Skip Navigation LinksHome > February 1, 2008 - Volume 47 - Issue 2 > Virologic Determinants of Success After Structured Treatment...
JAIDS Journal of Acquired Immune Deficiency Syndromes:
doi: 10.1097/QAI.0b013e31815dbf7f
Basic Science

Virologic Determinants of Success After Structured Treatment Interruptions of Antiretrovirals in Acute HIV-1 Infection

Lewin, Sharon R FRACP, PhD*†; Murray, John M PhD‡§; Solomon, Ajantha BSc (Hons)†; Wightman, Fiona BSc (Hons)†; Cameron, Paul U FRACP, FRCPA, PhD*†; Purcell, Damian J PhD∥; Zaunders, John J PhD¶; Grey, Pat RN, BA, DipEd, GradDipAppSci, Dip Counselling§; Bloch, Mark MBBS, DipFP, MMed#; Smith, Don MB, ChB, MD**; Cooper, David A AO, BSc (Med), MBBS, DSc, FRCP, FRACP, FRCPA, MD§; Kelleher, Anthony D FRACP, FRCPA, PhD§¶

Free Access
Article Outline
Collapse Box

Author Information

From the *Infectious Diseases Unit, Alfred Hospital, Melbourne, Australia; †Department of Medicine, Monash University, Melbourne, Australia; ‡School of Mathematics and Statistics, University of New South Wales, Sydney, Australia; §National Centre in HIV Epidemiology and Clinical Research, University of New South Wales, Sydney, Australia; ∥Department of Microbiology and Immunology, The University of Melbourne, Melbourne, Australia; ¶Centre for Immunology, St. Vincent's Hospital, Sydney, Australia; #Holdsworth House Medical Practice, Sydney Australia; and **Albion Street Centre, Sydney, Australia.

Received for publication July 15, 2007; accepted October 10, 2007.

Funded by the National Health and Medical Research Council (A. Solomon, F. Wightman, P. U. Cameron, S. R. Lewin) and The Alfred Foundation (S. R. Lewin). The National Centre in HIV Epidemiology and Clinical Research is supported by the Commonwealth Department of Health and Ageing.

Data presented at the 13th Conference on Retroviruses and Opportunistic Infections, Los Angeles, CA, February 25-28, 2007.

Correspondence to: Sharon R. Lewin, FRACP, PhD, Director, Infectious Diseases Unit, Alfred Hospital, and Professor, Department of Medicine, Monash University, Level 2, Burnet Building, Commercial Road, Melbourne, Victoria, 3008, Australia (e-mail: s.lewin@alfred.org.au).

Collapse Box

Abstract

Background: Latently infected resting memory CD4 T cells are thought to be the major reservoir that contributes to rebound viremia after cessation of antiretrovirals (ARVs). Commencing ARVs during primary HIV-1 infection (PHI) may limit the size of the latent pool and lead to improved control of viral replication during structured treatment interruption (STI).

Methods: Individuals with PHI (n = 59) were randomized to receive ARVs with or without hydroxyurea. After STI, a good response was defined as maintenance of HIV-1 RNA <5000 copies/mL for 24 weeks off therapy. In a detailed prospective virologic substudy (n = 19), integrated HIV-1 DNA, total HIV-1 DNA, and cell-associated HIV-1 unspliced (US) RNA were quantified using a real-time polymerase chain reaction assay.

Results: The plasma HIV-1 RNA 12 weeks after the initiation of ARVs was significantly lower in good responders (n = 7) compared with poor responders (n = 12) (P = 0.005). There were no significant differences between good and poor responders in integrated HIV-1 DNA, HIV-1 DNA, and HIV-1 US RNA. Integrated HIV-1 DNA before initiation of ARVs was strongly correlated with plasma HIV-1 RNA at week 12 (P = 0.006, r = 0.81).

Conclusion: HIV-1 RNA measured 12 weeks after initiation of ARV was the only virologic variable associated with viral rebound after treatment interruption in PHI.

Combination antiretrovirals (ARVs) for the treatment of HIV-1 infection have led to a major improvement in mortality and morbidity.1 The successful use of combination ARVs, however, is limited by drug-related toxicities, high costs, and drug resistance.2 Structured treatment interruptions (STIs) have been investigated as a treatment strategy for HIV-1-infected individuals potentially to reduce long-term exposure to ARVs and/or to enhance HIV-1-specific T-cell responses leading to long-term virologic control (recently reviewed3,4). In patients with chronic HIV-1 infection, the benefit of STI seems to be limited and has been shown to be detrimental to clinical outcome in some studies.5,6 In the setting of primary HIV-1 infection (PHI), transient containment of viremia after STI has been demonstrated, although these studies have largely been small and nonrandomized.7-9

Why some HIV-1-infected individuals can successfully contain viral replication after STI is not well understood, and the mechanisms are likely to be different in the setting of chronic infection and PHI. In chronic HIV-1 infection, virologic control after STI has been associated with a number of virologic parameters, including lower plasma HIV-1 RNA and lower HIV-1 DNA before ARV treatment, reduced number of drug-resistant quasispecies, and reduced viral fitness and diversity.10-12 The virologic determinants of successful virologic control after STI in PHI have not been evaluated in detail and have largely only looked at HIV-1 RNA and total HIV-1 DNA.13-15

Latently infected resting memory CD4 T cells are thought to be the major reservoir that contributes to rebound viremia after cessation of ARVs.16,17 Quantification of total HIV-1 DNA is frequently used as a surrogate for the quantification of latently infected cells.18,19 Total HIV-1 DNA includes a large proportion of DNA that is unintegrated and not replication competent, however.20 Assessment of integrated HIV-1 viral load therefore may more accurately quantify the pool of infected cells. Several methods that quantify integrated HIV-1 DNA have been described, including reverse linker polymerase chain reaction (PCR)21,22 and Alu-PCR.23,24

Rebound viremia after cessation of ARVs may also be influenced by the amount of persistent active viral replication that can occur even when plasma HIV-1 RNA is <50 copies/mL or less than the lower limit of detection of current commercial assays. Detection of residual viral replication has been demonstrated by quantification of cell-associated HIV-1 unspliced (US) or multiply spliced (MS) RNA,25-29 viral sequence evolution,30 ultrasensitive plasma HIV-1 RNA assays.31,32 and the detection of 2 long terminal repeat (LTR) circles (by products of retroviral complementary DNA [cDNA] synthesis).29,33

We hypothesized that the total pool of infected cells and the degree of persistent viral replication would determine the likelihood of successful virologic control after STI in PHI. We therefore performed a prospective detailed virologic analysis of individuals with PHI enrolled in a randomized trial of ARVs alone or ARVs in combination with hydroxyurea (HU) followed by up to 3 STIs.13

Back to Top | Article Outline

METHODS

Patients and Specimens

Patients were enrolled in a previously described clinical study of STI in PHI called PULSE.13 In brief, patients with PHI received a standardized ARV regimen consisting of 800 mg of indinavir administered twice daily, 100 mg of ritonavir administered twice daily, 400 mg of didanosine administered once daily, and 40 mg of stavudine administered twice daily or 150 mg of lamivudine administered twice daily for up to 12 months and were randomized to 500 mg of HU administered twice daily or not. If viral suppression (<50 copies/mL) was achieved, up to 3 STIs were undertaken. Two ARV cycles were allowed after each STI if virologic rebound to more than 5000 HIV-1 RNA copies/mL occurred. Treatment success was defined as maintaining viral loads <5000 copies/mL for 6 months after STI. All patients provided written informed consent in accordance with the guidelines of the Human Research and Ethics Committee of the University of New South Wales, Sydney, Australia.

A prospective virologic substudy was performed for 19 of the 59 patients enrolled in the study. Blood samples (including plasma and peripheral blood mononuclear cells [PBMCs]) were obtained before initiation of ARV; after 12, 24, and 52 weeks of ARV; and then before each STI and at the time of restarting ARVs. PBMCs and plasma were separated from blood by use of Ficoll-gradient purification and frozen at −80°C.

Back to Top | Article Outline
HIV-1 Integrated DNA

HIV-1 integrated DNA was quantified using a previously described nested real-time PCR assay with some minor modifications to improve the sensitivity for patient PBMCs.34,35 In brief, high-molecular-weight DNA was extracted from patient cells using the Qiagen Genomic DNA kit (Qiagen, Valencia, CA), as recommended by the manufacturer. Using this kit, chromosomal DNA (average molecular weight of 20 to 150 kb) was purified; therefore, extrachromosomal DNA, including unintegrated viral DNA, was largely removed. DNA from at least 2 million PBMCs was extracted, and samples were eluted in 80 μL of 10-mM Tris-Cl, pH 8.5, and stored at −20°C until used.

For the PCR reaction, 5 μL of DNA was added to the first-round PCR with a final concentration of 1 × PCR buffer (Applied Biosystems, Foster City, CA), 1.25 U of AmpliTaq DNA polymerase (Applied Biosystems), 2.5 mM of MgCl2, 0.8 mM of deoxynucleoside triphosphate, and 0.3 μM of each primer (HIV-1 LTR forward primer MH535: 5′-AACTAGGGAACCCACTGCTTAAG-3′ [coordinates 9574 to 9597] and genomic Alu reverse primer SB704: 5′-TGCTGGGATTACAGGCGTGAG-3′) as previously described.34 Cycling conditions for the first-round PCR were 95°C for 10 minutes and then 18 cycles of 94°C for 15 seconds and 60°C for 1 minute. Five microliters of the first-round product was then added to a second-round PCR mix with a final concentration of 1 × PCR buffer (Applied Biosystems), 1.25 U of AmpliTaq DNA polymerase (Applied Biosystems), 3.5 mM of MgCl2, 0.8 mM of deoxynucleoside triphosphate, 0.3 μM of each primer (HIV-1 LTR forward primer SL75: 5′-GGAACCCACTGCTTAAGCCTC-3′ [coordinates 9579 to 9601] and HIV-1 LTR reverse primer SL76: 5′-GTCTGAGGGATCTCTAGTTACC-3′ [coordinates 9658 to 9679]), and HIV-1 LTR beacon SL72 (6-carboxyfluorescein, FAM-CGGTCG-AGTGCTTCAAGTAGTGTGTGCCCGTC-CGACCG-tetramethyl-rhodamine, TAMRA [coordinates 9618 to 9644]). The second-round PCR was performed in a spectrofluorometric thermal cycler (iCycler; Biorad, Hercules, CA), and the cycling conditions were 95°C for 10 minutes and 94°C for 15 seconds, 60°C for 45 seconds, and 72°C for 45 seconds for 45 cycles. The second-round PCR reaction is referred to as the LTR-LTR PCR (locations of primers and probes are provided in Fig. 1 and Table 1).

Table 1
Table 1
Image Tools
Figure 1
Figure 1
Image Tools

Several controls were included for the nested PCR as previously described.35 First, a separate reaction mix was included for the first-round PCR identical to that described above, except only a single primer to the LTR was included and the primer to the Alu repeat element was not included. This control identified what component of the second-round PCR was a consequence of linear amplification from the LTR in the first round PCR (referred to as “LTR primer alone”). Second, a separate reaction mix was included for the first round identical to that described previously, except Taq DNA polymerase was not added. This control identified what component of the second-round PCR was a consequence of PCR amplification from the LTR alone and not integrated HIV-1 DNA. This control measured amplification from only the second-round LTR-LTR PCR or total HIV-1 DNA (summarized in Table 1 and Fig. 2).

Figure 2
Figure 2
Image Tools

All samples for the first- and second-round PCR assays were run in replicates of 5, given the varying length of the Alu-LTR amplicon, leading to high intra-assay variability of the Alu-LTR first-round reaction. A mean value of the 5 replicates was used to calculate the integrated copy number. To normalize for cell equivalents in the input DNA, we performed a separate real-time PCR with primers and beacons to detect the number of CCR5 copies as previously described.36

Given that DNA from the first round PCR was diluted 10-fold in the second round PCR, a difference of more than 3 cycles (which approximates a 10-fold change in template) between the threshold cycle (Ct) from the Alu-LTR/LTR-LTR reaction and the Ct from the LTR primer alone control reaction was required to demonstrate true amplification from the Alu-LTR reaction, and therefore to confirm that integrated HIV-1 DNA was present and quantifiable (see Fig. 2). The assay detected a minimum of 16 copies per reaction. Therefore, using a target number of cell equivalents of between 50,000 and 100,000 cells per reaction, the assay had a lower limit of detection of 16 to 32 copies per 100,000 cells.

Back to Top | Article Outline
Generation of Standards for Quantification of Integrated HIV-1

A standard that contained integrated HIV-1 DNA at random locations, and therefore at varying distances from the Alu repeat elements, was generated as previously described.34 Briefly the 293T-cell line was infected with a vesicular stomatitis virus G (VSV-G) pseudotyped HIV-1 that contained a deletion in envelope (VSV-G-HIVΔenv). Pseudotyped VSV-G-HIVΔenv was titrated using a reporter cell line, CEM-T-cell line, stably transfected with a green fluorescent protein (GFP) construct linked to the HIV-1 LTR promoter (CEM-GFP) to achieve a high multiplicity of infection (MOI = 1). Virus stock was filtered though a 0.45-μm filter (Sartorius, Goettingen, Germany) and treated with DNase 1 (Promega, Madison, WI) and added to 293T cells. Cells were passaged for 4 weeks to ensure that all the extracellular chromosomal forms of viral DNA were cleared as previously described.34 We therefore assumed that all HIV-1 genomes in the culture were now in an integrated form and quantified the amount of HIV-1 using an alternative real-time PCR assay that had both primers within the LTR.19,34,37

Back to Top | Article Outline
Quantification of Total HIV-1 DNA

To measure total HIV-1 DNA, a separate real-time PCR was performed. Briefly, each 50-μL reaction contained 5 μL of DNA, and the final concentration of each component was as follows: 1 × Taqman buffer II (Perkin Elmer, Waltham, MA), 3.5 mM of MgCl2, 0.8 mM of deoxynucleoside triphosphate, 1.25 U of AmpliTaq Gold DNA polymerase, 0.4 μM of each primer (sense: 5′-TCTCTAGCAGTGGCGCCCGAACA-3′ and antisense 5′-TCTCCTTCTAGCCTCCGCTAGTC-3′, and 0.2 μM of molecular beacon 5′ FAM (6-carboxyfluorescein)-CGGGAG TACTCACCAGTCGCCGCCCC CTCCCG (4-dimethylaminophenlazobenzoic acid, DABCYL) 3′. The PCR was performed in a spectrofluorometric thermal cycler (iCycler), and the cycling conditions were 95°C for 10 minutes, followed by 45 cycles of 94°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds.

Back to Top | Article Outline
HIV-1 RNA: Cell-Associated and Plasma

HIV-1 US RNA was quantified from PBMCs as previously described.25 HIV-1 plasma RNA was quantified using the Roche Amplicor assay (Roche Diagnostics, Basel, Switzerland). For samples with an HIV-1 viral load >700,000 copies/mL, serial dilutions were performed to achieve an accurate value.

Back to Top | Article Outline
Statistics

HIV-1 RNA copies/mL less than the detection limit of 50 copies/mL were included in the analysis as 50 copies/mL. Total HIV-1 DNA and US HIV-1 RNA copies less than their detection limits of 20 and 200 copies per 106 PBMCs, respectively, were included for the analysis as 20 and 200 copies per 106 PBMCs. Integrated HIV-1 DNA levels <16 copies per input cellular DNA were included as 16 copies and adjusted for the amount of DNA added to the assay (15,000 to 150,000 cell equivalents) to copies per 106 PBMCs. HIV-1 DNA, integrated HIV-1 DNA, and US HIV-1 RNA per 106 PBMCs were then converted to copies per 106 CD4 T cells using the proportion of CD4 T cells to total PBMCs at each time point.

Comparisons of continuous variables between groups were performed with the Wilcoxon rank sum test, whereas the Fisher exact test was used for contingency analysis. Correlations were performed with Spearman rank correlation. P values <0.05 were considered significant.

Back to Top | Article Outline

RESULTS

Kinetics of Cell-Associated HIV-1 DNA and RNA After STI

The change in all virologic parameters over time during treatment and after STI is summarized in Figure 3. As expected, plasma HIV-1 RNA decreased during ARV treatment and was >5000 copies/mL at the time of reintroduction of ARVs (as per the treatment protocol). The change in HIV-1 DNA and US HIV-1 RNA was similar to that in plasma HIV-1 RNA. The proportions of individuals with detectable HIV-1 DNA and US HIV-1 RNA at the end of the first ARV interruption were 78% (15 of 19 individuals) and 21% (3 of 14 individuals), respectively; at the end of the second interruption, the proportions were 81% (9 of 11 individuals) and 22% (2 of 9 individuals), respectively; and at the end of the third interruption, the proportions were 90% (9 of 10 individuals) and 20% (2 of 10 individuals), respectively. There were no significant differences in the proportions of individuals with detectable HIV-1 DNA or HIV-1 US RNA or in the copy number of HIV-1 DNA or HIV-1 US RNA at each interruption.

Figure 3
Figure 3
Image Tools
Back to Top | Article Outline
Virologic Determinants of Treatment Success

Treatment success, or a “good response,” was achieved in 7 individuals (5 after the first interruption and 2 after the third interruption). The clinical and virologic differences between good (n = 7) and poor (n = 12) responders are summarized in Table 2. In brief, there was no significant difference in baseline HIV-1 plasma RNA, CD4 T-cell count, HIV-1 integrated DNA, or HU use between good and poor responders. The plasma HIV-1 RNA 12 weeks after the initiation of ARV was significantly lower in good responders compared with poor responders (median [interquartile range (IQR)] in good responders was 50 [50 to 50] copies/mL and was 430 [100 to 1260] copies/mL in poor responders; P = 0.005), and plasma HIV-1 RNA was significantly more likely to be undetectable in good responders (<50 copies/mL; P = 0.017). HIV-1 DNA and HIV-1 US RNA were only quantified after the commencement of ARVs, and there were no significant differences between good and poor responders at any time in the proportion of individuals with detectable HIV-1 DNA and HIV-1 US RNA (Fisher exact test; P > 0.1 for all time points) or in the copy number of HIV-1 DNA or HIV-1 US RNA.

Table 2
Table 2
Image Tools

Because week 12 plasma HIV-1 RNA was the best predictor of good response of all virologic components, we then investigated whether its predictive capability was also valid in the total cohort (n = 59 [18 good responders and 41 poor responders]). As observed in the subjects enrolled in the virology substudy, there was significantly lower plasma HIV-1 RNA at week 12 after initiation of ARVs in good responders compared with poor responders in the total cohort (P = 0.006). Finally, the proportion of individuals with plasma HIV-1 RNA lower than detection at week 12 for the total cohort was significantly greater for good responders compared with poor responders (odds ratio [OR] = 4.1; P = 0.02). Baseline plasma HIV-1 RNA was significantly lower in good responders compared with poor responders in the total cohort (P = 0.01), however, which was not observed in the smaller cohort enrolled in the virology substudy. In a multivariate analysis on the total cohort, baseline and week 12 plasma HIV-1 RNA were significant independent predictors of a good response (P = 0.035 and P = 0.047, respectively).

Back to Top | Article Outline
HIV-1 Integrated DNA Was Associated With an Early Response to Treatment

To gain further insight into potential mechanisms of virologic rebound, we then determined correlations between each of the viral quantification methods during this first year of ARVs. Baseline integrated HIV-1 DNA was assessed relative to other components at all available time points, whereas plasma HIV-1 RNA, total HIV-1 DNA, and HIV-1 US RNA were assessed relative to each other at corresponding time points. After Bonferroni adjustment for multiple testing, only 2 comparisons were significantly correlated. Integrated HIV-1 DNA at baseline was strongly correlated with plasma HIV-1 RNA at week 12 (P = 0.006, r = 0.81; n = 15; Fig. 4A) but not with plasma HIV-1 RNA at baseline. The association remained significant even when we only considered individuals with detectable integrated HIV-1 DNA (P = 0.03). Total HIV-1 DNA and HIV-1 US RNA (on ARVs) were not significantly associated with plasma HIV-1 RNA at baseline or week 12 (Fig. 4B-C). Total HIV-1 DNA and US HIV-1 RNA at week 12 were significantly correlated (P = 0.03, r = 0.68; n = 19; see Fig. 4D), however. When we only included individuals in whom HIV-1 US RNA was detectable (n = 4), the association was no longer significant.

Figure 4
Figure 4
Image Tools
Back to Top | Article Outline

DISCUSSION

We demonstrate here that the viral load measured 12 weeks after initiation of ARVs in primary infection was strongly associated with successful virologic control after interruption of ARVs. Although the concentration of integrated HIV-1 DNA before initiation of treatment was strongly correlated with HIV-1 RNA after 12 weeks of ARVs, quantification of integrated HIV-1 DNA itself before initiation of ARVs or that of HIV-1 DNA or US HIV-1 RNA did not predict a good or poor response after interruption of ARVs.

The only significant virologic factor that was correlated with clinical outcome, defined as the extent of rebound of viral replication, was the plasma HIV-1 RNA level at week 12 of treatment. This remained significant when we looked at all subjects in the study (n = 59). In addition, the plasma HIV-1 RNA level before initiation of ARVs was significantly associated with clinical outcome, as previously reported by our group and others.13,38,39 It was interesting that there was a correlation between integrated HIV-1 DNA before therapy and the week 12 plasma HIV-1 RNA level, suggesting that the total number of infected cells before ARVs may determine the pattern of viral kinetics after the initiation of ARVs, specifically the second phase decay, as predicted in earlier mathematic models of HIV-1 viral kinetics.40,41 In this study, we were unable to address the relation between integrated DNA prior to treatment and HIV RNA on treatment because detailed viral kinetic analyses were not performed, but this relation should be explored in future studies after treatment of primary infection.

We were unable to demonstrate that a more sensitive marker of the number of infected cells (HIV-1 DNA or integrated HIV-1 DNA) or residual viral replication (eg, HIV-1 US RNA) may predict clinical outcome after cessation of ARVs. Another study of treatment interruption after acute HIV-1 infection also showed that the concentration of HIV-1 DNA did not predict the likelihood of viral rebound14 in contrast to studies of treatment interruption in chronic infection, where the baseline concentration of HIV-1 DNA was lower in individuals with a successful outcome after treatment interruption.11,42 We were unable to measure total HIV-1 DNA at baseline; however, the level of HIV-1 DNA before each treatment interruption or at any time on treatment was not associated with the likelihood of viral rebound.

No previous studies have evaluated the role of cell-associated HIV-1 RNA in predicting viral rebound after cessation of ARV. In this study, few individuals had detectable cell-associated HIV-1 US RNA before (20%) or after (∼50%) treatment interruption. This is consistent with previous studies, which showed that HIV-1 US RNA is found in some but not all individuals receiving ARVs and that the amount of HIV-1 US RNA increases soon after treatment interruption.25,27-29 We chose to measure HIV-1 US RNA in preference to MS RNA because we and others have demonstrated that HIV-1 US RNA is more commonly detected in individuals receiving ARV than MS RNA encoding for tat-rev.25,33 Another group that studied HIV-1 US RNA and MS RNA during STI in chronic infection found that MS RNA encoding nef transcripts was more frequently detected than MS RNA encoding tat/rev transcripts and cell-associated US RNA in individuals receiving ARVs, however. In addition, the level of MS RNA encoding nef predicted rebound viremia after treatment interruption.27 Measurement of transcripts other than cell-associated US RNA may be a more sensitive marker to predict viral rebound.

This is the first study to determine if quantification of integrated HIV-1 DNA may predict viral rebound after interruption of ARVs. There have been 4 previous methods described to quantify integrated HIV-1 DNA. The methods include 1-step Alu-LTR amplification;34 nested PCR using linker primers;21,22 real-time nested PCR using Alu-specific primers and a virus specific primer without a tag sequence;24,35 and, more recently, real-time nested PCR using Alu-specific primers and a virus-specific primer with a tag sequence.43,44 By the addition of a tag sequence to the virus-specific primer, the specificity of amplification is substantially improved, because amplification of unintegrated forms of HIV-1 is reduced. We did not use a tag sequence in this study but accounted for the potential contribution of unintegrated HIV-1 DNA to the detection of integrated HIV-1 DNA by including “no polymerase” and LTR alone controls. We only considered true detection of integrated HIV-1 DNA, if there was at least a 3-threshold cycle shift between the LTR alone control and the Alu-LTR/LTR-LTR reaction. This stringent approach may have potentially underestimated the amount of integrated HIV-1 DNA present and reduced the sensitivity of the assay in vivo. The frequency of detection of integrated HIV-1 DNA in untreated individuals was approximately 40%, however, which is similar to that recently reported using a similar technique.24

There were several limitations to this study. First, we were unable to measure all parameters on baseline specimens, given the large number of cells required to quantify integrated HIV-1 DNA. We did, however, measure residual HIV-1 DNA and HIV-1 US messenger RNA (mRNA) before each interruption. We hypothesized that this was the best time to quantify the size of the residual reservoir. Second, the sensitivity of each of the assays used was limited by the total amount of DNA added to each assay. This was dependent on sample availability and inhibition of PCR in the presence of >1 μg of cellular DNA. Therefore, we were unable to detect and quantify integrated HIV-1 DNA and HIV-1 US mRNA in a significant number of specimens, although the frequency of detection was consistent with previous reports with different assay techniques.24,27 Given the detailed virologic analyses required for each patient, the sample size was small; therefore, these findings need to be confirmed in a larger study. This study only addressed virologic parameters associated with viral rebound when other factors may clearly be relevant, such as the CD8 T-cell, immune activation, and neutralizing antibody response.38,45-47 Finally, in this study, we only evaluated potential viral reservoirs in blood, and it is possible that the source of rebound virus may be from other anatomic sites that have a high burden of HIV-1 infection, such as the gastrointestinal tract or lymphoid tissue.48-50

In summary, we identified that HIV-1 RNA measured 12 weeks after initiation of ARVs was the only virologic variable associated with viral rebound after treatment interruption. The use of more complex assays to measure cell-associated virus in blood, including quantification of integrated HIV-1 DNA, did not help to predict the likelihood of viral rebound after STI in the setting of PHI.

Back to Top | Article Outline

ACKNOWLEDGMENTS

The authors thank all the participants and investigators of the PULSE study and Ming Lee Goh and Jane Howard for development of the integrated HIV cell line.

Back to Top | Article Outline

REFERENCES

1. Palella FJ Jr, Delaney KM, Moorman AC, et al. Declining morbidity and mortality among patients with advanced human immunodeficiency virus infection. HIV Outpatient Study Investigators. N Engl J Med. 1998;338:853-860.

2. Chen LF, Hoy J, Lewin SR. Ten years of highly active antiretroviral therapy for HIV infection. Med J Aust. 2007;186:146-151.

3. Ananworanich J, Hirschel B. Interrupting highly active antiretroviral therapy in patients with HIV. Expert Review of Anti Infective Therapy. 2005;3:51-60.

4. Julg B, Goebel FD. Treatment interruption in HIV therapy: a SMART strategy? Infection. 2006;34:186-188.

5. Ananworanich J, Gayet-Ageron A, Le Braz M, et al. CD4-guided scheduled treatment interruptions compared with continuous therapy for patients infected with HIV-1: results of the Staccato randomised trial. Lancet. 2006;368:459-465.

6. El-Sadr WM, Lundgren JD, Neaton JD, et al. CD4+ count-guided interruption of antiretroviral treatment. N Engl J Med. 2006;355:2283-2296.

7. Markowitz M, Jin X, Hurley A, et al. Discontinuation of antiretroviral therapy commenced early during the course of human immunodeficiency virus type 1 infection, with or without adjunctive vaccination. J Infect Dis. 2002;186:634-643.

8. Kaufmann DE, Lichterfeld M, Altfeld M, et al. Limited durability of viral control following treated acute HIV infection. PLoS Med. 2004;1:e36.

9. Rosenberg ES, Billingsley JM, Caliendo AM, et al. Vigorous HIV-1-specific CD4+ T cell responses associated with control of viremia [see comments]. Science. 1997;278:1447-1450.

10. Fagard C, Oxenius A, Gunthard H, et al. A prospective trial of structured treatment interruptions in human immunodeficiency virus infection. Arch Intern Med. 2003;163:1220-1226.

11. Yerly S, Gunthard HF, Fagard C, et al. Proviral HIV-DNA predicts viral rebound and viral setpoint after structured treatment interruptions. AIDS. 2004;18:1951-1953.

12. Joos B, Trkola A, Fischer M, et al. Low human immunodeficiency virus envelope diversity correlates with low in vitro replication capacity and predicts spontaneous control of plasma viremia after treatment interruptions. J Virol. 2005;79:9026-9037.

13. Bloch MT, Smith DE, Quan D, et al. The role of hydroxyurea in enhancing the virologic control achieved through structured treatment interruption in primary HIV infection: final results from a randomized clinical trial (PULSE). J Acquir Immune Defic Syndr. 2006;42:192-202.

14. Hoen B, Fournier I, Lacabaratz C, et al. Structured treatment interruptions in primary HIV-1 infection: the ANRS 100 PRIMSTOP trial. J Acquir Immune Defic Syndr. 2005;40:307-316.

15. Rosenberg ES, Altfeld M, Poon SH, et al. Immune control of HIV-1 after early treatment of acute infection. Nature. 2000;407:523-526.

16. Zhang L, Chung C, Hu BS, et al. Genetic characterization of rebounding HIV-1 after cessation of highly active antiretroviral therapy. J Clin Invest. 2000;106:839-845.

17. Chun TW, Davey RT Jr, Engel D, et al. Re-emergence of HIV after stopping therapy. Nature. 1999;401:874-875.

18. Shaunak S, Teo I. Monitoring HIV disease with new and clinically useful surrogate markers. Curr Opin Infect Dis. 2003;16:581-586.

19. Zhang L, Ramratnam B, Tenner-Racz K, et al. Quantifying residual HIV-1 replication and decay of the latent reservoir in patients on seemingly effective antiretroviral therapy. N Engl J Med. 1999;340:1605-1613.

20. Chun T-W, Stuyer L, Mizell S, et al. Presence of an inducible HIV-1 latent reservoir during highly active antiretroviral therapy. Proc Natl Acad Sci USA. 1997;94:13193-13197.

21. Kumar R, Vandegraaff N, Mundy L, et al. Evaluation of PCR-based methods for the quantitation of integrated HIV-1 DNA. J Virol Methods. 2002;105:233-246.

22. Vandegraaff N, Kumar R, Burrell CJ, et al. Kinetics of human immunodeficiency virus type 1 (HIV) DNA integration in acutely infected cells as determined using a novel assay for detection of integrated HIV DNA. J Virol. 2001;75:11253-11260.

23. Sonza S, Maerz A, Deacon N, et al. Human immunodeficiency virus type 1 replication is blocked prior to reverse transcription and integration in freshly isolated peripheral blood monocytes. J Virol. 1996;70:3863-3869.

24. Carr JM, Cheney KM, Coolen C, et al. Development of methods for coordinate measurement of total cell-associated and integrated human immunodeficiency virus type 1 (HIV-1) DNA forms in routine clinical samples: levels are not associated with clinical parameters, but low levels of integrated HIV-1 DNA may be prognostic for continued successful therapy. J Clin Microbiol. 2007;45:1288-1297.

25. Lewin S, Vesanen M, Kostrikis L, et al. The use of real-time PCR and molecular beacons to detect virus-replication in HIV-1-infected individuals on prolonged effective antiretroviral therapy. J Virol. 1999;73:6099-6103.

26. Vesanen M, Markowitz M, Cao Y, et al. Human immunodeficiency virus type-1 mRNA splicing pattern in infected persons is determined by the proportion of newly infected cells. Virology. 1997;236:104-109.

27. Fischer M, Joos B, Hirschel B, et al. Cellular viral rebound after cessation of potent antiretroviral therapy predicted by levels of multiply spliced HIV-1 RNA encoding nef. J Infect Dis. 2004;190:1979-1988.

28. Fischer M, Gunthard HF, Opravil M, et al. Residual HIV-RNA levels persist for up to 2.5 years in peripheral blood mononuclear cells of patients on potent antiretroviral therapy. AIDS Res Hum Retroviruses. 2000;16:1135-1140.

29. Fischer M, Trkola A, Joos B, et al. Shifts in cell-associated HIV-1 RNA but not in episomal HIV-1 DNA correlate with new cycles of HIV-1 infection in vivo. Antivir Ther. 2003;8:97-104.

30. Zhang L, Ramratnam B, Tenner-Racz K, et al. Quantifying residual HIV-1 replication in patients receiving combination antiretroviral therapy. N Engl J Med. 1999;340:1605-1613.

31. Palmer S, Wiegand AP, Maldarelli F, et al. New real-time reverse transcriptase-initiated PCR assay with single-copy sensitivity for human immunodeficiency virus type 1 RNA in plasma. J Clin Microbiol. 2003;41:4531-4536.

32. Maldarelli F, Palmer S, King MS, et al. ART suppresses plasma HIV-1 RNA to a stable set point predicted by pretherapy viremia. PLoS Pathog. 2007;3:e46.

33. Furtado M, Callaway D, Phair J, et al. Persistence of HIV-1 transcription in peripheral-blood mononuclear cells in patients receiving potent antiretroviral therapy. N Engl J Med. 1999;340:1614-1622.

34. Butler SL, Hansen MS, Bushman FD. A quantitative assay for HIV DNA integration in vivo. Nat Med. 2001;7:631-634.

35. O'Doherty U, Swiggard WJ, Jeyakumar D, et al. A sensitive, quantitative assay for human immunodeficiency virus type 1 integration. J Virol. 2002;76:10942-10950.

36. Zhang L, Lewin S, Markowitz M, et al. Measuring recent thymic emigrants in blood of normal persons and HIV-1-infected patients before and after effective therapy. J Exp Med. 1999;190:725-732.

37. Solomon A, Lane N, Wightman F, et al. Enhanced replicative capacity and pathogenicity of HIV-1 isolated from individuals infected with drug-resistant virus and declining CD4+ T-cell counts. J Acquir Immune Defic Syndr. 2005;40:140-148.

38. Oxenius A, Price DA, Gunthard HF, et al. Stimulation of HIV-specific cellular immunity by structured treatment interruption fails to enhance viral control in chronic HIV infection. Proc Natl Acad Sci USA. 2002;99:13747-13752.

39. Lafeuillade A, Poggi C, Hittinger G, et al. Predictors of plasma human immunodeficiency virus type 1 RNA control after discontinuation of highly active antiretroviral therapy initiated at acute infection combined with structured treatment interruptions and immune-based therapies. J Infect Dis. 2003;188:1426-1432.

40. Ho D, Neumann A, Perelson A, et al. Rapid turnover of plasma virions and CD4 lymphocytes in HIV-1 infection. Nature. 1995;373:123-126.

41. Perelson A, Essunger P, Cao Y, et al. Decay characteristics of HIV-1-infected compartments during combination therapy. Nature. 1997;387:188-191.

42. Kabamba-Mukadi B, Henrivaux P, Ruelle J, et al. Human immunodeficiency virus type 1 (HIV-1) proviral DNA load in purified CD4+ cells by LightCycler real-time PCR. BMC Infect Dis. 2005;5:15-24.

43. Brussel A, Sonigo P. Analysis of early human immunodeficiency virus type 1 DNA synthesis by use of a new sensitive assay for quantifying integrated provirus. J Virol. 2003;77:10119-10124.

44. Yamamoto N, Tanaka C, Wu Y, et al. Analysis of human immunodeficiency virus type 1 integration by using a specific, sensitive and quantitative assay based on real-time polymerase chain reaction. Virus Genes. 2006;32:105-113.

45. Trkola A, Kuster H, Rusert P, et al. Delay of HIV-1 rebound after cessation of antiretroviral therapy through passive transfer of human neutralizing antibodies. Nat Med. 2005;11:615-622.

46. Huber M, Fischer M, Misselwitz B, et al. Complement lysis activity in autologous plasma is associated with lower viral loads during the acute phase of HIV-1 infection. PLoS Med. 2006;3:e441.

47. Benito JM, Lopez M, Ballesteros C, et al. Immunological and virological effects of structured treatment interruptions following exposure to hydroxyurea plus didanosine. AIDS Res Hum Retroviruses. 2006;22:734-743.

48. Brenchley JM, Schacker TW, Ruff LE, et al. CD4+ T cell depletion during all stages of HIV disease occurs predominantly in the gastrointestinal tract. J Exp Med. 2004;200:749-759.

49. Mehandru S, Poles MA, Tenner-Racz K, et al. Lack of mucosal immune reconstitution during prolonged treatment of acute and early HIV-1 infection. PLoS Med. 2006;3:e484.

50. Fischer M, Joos B, Wong JK, et al. Attenuated and nonproductive viral transcription in the lymphatic tissue of HIV-1-infected patients receiving potent antiretroviral therapy. J Infect Dis. 2004;189:273-285.

Cited By:

This article has been cited 5 time(s).

Current Opinion in Hiv and AIDS
How to best measure HIV reservoirs?
Rouzioux, C; Richman, D
Current Opinion in Hiv and AIDS, 8(3): 170-175.
10.1097/COH.0b013e32835fc619
CrossRef
New Microbiologica
The role of HIV-DNA testing in clinical practice
d'Ettorre, G; Zaffiri, L; Ceccarelli, G; Mastroianni, CM; Vullo, V
New Microbiologica, 33(1): 1-11.

Journal of Gene Medicine
Mathematical modelling of the impact of haematopoietic stem cell-delivered gene therapy for HIV
Murray, JM; Fanning, GC; Macpherson, JL; Evans, LA; Pond, SM; Symonds, GP
Journal of Gene Medicine, 11(): 1077-1086.
10.1002/jgm.1401
CrossRef
Journal of Neuroimmune Pharmacology
Targeting the Glutamatergic System for the Treatment of HIV-Associated Neurocognitive Disorders
Potter, MC; Figuera-Losada, M; Rojas, C; Slusher, BS
Journal of Neuroimmune Pharmacology, 8(3): 594-607.
10.1007/s11481-013-9442-z
CrossRef
AIDS
Antiretroviral therapy in acute and recent HIV infection: a prospective multicenter stratified trial of intentionally interrupted treatment
Volberding, P; Demeter, L; Bosch, RJ; Aga, E; Pettinelli, C; Hirsch, M; Vogler, M; Martinez, A; Little, S; Connick, E; the ACTG 371 Team,
AIDS, 23(15): 1987-1995.
10.1097/QAD.0b013e32832eb285
PDF (335) | CrossRef
Back to Top | Article Outline
Keywords:

HIV-1 DNA; integrated HIV-1 DNA; primary HIV-1 infection; treatment interruption; unspliced HIV-1 RNA

© 2008 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.