis. Acta Parasitol Polon 1988; 33:295–301.

3. Neill MA, Rice SK, Ahmad NV, et al. Cryptosporidiosis: anunrecognised cause of diarrhoea in elderly hospitalised patients. Clin Infect Dis 1996; 22:168–170.

4. Kocoshis SA, Cibull ML, Davis TE, et al. Intestinal and pulmonary cryptosporidiosis in an infant with severe combined immune deficiency. J Pediatr Gastroenetrol Nutr 1984; 3:149–157.

5. Levy J, Espanol-Boren T, Thomas C. Clinical spectrum of X linked hyper-IgM syndrome. J Pediatr 1997; 131:47–54.

6. Davies EG, Hadzic N, Jones AM. Cholangiopathy in children with combined immunodeficiencies [abstract]. Mol Immunol 1998; 35:731.

7. Hunter PR, Nichols G. Epidemiology and clinical features of Cryptosporidium infection in immunocompromised patients. Clin Microbiol Rev 2002; 15:145–154.

8. Thompson RC, Olson ME, Zhu G, et al. Cryptosporidium and cryptosporidiosis. Adv Parasitol 2005; 59:77–158.

9. Cacciò SM, Thompson RCA, McLauchlin J, et al. Unravelling Cryptosporidium and Giardia epidemiology. Trends Parasitol 2005; 21:430–437.

10. O'Donoghoue PJ. Cryptosporidium and cryptosporidiosis in man and animals. Int J Parasitol 1995; 25:139–195.

11. Cello JP. Human immunodeficiency virus associated biliary tract disease. Semin Liver Dis 1992; 12:213–218.

12. Clark DP. New insights into human cryptosporidiosis. Clin Microbiol Rev 1999; 12:554–563.

13. Henriksen S, Pohlenz J. Staining of cryptosporidia by modified Ziehl-Neelsen technique. Acta Vet Scand 1981; 22:594–596.

14. Da Silva AJ, Bornay-Llinares FJ, Moura INS, et al. Fast and reliable extraction of protozoan parasite DNA from fecal specimens. Mol Diag 1999; 4:57–64.

15. Pedraza-Diaz S, Amar C, Nichols GL, et al. Nested polymerase chain reaction for amplification of the Cryptosporidium oocyst wall protein gene. Emerg Infect Dis 2001; 7:49–56.

16. Spano F, Putignani L, McLauchlin J, et al. PCR-RFLP analysis of the Cryptosporidium oocyst wall protein (COWP) gene discriminates between C. wrairi and C. parvum, and between C. parvum isolates of human and animal origin. FEMS Microbiol Lett 1997; 150:209–217.

17. Xiao L, Limor J, Morgan UM, et al. Sequence differences in the diagnostic target region of the oocyst wall protein gene of Cryptosporidium parasites. Appl Environ Microbiol 2000; 66:5499–5502.

18. Fayer R, Speer CA, Dubey JP. The general biology of cryptosporidium. In: Fayer R (ed). Cryptosporidium and Cryptosporidiosis. Boca Raton, FL: CRC Press; 1997:1–41.

19. Chen W, Harp JA, Harmsen AG, et al. Gamma interferon functions in resistance to Cryptosporidium parvum infection in SCID mice. Infect Immunol 1993; 61:3548–3551.

20. McDonald V, Bancroft GJ. Mechanisms of innate and acquired resistance to Cryptosporidium parvum infection in SCID mice. Parasite Immunol 1994; 16:315–320.

21. Perryman LE, Mason PH, Chrisp CE. Effect of spleen cell populations on resolution of Cryptosporidium parvum infection in SCID mice. Adv Parasitol 1998; 40:87–119.

22. Ungar BLP, Kao TC, Burris JA, et al. Cryptosporidium infection in an adult mouse model. Independent roles for IFNγ and CD4+T lymphocytes in protective immunity. J Immunol 1991; 147:1014–1022.

23. Ferrari S, Giliani S, Insalco A, et al. Mutations of CD40 gene cause an autosomal recessive form of immunodeficiency with hyper IgM. Proc Nat Acad Sci U S A 2001; 98:12614–12619.

24. Winkelstein JA, Marino MC, Ochs H, et al. The X-linked hyper-IgM syndrome. Medicine 2003; 82:373–384.

25. McLauchlin J, Amar C, Pedraza-Diaz S, et al. Molecular epidemiological analysis of Cryptosporidium spp. in the United Kingdom: results of genotyping Cryptosporidium spp. in 1705 fecal samples from humans and 105 fecal samples from livestock animals. J Clin Microbiol 2000; 38:3984–3990.

26. Caccio S, Pinter E, Fantini R, et al. Human infection with Cryptosporidium felis: case report and literature review. Emerg Infect Dis 2002; 8:85–86.

27. Sargent KD, Morgan UM, Elliot A, et al. Morphological and genetic characterisation of Cryptosporidium oocysts from domestic cats. Vet Prasitol 1998; 7:221–227.

28. Fayer R, Ttout JM, Xiao L, et al. Cryptosporidium canis n. sp. from domestic dogs. J Parasitol 2001; 87:1415–1422.

29. Slavin D. Cryptosporidium meleagridis (sp. Nov.). J Comp Pathol Ther 1955; 65:262–266.

30. Toniati P, Savoldi G, Jones AM, et al. Report of the ESID collaborative study on clinical features and molecular analysis of X-linked hyper-IgM syndrome. Eur Soc Immunodeficiencies Newslett 2002; F9(Suppl):40.

31. Gennery AR, Khawaja K, Veys P, et al. Treatment of CD40 ligand deficiency by hematopoietic stem cell transplantation: a survey of the European experience, 1993–2002. Blood 2004; 103:1152–1157.

32. Heyward AR, Levy J, Facchetti F, et al. Cholangiopathy and tumors of the pancreas, liver and biliary tree in boys with X-linked immunodeficiency with hyper IgM. J Immunol 1997; 158:977–983.

33. Zulu I, Kelly P, et al. Nitazoxanide for persistent diarrhoea in Zambian acquired immune deficiency syndrome patients: a randomized-controlled trial. Aliment Pharmacol Ther 2005; 21:757–63; Notarangelo LD, Hayward AR, X-linked immunodeficiency with hyper IgM (XHIM). Clin Exp Immunol. 2000;120:399–405.

34. Dimicoli S, Benesoussan D, Latger-Cannard V, et al. Complete recovery from Cryptosporidium parvum infection with gastroenterocolitis and sclerosis cholangitis after successful bone marrow transplantation in two brothers with X-linked hyper-IgM syndrome. Bone Marrow Transplant 2003; 32:733–737.

35. Rodrigues F, Davies EG, Harrison P, et al. Liver disease in children with primary immunodeficiencies. J Pediatr 2004; 145:333–339.

36. Kutukculer N, Moratto D, Aydinok Y, et al. Disseminated Cryptosporidium infection in an infant with hyper-IgM syndrome caused by CD40 deficiency. J Pediatr 2003; 142:194–196.

Cited By:

This article has been cited 14 time(s).

Pediatric Clinics of North America
Childhood Parasitic Infections Endemic to the United States
Barry, MA; Weatherhead, JE; Hotez, PJ; Woc-Colburn, L
Pediatric Clinics of North America, 60(2): 471-+.
10.1016/j.pcl.2012.12.011
CrossRef
Current Medical Research and Opinion
Diarrhea in solid-organ transplant recipients: a review of the evidence
Pant, C; Deshpande, A; Larson, A; O'Connor, J; Rolston, DDK; Sferra, TJ
Current Medical Research and Opinion, 29(): 1315-1328.
10.1185/03007995.2013.816278
CrossRef
Experimental Parasitology
Molecular epidemiology of cryptosporidiosis: An update
Xiao, LH
Experimental Parasitology, 124(1): 80-89.
10.1016/j.exppara.2009.03.018
CrossRef
Journal of Pediatric Surgery
Eradication of cryptosporidium from a defunctionalized colon limb by refeeding stoma effluent
Sidebotham, EL; Sepkowitz, K; Price, AP; Steinherz, PG; La Quaglia, MP; Kayton, ML
Journal of Pediatric Surgery, 45(1): E33-E36.
10.1016/j.jpedsurg.2009.10.091
CrossRef
Parasitology Research
Genotyping of Cryptosporidium isolates from human clinical cases in Poland
Bajer, A; Bednarska, M; Caccio, SM; Wolska-Kusnierz, B; Heropolitanska-Pliszka, E; Bernatowska, E; Wielopolska, M; Paziewska, A; Welc-Faleciak, R; Sinski, E
Parasitology Research, 103(1): 37-42.
10.1007/s00436-008-0924-5
CrossRef
Clinical Microbiology Reviews
Clinical Significance of Enteric Protozoa in the Immunosuppressed Human Population
Stark, D; Barratt, JLN; van Hal, S; Marriott, D; Harkness, J; Ellis, JT
Clinical Microbiology Reviews, 22(4): 634-+.
10.1128/CMR.00017-09
CrossRef
Future Microbiology
Human immune responses in cryptosporidiosis
Borad, A; Ward, H
Future Microbiology, 5(3): 507-519.
10.2217/FMB.09.128
CrossRef
Plos One
Putative cis-Regulatory Elements Associated with Heat Shock Genes Activated During Excystation of Cryptosporidium parvum
Cohn, B; Manque, P; Lara, AM; Serrano, M; Sheth, N; Buck, G
Plos One, 5(3): -.
ARTN e9512
CrossRef
International Journal for Parasitology
Molecular approaches to diversity of populations of apicomplexan parasites
Beck, HP; Blake, D; Darde, ML; Felger, I; Pedraza-Diaz, S; Regidor-Cerrillo, J; Gomez-Bautista, M; Ortega-Mora, LM; Putignani, L; Shiels, B; Tait, A; Weir, W
International Journal for Parasitology, 39(2): 175-189.
10.1016/j.ijpara.2008.10.001
CrossRef
Annals of Tropical Medicine and Parasitology
Intestinal parasitic infections: prevalences in HIV/AIDS patients in a Thai AIDS-care centre
Saksirisampant, W; Prownebon, J; Saksirisampant, P; Mungthin, M; Siripatanapipong, S; Leelayoova, S
Annals of Tropical Medicine and Parasitology, 103(7): 573-581.
10.1179/000349809X12502035776072
CrossRef
Parasitology Research
Cryptosporidium and Giardia spp. infections in humans, animals and the environment in Poland
Bajer, A
Parasitology Research, 104(1): 1-17.
10.1007/s00436-008-1179-x
CrossRef
Postepy Mikrobiologii
Microsporidia - opportunistic pathogens of humans
Bednarska, M
Postepy Mikrobiologii, 52(1): 53-63.

Clinical Microbiology Reviews
Cryptosporidium Pathogenicity and Virulence
Bouzid, M; Hunter, PR; Chalmers, RM; Tyler, KM
Clinical Microbiology Reviews, 26(1): 115-134.
10.1128/CMR.00076-12
CrossRef
Journal of Experimental Medicine
Loss-of-function mutations in the IL-21 receptor gene cause a primary immunodeficiency syndrome
Kotlarz, D; Zietara, N; Uzel, G; Weidemann, T; Braun, CJ; Diestelhorst, J; Krawitz, PM; Robinson, PN; Hecht, J; Puchalka, J; Gertz, EM; Schaffer, AA; Lawrence, MG; Kardava, L; Pfeifer, D; Baumann, U; Pfister, ED; Hanson, EP; Schambach, A; Jacobs, R; Kreipe, H; Moir, S; Milner, JD; Schwille, P; Mundlos, S; Klein, C
Journal of Experimental Medicine, 210(3): 433-443.
10.1084/jem.20111229
CrossRef
Back to Top | Article Outline
Keywords:

Cryptosporidium species; Hyperimmunoglobulin M syndrome; Primary immunodeficiencies; Sclerosing cholangitis

© 2007 Lippincott Williams & Wilkins, Inc.

Login

Article Tools

Images

Share

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.

Connect With Us

 

 

Twitter

twitter.com/JPGNonline

 

Visit JPGN.org on your smartphone. Scan this code (QR reader app required) with your phone and be taken directly to the site.