Skip Navigation LinksHome > May 1, 2013 - Volume 63 - Issue 1 > IL28B Polymorphism, Pretreatment CXCL10, and HCV RNA Levels...
JAIDS Journal of Acquired Immune Deficiency Syndromes:
doi: 10.1097/QAI.0b013e31828323c1
Basic and Translational Science

IL28B Polymorphism, Pretreatment CXCL10, and HCV RNA Levels Predict Treatment Response in Racially Diverse HIV/HCV Coinfected and HCV Monoinfected Patients

Zeremski, Marija PhD*; Dimova, Rositsa B. PhD*; Makeyeva, Jessy BS*; Sipley, John D. PhD; Jacobson, Ira M. MD*; Rennert, Hanna PhD; Talal, Andrew H. MD, MPH*

Free Access
Article Outline
Collapse Box

Author Information

*Center for the Study of Hepatitis C and Division of Gastroenterology and Hepatology, Weill Cornell Medical College, New York, NY;

Department of Pathology and Laboratory Medicine, Weill Cornell Medical College, New York, NY; and

Department of Pathology and Laboratory Medicine, New York-Presbyterian Hospital, New York, NY.

Correspondence to: Marija Zeremski, PhD, Weill Cornell Medical College, 1300 York Avenue, Box 319, New York, NY 10065 (e-mail: maz2003@med.cornell.edu).

Presented at the 63rd Annual Meeting of the American Association for the Study of Liver Diseases, November 9–13, 2012, Boston, MA and at the 19th International Symposium on Hepatitis C Virus and Related Viruses, October 5–9, 2012, Venice, Italy.

Supported by an investigator-initiated project by Merck, Inc.

M. Zeremski and R.B. Dimova received research support from Merck. A.H. Talal has been a consultant and advisor for Merck, Inc., Boerhinger-Ingelheim, and Pfizer; has received research support from Merck, Inc, Vertex, Tibotec, Janssen, Bristol-Meyers Squibb, Boehringer-Ingelheim, and Abbott; and is a member of the speakers' bureaus for Vertex and Genentech. I.M. Jacobson has received grant and research support from Schering-Plough, Merck, Tibotec, Janssen, Roche, Genentech, Pharmasset, Achillion, Anadys, Boehringer-Ingelheim, Novartis, Gilead, Vertex, GlobeImmune, Human Genome Sciences, Pfizer, Bristol Myers Squibb, and Zymogenetics; has been a consultant and advisor for Bristol Myers Squibb, Novartis, Gilead, Schering, Merck, Pfizer, Vertex, Globelmmune, Human Genome Sciences, Boehringer-Ingelheim, Pharmasset, Zymogenetics, Tibotec, Janssen, Abbott, Roche, Genentech, Anadys, Sanofi-Aventis, Achillion, Glaxo Smithkline, and Biolex and is on the speakers' bureaus for Schering, Merck, Gilead, Bristol Myers Squibb, Roche, Genentech, and Vertex. The remaining authors have no conflicts of interest to disclose.

Received August 29, 2012

Accepted December 12, 2012

Collapse Box

Abstract

Objective: We sought to develop a score to predict sustained virological response (SVR) in racially diverse HIV/hepatitis C virus (HCV)–coinfected and HCV-monoinfected pegylated interferon/ribavirin-treated patients.

Methods: We retrospectively evaluated 374 patients (259 monoinfected and 115 coinfected) treated at a single tertiary care center. The IL28B rs12979860 single nucleotide polymorphism genotyping was performed in 335 patients, and plasma CXCL10 levels were measured by enzyme-linked immunosorbent assay in 171 patients.

Results: Of the 374 patients, 64.9% were white, 17.2% were African American, 76.5% were HCV genotype 1 infected, and 49.3% had advanced fibrosis. Sustained virological response was achieved by 151 (40.4%) patients, 106 (40.9%) patients monoinfected, and 45 (39.1%) patients coinfected. Patients with IL28B C/C genotype were significantly more likely to achieve an SVR compared with non-C/C genotype patients, but only if they were infected with HCV genotypes 1/4 (59.1% vs 21.1%, P < 0.0001). No significant differences existed in IL28B predictive capacity between coinfected and monoinfected patients. Pretreatment CXCL10 levels were significantly higher in nonresponders, both monoinfected and coinfected, compared with SVR patients (P = 0.0018). Coinfected patients had higher CXCL10 levels compared with monoinfected patients (P = 0.03). The combination of IL28B genotype, pretreatment CXCL10 and HCV RNA levels, and HCV genotype had the best ability to predict treatment response in both patient groups (area under the receiver operating characteristic curve = 0.85). Among all patients, a cutoff score of −0.94 or more had a sensitivity of 0.93 and specificity of 0.59. In coinfected patients, a score of −0.55 or more had sensitivity of 0.81 and specificity of 0.80.

Conclusions: IL28B genotype, pretreatment CXCL10, and HCV RNA levels have very good capacity to predict pegylated interferon/ribavirin–treatment outcome in both HIV/HCV coinfected and HCV monoinfected patients.

Back to Top | Article Outline

INTRODUCTION

Hepatitis C virus (HCV) infection globally affects up to 170 million people1 and almost 5 million Americans.2 It is a major cause of chronic liver disease that can lead to cirrhosis and hepatocellular carcinoma. In developed countries, chronic hepatitis C is the primary indication for liver transplantation.3 Due to shared transmission routes, most importantly injection drug use, approximately one-third of HIV-infected people are also infected with HCV.4 Liver fibrogenesis is accelerated in HIV/HCV coinfection, particularly among patients with ineffective HIV therapy and in those with substantial CD4 lymphopenia. Due to improvements in HIV treatment efficacy with resulting decreases in HIV-attributable mortality, HCV-associated liver disease has become a leading cause of death in HIV-infected individuals.5

Until recently, pegylated interferon (PEG-IFN) and ribavirin (RBV) were standard of care for the treatment of chronic HCV infection in all patients. PEG-IFN/RBV treatment results in sustained virological response (SVR) in approximately half of HCV-infected people, but among those with genotype 1, responses are substantially decreased.6–8 In 2011, the first direct acting antivirals (DAAs) that inhibit the HCV NS3-NS4A protease, boceprevir and telaprevir were approved by US and European regulatory authorities for use in chronic HCV genotype 1 monoinfected patients.9–11 Treatment-naïve patients who receive boceprevir or telaprevir in combination with PEG-IFN/RBV can achieve SVR rates of 70% or higher. These agents are not yet approved by the US Food and Drug Administration for HCV treatment in other populations, such as those with HIV/HCV coinfection or infection with other HCV genotypes.

Prediction of HCV treatment outcome continues to be an important factor in counseling of patients with regard to timing of HCV treatment initiation, particularly, in light of anticipated future modifications in HCV therapeutics. Specifically, whether to initiate treatment with IFN-based therapies or to await approval of all DAA-combination regimens that avoid IFN is significantly influenced by fibrosis stage and the likelihood of achieving an SVR. Although it is not possible to predict with certainty the patients who will respond to PEG-IFN/RBV, certain factors, such as older age, advanced fibrosis stage, African American (AA) race, infection with HCV genotype 1, and higher pretreatment HCV RNA levels have all been associated with decreased treatment efficacy. Additionally, elevated pretreatment peripheral concentration of the chemokine CXCL10 is a negative predictor of treatment efficacy in both HCV monoinfected12,13 and HIV/HCV coinfected patients.14,15 Finally, the strongest predictors of PEG-IFN/RBV response identified to date were several highly correlated single nucleotide polymorphisms (SNPs) located in the vicinity of the IL28B gene that encode for IFN-λ-3.16–18 The rs12979860 is the SNP with the highest predictive capacity, and both HIV/HCV coinfected15,19 and HCV monoinfected16,20 PEG-IFN/RBV-treated patients with C/C rs12979860 SNP genotype are significantly more likely to eradicate HCV compared to patients with C/T and T/T genotypes. Interestingly, patients of African ancestry are more likely to have the T/T genotype,21 a negative predictor of treatment efficacy.

While factor combinations have been assessed for their predictive capacity in PEG-IFN/RBV treated patients,15,20,22,23 their performance in HIV/HCV coinfection remains poorly evaluated. Here, we sought to identify the best predictors of PEG-IFN/RBV treatment response in a racially diverse population of coinfected and monoinfected patients. We analyzed the predictive capacity of several factors, including IL28B rs12979860 SNP genotype, pretreatment peripheral CXCL10 and HCV RNA levels, HCV genotype, fibrosis stage, and demographic characteristics. Besides differences in predictive capacity between those with single and dual virus infection, we sought to evaluate the effect of race on their predictive capacity for a successful outcome to PEG-IFN/RBV.

Back to Top | Article Outline

METHODS

Patients

All patients included in this study were drawn from those evaluated and treated for chronic HCV infection at the Center for the Study of Hepatitis C at Weill Cornell Medical College. Patients were selected based on the availability of frozen peripheral blood mononuclear cells and buffy coat samples, which were used for IL28B genotyping and pretreatment plasma samples used for CXCL10 measurements. Patients on whom the IL28B rs12979860 SNP genotype test was performed for clinical purposes (LabCorp, Research Triangle Park, NC) were also included in the study. All patients provided an informed consent at the time of the blood draw. The study was approved by the Weill Cornell Medical College institutional review board and was performed in accordance with the Declaration of Helsinki.

A total of 374 patients, 259 HCV monoinfected and 115 HIV/HCV coinfected, were included in the study. All patients completed a full course of PEG-IFN and RBV therapy, with the exception of 3 patients: 2 HIV/HCV coinfected, 1 treated with IFN, 1 with IFN and RBV, both of whom achieved an SVR, and 1 HCV monoinfected treated with PEG-IFN who also achieved an SVR. IL28B rs12979860 SNP genotype was determined in 335 patients (34 by LabCorp), 222 monoinfected, and 113 coinfected. Pretreatment plasma CXCL10 levels were measured in 171 patients, 117 monoinfected and 54 coinfected. Plasma samples were obtained on average 1.4 ± 2.1 months before treatment initiation. Both IL28B genotype and pretreatment CXCL10 measurements were available for 132 patients, 80 monoinfected and 52 coinfected. Pretreatment HCV RNA levels were extracted through chart review and were available for 366 patients, 253 monoinfected and 113 coinfected. HCV RNA measurements were performed on average 2.3 ± 4.6 months before treatment initiation.

Fibrosis stage was determined either through liver biopsy according to the Scheuer24 classification or through a clinical assessment of cirrhosis based on a combination of clinical, laboratory, and radiological assessments. Fibrosis stage was available in 343 patients, 233 monoinfected and 110 coinfected.

Back to Top | Article Outline
IL28B Genotyping

Genomic DNA was isolated from frozen peripheral blood mononuclear cell or buffy coat samples using QIAamp DNA Blood Mini Kit (Qiagen, Germantown, MD). DNA samples were genotyped for the IL28B rs12979860 SNP genotype using a Custom TaqMan SNP genotyping Assay (Applied Biosystems, Foster City, CA) consisting of rs12979860 forward primer GCCTGTCGTGTACTGAACCA, reverse primer GCGCGGAGTGCAATTCAAC, and the probes TGGTTCGCGCCTTC [VIC] and CTGGTTCACGCCTTC [FAM], on an ABI 7900HT instrument. After a 10-minute incubation at 95°C, 40 cycles of polymerase chain reaction amplification at 92°C for 15 seconds and 60°C for 1 minute were performed. After polymerase chain reaction amplification, an allelic discrimination plate read was performed using the ABI SDS 2.2.2 software auto-calling system. Genotyping calls were considered appropriate after inspection only when the quality value of the call was greater than or equal to 95%.

Back to Top | Article Outline
CXCL10 Measurements

Plasma CXCL10 concentration was measured using commercially available enzyme-linked immunosorbent assay kits (BD OptEIA, BD Biosciences, San Diego, CA). Plasma samples were kept frozen at –70°C and were not previously thawed before use in these experiments.

Back to Top | Article Outline
Statistical Analysis

Statistical analysis was performed using SAS (SAS Institute Inc., Cary, NC) and R (http://www.r-project.org/). Associations between categorical variables were assessed through Fisher exact test and logistic regression. For continuous variables, comparisons between groups were performed using Wilcoxon rank sum or Kruskal–Wallis test. We evaluated the abilities of CXCL10, IL28B, as well as of appropriate linear scores of multiple covariates to predict successful treatment outcome and thus to serve as diagnostic tests through estimation of the area under the receiver operating characteristic (AUROC) curve. The ROC curve is presented through a plot of the true positive rate (sensitivity) versus the false positive rate (1-specificity). The AUROC was estimated by the trapezoidal rule and represents the probability that a randomly selected pair of subjects [sustained responders and nonresponders (NRs)] will be classified correctly. To estimate the linear combination of the available variables, which predicts successful treatment outcome, we used logistic regression. Comparison of the ROC curves was based on DeLong et al.25 The significance level in all tests was α = 0.05.

Back to Top | Article Outline

RESULTS

Patients' Characteristics

A total of 374 patients were included in this study, 259 of whom were HCV monoinfected and 115 HIV/HCV coinfected. Patients' mean age was 49.4 ± 9.4 years, 62% were male, 64.9% were white, and 17.2% were AA (Table 1). There were significantly more AA among coinfected (31.3%) compared with monoinfected (10.9%) patients (P < 0.0001). Most of the patients were infected with HCV genotype 1 (76.5%) and 49.3% patients had advanced liver disease (Scheuer stage 3–4). Among 335 patients on whom IL28B genotype was available, 100 (29.9%) were C/C, 174 (51.9%) were C/T, and 61 (18.2%) were T/T genotype. We did not observe significant differences in IL28B genotype distribution between monoinfected and coinfected patients. T/T genotype was significantly more frequent among AA patients compared with other races (31.2% vs 15.3%, P = 0.006).

Table 1
Table 1
Image Tools

Pretreatment plasma CXCL10 concentration was measured in 171 patients (117 monoinfected and 54 coinfected). Coinfected patients had significantly higher CXCL10 expression levels compared with monoinfected patients (P = 0.030). Patients infected with HCV genotypes 1 or 4 also had higher pretreatment CXCL10 values compared with those infected with genotypes 2 or 3 (P = 0.023). We did not observe significant differences in pretreatment CXCL10 levels between patients of different racial backgrounds.

Back to Top | Article Outline
IL28B Genotypes and Treatment Response

SVR was achieved by 151 (40.4%) patients, 106 (40.9%) of whom were monoinfected and 45 (39.1%) coinfected (P = 0.82). Patients with IL28B C/C genotype were significantly more likely to achieve an SVR compared with patients with non-C/C genotypes, but only if they were infected with HCV genotypes 1 or 4 (59.1% vs 21.1%, P < 0.0001) (Fig. 1A). Among patients monoinfected with HCV genotypes 1 or 4, those with IL28B C/C genotype had an SVR rate of 61.4% compared with 20.5% in those with non-C/C IL28B genotypes (P < 0.0001). Among HIV/HCV coinfected patients infected with genotypes 1 or 4, SVR was achieved by 54.6% of C/C patients compared with 22.7% of those with C/T and T/T genotypes (P = 0.008). In patients infected with HCV genotypes 2 and 3, SVR was achieved by 76.5% of patients with IL28B C/C genotype compared with 66.7% of patients with non-C/C genotypes (P = 0.433) (Fig. 1B). However, patients with IL28B T/T genotype were significantly less likely to achieve an SVR compared to those with C/C and C/T genotypes (22.95% vs 42.7%, P = 0.009), and this association did not differ between HCV genotypes 1/4 and 2/3 (P = 0.255). The ability of IL28B T/T genotype to predict treatment nonresponse did not significantly differ between monoinfected and coinfected patients (P = 0.338). When we analyzed the influence of race on treatment outcome, we identified a trend of lower SVR rates among AA patients, after adjusting for IL28B genotype (odds ratio = 0.5087; 95% confidence interval [CI]: 0.2587, 1.0004; P = 0.052).

Figure 1
Figure 1
Image Tools
Back to Top | Article Outline
CXCL10 Levels and Treatment Response

Coinfected patients overall had higher pretreatment CXCL10 expression levels compared with monoinfected patients (P = 0.030) (Fig. 2A). Pretreatment CXCL10 levels were also significantly higher in treatment NRs, both monoinfected and coinfected, compared with SVR patients (P = 0.002) (Fig. 2B). In monoinfected patients, mean ln (CXCL10) levels were 6.45 ± 0.75 in treatment responders compared with 6.72 ± 0.62 in treatment NRs (P = 0.006). In HIV/HCV coinfected SVR patients, mean pretreatment ln (CXCL10) levels were 6.56 ± 0.56 compared with 7.08 ± 0.84 in treatment NR (P = 0.012). We did not observe significant differences in CXCL10 expression between patients with different IL28B genotypes (P = 0.129). However, among patients infected with HCV genotypes 1 or 4, those with IL28B T/T genotype had significantly higher CXCL10 levels compared to those with non-T/T genotypes (P = 0.038). This association was not observed in patients infected with HCV genotypes 2 or 3 (P = 0.422), which may be because of the small sample size (ie, only 5 of 34 patients infected with genotypes 2 or 3 who also had CXCL10 measured were IL28B T/T genotype). There were no significant differences in CXCL10 expression levels between AA compared with patients from other racial backgrounds.

Figure 2
Figure 2
Image Tools
Back to Top | Article Outline
Other Factors and Treatment Response

Patients infected with HCV genotypes 2 or 3 were significantly more likely to achieve an SVR compared to patients infected with HCV genotypes 1 or 4 (73.8% vs 31.4%, P < 0.0001) (Table 2). HCV RNA levels were significantly higher in NR patients compared to SVR patients [mean ln (HCV RNA): 14.25 ± 1.5 vs 12.88 ± 2.06, P < 0.0001]. Viral load was also significantly higher in HIV/HCV coinfected [mean ln (HCV RNA): 14.14 ± 1.75] compared with HCV monoinfected patients [mean ln (HCV RNA): 13.45 ± 1.90, P = 0.001]. African American patients were significantly less likely to achieve an SVR compared with patients from other racial backgrounds (26.6% vs 43.4%, P = 0.014). The SVR rates did not differ depending on fibrosis stage, gender, or age of the patients.

Table 2
Table 2
Image Tools
Back to Top | Article Outline
Performance Characteristics of Multiple Factor Combinations to Predict Treatment Response

We used logistic regression to investigate the abilities of combinations of factors to predict successful treatment outcome. We modeled the following factors: IL28B SNP genotype, pretreatment CXCL10 and HCV RNA levels, fibrosis stage, HCV genotype, and the age, race, and gender of the patients. Of all analyzed factors, only IL28B genotype, pretreatment CXCL10, pretreatment HCV RNA, and HCV genotype significantly contributed to the ability to predict treatment outcome. The estimated ROC curves with the respective AUROC for all patients (N = 121) are shown in Figure 3A. Based on logistic regression, we estimated the combined linear score of ln (CXCL10), IL28B, ln (HCV RNA), and HCV genotype as: 16.32 (±3.76) − 0.39 (±0.13) × ln (HCV RNA) + 1.44 (±0.68) × 1{if CC} − 0.47 (±0.64) × 1{if CT} − 1.6 (±0.43) × ln (CXCL10) − 0.97 (±0.55) × 1{if genotype 1/4} and estimated its AUROC as 0.85 (95% CI: 0.78 to 0.92). The AUROCs for IL28B (0.66, 95% CI: 0.57 to 0.75) and for ln (CXCL10) (0.71, 95% CI: 0.62 to 0.80) were significantly lower than the AUROC for the combined score (P < 0.0001 and P = 0.002, respectively). Next, we evaluated their performance characteristics and found that a cutoff score of −0.94 or higher resulted in sensitivity of 0.93 and specificity of 0.59 to predict successful treatment outcome (Fig. 3B).

Figure 3
Figure 3
Image Tools

In HIV/HCV coinfected patients (N = 51), 3 factors, ln (CXCL10), ln (HCV RNA), and IL28B genotype, had the best model fit with the AUROC of the combined linear score of 0.87 (95% CI: 0.78 to 0.97) (Fig. 3C). The AUROC for the individual factors was estimated to be 0.70 (95% CI: 0.55 to 0.84) for ln (CXCL10), 0.67 (95% CI: 0.53 to 0.82) for IL28B, and 0.79 (95% CI: 0.64 to 0.95) for ln (HCV RNA). The linear combination of all 3 factors had significantly higher AUROC than that calculated for CXCL10 or IL28B individually (P = 0.0283 and P = 0.0076, respectively). A cutoff score of −0.55 or higher resulted in sensitivity of 0.81 and specificity of 0.80 (Fig. 3D).

Back to Top | Article Outline

DISCUSSION

Despite the recent approval of DAAs for treatment of HCV genotype 1 monoinfected people, many patients infected with other HCV genotypes and those coinfected with HIV are still treated with PEG-IFN/RBV. Therefore, the identification of factors capable of predicting successful PEG-IFN/RBV treatment outcome remains an important clinical objective. Here, we show that the combination of IL28B SNP genotype, HCV genotype, pretreatment CXCL10, and pretreatment HCV RNA levels has very good ability to predict SVR among a racially diverse population of HIV/HCV coinfected and HCV monoinfected patients.

Our results confirm the importance of IL28B SNP genotype in predicting treatment response to PEG-IFN/RBV, both in HCV monoinfection and in HIV/HCV coinfection.16–19 Our patients with C/C genotype were significantly more likely to achieve an SVR compared with non-C/C patients, but only if infected with HCV genotypes 1 or 4. Among patients infected with genotypes 2 or 3, those with IL28B genotype T/T were significantly less likely to achieve an SVR compared with C/C and C/T patients. We also found that patients of AA ancestry were significantly less likely to achieve an SVR compared with patients from other racial backgrounds. NR patients, both monoinfected and coinfected, had significantly higher pretreatment CXCL10 levels compared with those who achieved an SVR. This finding is in agreement with previous reports that high levels of CXCL10 predict nonresponse to PEG-IFN/RBV in both monoinfected and coinfected patients.12–15,26–28 We also found significantly elevated CXCL10 levels in patients infected with HCV genotypes 1 or 4 compared with those infected with genotypes 2 or 3 and in HIV/HCV coinfected patients compared with HCV monoinfected patients. As HIV infection can independently increase CXCL10 expression,14 elevated levels found in coinfected patients are not unexpected. Finally, higher pretreatment viral loads, infection with HCV genotype 1, and AA race were also significantly associated with treatment nonresponse.

Among our patients, we showed that the combination of IL28B and HCV genotype with pretreatment CXCL10 and HCV RNA levels has improved predictive capacity for treatment response compared with any of these factors separately. Among all patients, using a cutoff score of –0.94, we were able to identify treatment responders with sensitivity of 0.93 and specificity of 0.59. The model has similar accuracy when used in the HIV/HCV coinfected population. Using a cutoff value of –0.55, we could identify coinfected treatment responders with sensitivity of 0.81 and specificity of 0.80. To our knowledge, only one study by Payer et al15 evaluated the combination of IL28B and pretreatment CXCL10 levels as predictors of treatment response in HIV/HCV coinfected patients. Although the combination of the 2 factors seems to have additional predictive value in that study, formal statistical comparisons of the performance characteristics were not presented. In our study, multivariable analysis permitted identification of a linear combination of factors with very good ability to predict treatment outcome. Finally, Payer et al analyzed racially homogeneous European coinfected patients, whereas our study included a racially and ethnically heterogeneous US population.

Interestingly, our SVR rate was almost equivalent in coinfected and monoinfected patients. Although response rates in coinfected patients were similar to those reported in the literature, treatment responses in our monoinfected population were somewhat lower than expected. This could, at least in part, be explained by the intrinsic differences between the 2 viral infections that may have resulted in sampling bias. The HIV outpatient clinic at our institution serves the primary care needs of HIV-infected patients regardless of their HCV status, which permitted sample collection even very remotely from their HCV treatment course. Conversely, many HCV monoinfected patients are referred to the hepatologist for specialty care; if they achieve a successful treatment outcome, they almost always discontinue follow-up for HCV care, thereby severely limiting the possibility to collect samples for IL28B genotyping.

Coinfection with HIV increases HCV treatment complexity because of potential drug–drug interactions. In addition, coinfected patients frequently have more preexisting comorbidities, and they historically have had decreased HCV treatment efficacy. PEG-IFN/RBV, currently the FDA-approved treatment for HIV/HCV coinfected patients, is associated with significant side effects and considerable costs. Consequently, predictive indices to identify patients most likely to successfully respond to that therapy are of clinical importance. Here, we report that the combination of several factors, including IL28B SNP genotype, pretreatment CXCL10 and HCV RNA levels, and HCV genotype, has very good capacity to predict patients most likely to respond to PEG-IFN/RBV treatment. The degree to which these same combinations of factors will predict treatment outcome in DAA-treated patients remains to be determined.

Back to Top | Article Outline
ACKNOWLEDGMENTS

The authors acknowledge current and former physicians affiliated with Weill Cornell Division of Gastroenterology and Hepatology: Drs Maya Gambarin-Gelwan, Gerond Lake-Bakaar, Rebecca Gross, and Mark Russo. They also thank the physicians of the New York Presbyterian Hospital Outpatient HIV Clinic specifically Drs Roy Gulick, Jon Jacobs, Sam Merrick, Marshall Glesby, Kristen Marks, Duane Smith, Sian Jones, Cecilia Yoon, Mary Vogler, Carlos Vaamonde, Harjot Singh, Susan Ball, Tim Wilkin, Larry Siegel, and Usha Mather-Wagh.

Back to Top | Article Outline

REFERENCES

1. World Health Organization. Hepatitis C. Fact sheet No. 164. 2011. Available at: http://www.who.int/mediacentre/factsheets/fs164/en/. Accessed October 12, 2011.

2. Chak E, Talal AH, Sherman KE, et al.. Hepatitis C virus infection in USA: an estimate of true prevalence. Liver Int. 2011;31:1090–1101.

3. Brown RS. Hepatitis C and liver transplantation. Nature. 2005;436:973–978.

4. Kadam JS, Talal AH. Changing treatment paradigms: hepatitis C virus in HIV-infected patients. AIDS Patient Care STDS. 2007;21:154–168.

5. Bica I, McGovern B, Dhar R, et al.. Increasing mortality due to end-stage liver disease in patients with human immunodeficiency virus infection. Clin Infect Dis. 2001;32:492–497.

6. Fried MW, Shiffman ML, Reddy KR, et al.. Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. N Engl J Med. 2002;347:975–982.

7. Manns MP, McHutchison JG, Gordon SC, et al.. Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomised trial. Lancet. 2001;358:958–965.

8. Torriani FJ, Rodriguez-Torres M, Rockstroh JK, et al.. Peginterferon Alfa-2a plus ribavirin for chronic hepatitis C virus infection in HIV-infected patients. N Engl J Med. 2004;351:438–450.

9. Poordad F, McCone J Jr, Bacon BR, et al.. Boceprevir for untreated chronic HCV genotype 1 infection. N Engl J Med. 2011;364:1195–1206.

10. Jacobson IM, McHutchison JG, Dusheiko G, et al.. Telaprevir for previously untreated chronic hepatitis C virus infection. N Engl J Med. 2011;364:2405–2416.

11. Sherman KE, Flamm SL, Afdhal NH, et al.. Response-guided telaprevir combination treatment for hepatitis C virus infection. N Engl J Med. 2011;365:1014–1024.

12. Butera D, Marukian S, Iwamaye AE, et al.. Plasma chemokine levels correlate with the outcome of antiviral therapy in patients with hepatitis C. Blood. 2005;106:1175–1182.

13. Lagging M, Romero AI, Westin J, et al.. IP-10 predicts viral response and therapeutic outcome in difficult-to-treat patients with HCV genotype 1 infection. Hepatology. 2006;44:1617–1625.

14. Zeremski M, Markatou M, Brown QB, et al.. Interferon gamma-inducible protein 10: a predictive marker of successful treatment response in hepatitis C virus/HIV-coinfected patients. J Acquir Immune Defic Syndr. 2007;45:262–268.

15. Payer BA, Reiberger T, Aberle J, et al.. IL28B and interferon-gamma inducible protein 10 for prediction of rapid virologic response and sustained virologic response in HIV-HCV-coinfected patients. Eur J Clin Invest. 2012;42:599–606.

16. Ge D, Fellay J, Thompson AJ, et al.. Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature. 2009;461:399–401.

17. Suppiah V, Moldovan M, Ahlenstiel G, et al.. IL28B is associated with response to chronic hepatitis C interferon-alpha and ribavirin therapy. Nat Genet. 2009;41:1100–1104.

18. Tanaka Y, Nishida N, Sugiyama M, et al.. Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. Nat Genet. 2009;41:1105–1109.

19. Rallon NI, Naggie S, Benito JM, et al.. Association of a single nucleotide polymorphism near the interleukin-28B gene with response to hepatitis C therapy in HIV/hepatitis C virus-coinfected patients. AIDS. 2010;24:F23–F29.

20. Darling JM, Aerssens J, Fanning G, et al.. Quantitation of pretreatment serum interferon-gamma-inducible protein-10 improves the predictive value of an IL28B gene polymorphism for hepatitis C treatment response. Hepatology. 2011;53:14–22.

21. Thomas DL, Thio CL, Martin MP, et al.. Genetic variation in IL28B and spontaneous clearance of hepatitis C virus. Nature. 2009;461:798–801.

22. Lagging M, Askarieh G, Negro F, et al.. Response prediction in chronic hepatitis C by assessment of IP-10 and IL28B-related single nucleotide polymorphisms. PLoS One. 2011;6:e17232.

23. Fattovich G, Covolo L, Bibert S, et al.. IL28B polymorphisms, IP-10 and viral load predict virological response to therapy in chronic hepatitis C. Aliment Pharmacol Ther. 2011;33:1162–1172.

24. Scheuer PJ. Classification of chronic viral hepatitis: a need for reassessment. J Hepatol. 1991;13:372–374.

25. DeLong ER, DeLong DM, Clarke-Pearson DL. Comparing the areas under two or more correlated receiver operating characteristic curves: a nonparametric approach. Biometrics. 1988;44:837–845.

26. Diago M, Castellano G, Garcia-Samaniego J, et al.. Association of pretreatment serum interferon {gamma} inducible protein 10 levels with sustained virological response to peginterferon plus ribavirin therapy in genotype 1 infected patients with chronic hepatitis C. Gut. 2006;55:374–379.

27. Apolinario A, Diago M, Lo Iacono O, et al.. Increased circulating and intrahepatic T-cell-specific chemokines in chronic hepatitis C: relationship with the type of virological response to peginterferon plus ribavirin combination therapy. Aliment Pharmacol Ther. 2004;19:551–562.

28. Romero AI, Lagging M, Westin J, et al.. Interferon (IFN)-gamma-inducible protein-10: association with histological results, viral kinetics, and outcome during treatment with pegylated IFN- alpha 2a and ribavirin for chronic hepatitis C virus infection. J Infect Dis. 2006;194:895–903.

Keywords:

hepatitis C virus treatment; predictors of treatment outcome; treatment biomarkers; CXCL10; IL28B

© 2013 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.