Skip Navigation LinksHome > December 1, 2007 - Volume 46 - Issue 4 > LMNA Messenger RNA Expression in Highly Active Antiretrovira...
JAIDS Journal of Acquired Immune Deficiency Syndromes:
doi: 10.1097/QAI.0b013e31815aba1b
Basic Science

LMNA Messenger RNA Expression in Highly Active Antiretroviral Therapy-Treated HIV-Positive Patients

Miranda, Merce PhD*; Chacón, Matilde R PhD*; Vidal, Francesc MD, PhD†; Megia, Ana MD, PhD*; Richart, Cristóbal MD, PhD†‡; Veloso, Sergi MD†; Saumoy, Maria MD†; Olona, Carles MD§; Vendrell, Joan MD, PhD*

Free Access
Article Outline
Collapse Box

Author Information

From the *Endocrinology and Diabetes Unit, Research Department, University Hospital of Tarragona Joan XXIII, “Pere Virgili” Institute, Rovira i Virgili University, Tarragona, Spain; †Internal Medicine Service, University Hospital of Tarragona Joan XXIII, “Pere Virgili” Institute, Rovira i Virgili University, Tarragona, Spain; ‡Centro de Investigación Biomédica en Red (CIBER) Pathophysiology of Obesity (CB/06), Girona, Spain; and §Surgery Service, University Hospital of Tarragona Joan XXIII, Tarragona, Spain.

Received for publication June 1, 2007; accepted September 10, 2007.

Funded by Marató TV3 (02/1830 and 02/1910); Fondo de Investigación Sanitaria (FIS) 02-1282; FIS 05-1994, FIS 05-1591; Fundación para la investigación y prevención del SIDA en España (FIPSE) 36610-06; and the Ministerio de Sanidad y Consumo, Instituto de Salud Carlos III, Red de Sida (RIS), Red de diabetes y enfermedades metabólicas (REDIMET) (RD06/0015/0011). Dr. Matilde R. Chacón is supported by a fellowship from the FIS CP06/00119.

Correspondence to: Merce Miranda, PhD, Unitat de Recerca, Hospital Universitari Joan XXIII de Tarragona, c/o Dr. Mallafré Guasch, 4, 43007 Tarragona, Spain (e-mail: mmiranda.hj23.ics@gencat.net).

Collapse Box

Abstract

The LMNA gene encodes for lamins A and C as major products, which are involved in nuclear stability, chromatin structure, and gene expression. Several LMNA mutations cause an insulin-resistant lipodystrophy that shares features with HIV-related lipodystrophy. Some HIV-treatment agents alter lamin A/C maturation, organization, and stability in 3T3-L1. We aimed to test the hypothesis that human adipose tissue LMNA expression can be altered in highly active antiretroviral therapy (HAART)-treated HIV-positive patients with lipodystrophy. We have also analyzed both isoforms and explored if their expression is associated with insulin resistance or inflammation in these patients. A cross-sectional study that analyzed abdominal subcutaneous adipose tissue from 39 treated HIV-positive patients (25 of whom had lipodystrophy) and 21 uninfected control subjects was performed. We have observed lower levels of lamin A isoform but normal levels of lamin C isoform in all HIV-infected patients, irrespective of the presence or absence of lipodystrophy, which reinforces the idea that an altered lamin A/C ratio could reflect a pathogenic condition. We have also found a correlation between LMNA adipose expression and several cytokine and adipogenic gene markers in HIV-positive patients, regardless of the presence or absence of lipodystrophy. Hence, in the present study, the lower lamin A expression observed in HIV-positive patients is related to HIV itself or to treatments rather than to the presence of lipodystrophy.

A-type lamins are nuclear proteins that form the nuclear lamina, a filamentous network located just underneath the inner nuclear membrane. A-type lamins are the product of the LMNA gene, which, through alternative splicing, encodes for lamins A and C (lamin A/C) as major products.1 They participate in structural integrity of the nucleus and in controlling gene expression.1 A-type lamin proteins interact with several transcription factors, including sterol responsive element binding protein-1 (SREBP-1).2 Many different mutations in the LMNA gene cause numerous human genetic disorders, termed laminopathies. These include Dunnigan-type familial partial lipodystrophy (FPLD), a severe monogenic form of insulin-resistant lipodystrophy that shares common features with highly active antiretroviral therapy (HAART)-related lipodystrophy in HIV-infected patients.3 Studies to date, however, have shown no mutations in LMNA or its promoter region in patients with HAART-associated lipodystrophy.4-6

The HAART-related lipodystrophy syndrome has a prevalence of 50% to 80% in patients infected with HIV and presents with peripheral lipoatrophy, central hypertrophy, and insulin resistance.7 Its pathogenesis is unknown, but different mechanisms have been described as implicated: HIV infection itself, inflammation state, antiretroviral drugs, adipocyte apoptosis, and adipogenic alterations. Regarding the latter, nelfinavir and indinavir exposition over 3T3-F442A preadipocytes altered SREBP-1 localization and adipocyte differentiation by promoting perturbations in the lamin A/C maturation, organization, and stability. This suggested that these alterations in the lamin A/C network could be the responsible for the SREBP-1 nuclear mislocalization resulting in altered adipocyte differentiation.8 These data, however, have not been replicated subsequently.9

Despite the extensive work in LMNA genotypic variation associated with diverse conditions, little is known about differential mechanisms at the molecular level by which the lamin A/C isoforms contribute to different phenotypes. Several observations led to the proposal that lamin A/C isoforms may contribute differentially to cellular functions. Hence, some disease-associated mutations that affect only the lamin A isoform have been described,10,11 whereas development of lamin C-only mice, which produce lamin C but no lamin A or prelamin A, are entirely healthy.12 Similar levels in messenger RNA (mRNA) expression of lamin A and C isoforms in human preadipocytes and adipocytes have been previously described at the mRNA and protein level.13 An unbalanced lamin A/C ratio could reflect a pathogenic condition, however, as previously described.14,15

In light of these observations, we have tested the hypothesis that human subcutaneous adipose tissue (SAT) LMNA expression can be altered with HAART treatment in HIV-positive patients or with lipodystrophy development. Furthermore, we have analyzed lamin A and C isoform expression and explored their relation to adipose inflammatory environment and systemic insulin resistance in these patients.

Back to Top | Article Outline

METHODS

Participants
Design and Setting

The present work was a cross-sectional case-control study. We have studied a group of HIV-infected patients receiving HAART with and without lipodystrophy and a healthy control group, both recruited at the Hospital Universitari Joan XXIII (Tarragona, Spain).

Back to Top | Article Outline
Participants and Definitions

Fourteen HIV-positive patients receiving HAART without lipodystrophy (HIV+HALS) and a group of 25 HIV-positive patients who developed lipodystrophy while on HAART (HIV+HALS+) were included in this study. These patients were recruited from a cohort of 400 HIV-infected patients receiving stable HAART for at least 1 year. All the HIV-infected patients who receive HAART at our HIV outpatient clinic were followed up at regular scheduled 3-month visits. At each visit, the patients were given a short unstructured questionnaire devoted to assessing the appearance of body changes suggestive of lipodystrophy and a complete physical examination to assess the type (lipoatrophy, lipohypertrophy, or mixed) and degree (slight, moderate, or severe) of Fat Redistribution Syndrome (FRS). Waist and hip diameter and their ratio (WHR), height, weight, bicipital and tricipital fold, and body mass index (BMI) were measured. The presence of FRS was defined by changes in the body fat composition that were important enough to be recognized by the patient and the attending physician(s). Criteria for lipoatrophy were 1 or more of the following: loss of fat from the face, arms, and legs; prominent veins in the arms and legs; and a thin bottom. Criteria for lipohypertrophy were an increase in abdominal perimeter and breast and/or neck fat deposition (1 or both). Mixed lipodystrophy was defined by the presence of at least 1 characteristic of lipoatrophy and 1 characteristic of lipohypertrophy being concomitantly present in 1 patient. FRS was categorized in accordance with the scale proposed by Carr et al16: nonexistent (0), slight (1), moderate (2), and severe (3). This categorization was evaluated in the face, arms, legs, buttocks, abdomen, neck, and breasts. The sum of the values corresponding to each corporal zone indicated the degree of FRS: none (0), slight (1 to 6), moderate (7 to 12), and severe (13 to 18).16 Of the 400 individuals prospectively assessed, 284 (71%) had no criteria for lipodystrophy, whereas 116 (29%) had some degree of lipodystrophy: 33 (28%) had slight lipodystrophy, 40 (35%) had moderate lipodystrophy, and 43 (37%) had severe lipodystrophy, according to the scale of Carr et al.16 Among all these individuals, 14 patients without lipodystrophy and 25 with severe lipodystrophy agreed to participate. In these patients, a CT scan was performed as an objective measurement of body composition. The control group for the HIV-positive cohort was made up of 21 healthy subjects. HIV-infected and healthy controls were of white race and reported that their body weight had been stable for at least 3 months before the study. Exclusion criteria included the following: (1) clinically significant hepatic, neurologic, or other major systemic disease, including malignancy; (2) history of drug or alcohol abuse, defined as >80 g of alcohol intake per day in men and >40 g of alcohol intake per day in women, or serum transaminase activity more than twice the normal upper limit; (3) an elevated serum creatinine concentration; (4) an acute major cardiovascular event in the previous 6 months; (5) acute illnesses and current evidence of acute or chronic inflammatory or infective diseases; and (6) personal or family history suggesting laminopathies. The hospital's ethics committee approved the study, and informed consent was obtained from all participants.

Back to Top | Article Outline
Methods
CT Scan

To assess the distribution of visceral adipose tissue (VAT) and SAT, a single-slice CT scan (ELSCINT CT Helicoidal TWIN scan (Hackensack, NJ) was performed at the level of L4 in the 39 HIV-1-infected patients (25 with FRS and 14 without FRS) in whom LMNA mRNA SAT levels were assessed. The volume of adipose tissue was measured in cubic centimeters.

Back to Top | Article Outline
Insulin Sensitivity Study

Insulin sensitivity (SI) and glucose effectiveness were measured in the HIV-infected patients (n = 39) using the frequently sampled intravenous glucose tolerance test (FSIGTT), as previously described.17

Back to Top | Article Outline
Analytic Methods

Blood samples were drawn from each subject after overnight fasting. Plasma and serum samples were stored at −80°C until analytic measurements were performed, except for glucose and glycated hemoglobin A1c (HbA1c), which were determined immediately after the blood was drawn.

Serum glucose was measured by the glucose oxidase method with a Hitachi autoanalyzer (Boehringer, Manheim, Germany). A lipid profile (triglycerides, total cholesterol, and high-density and low-density lipoprotein cholesterol) was measured by usual enzymatic methods.

HbA1c was measured by the high-performance liquid chromatography method (Bio-Rad, Munich, Germany), with a recommended normal range of the assay being 4.1% to 6.5%.

Plasma interleukin-6 (IL-6) levels were measured by the highly sensitive quantitative sandwich-enzyme-immunoassay technique with the Human IL-6 Quantikine HS ELISA Kit (R&D Systems, Minneapolis, MN). The mean of the minimum detectable concentration was 0.039 pg/mL. Intra- and interassay coefficients of variation (CVs) were <9.8% and <11.2%, respectively. Plasma high sensitive C reactive protein (hsCRP) was measured by a highly sensitive immunonephelometry kit (Dade Behring, Marburg, Germany). Plasma adiponectin concentrations were measured by radioimmunoassay (Linco Research, St. Charles, MO). The intra- and interassay CVs were <5%. Serum insulin was measured by radioimmunoassay (Coat-A-Count Insulin; Diagnostic Products Corporation, Los Angeles, CA). The intra-assay CV was 6.6%.

Back to Top | Article Outline
Adipose Tissue Samples

Adipose tissue samples were obtained from subcutaneous abdominal depots by surgical biopsy. All patients had fasted overnight; at the beginning of surgery, 1 to 4 g of SAT was removed from each proband and was immediately frozen in liquid nitrogen and stored at −80°C until RNA extraction.

Back to Top | Article Outline
Total RNA Isolation and Reverse Transcription

Total RNA was extracted from 400 to 500 mg of frozen SAT using the RNeasy Lipid Tissue Midi Kit (Qiagen Science, Valencia, CA) according to the manufacturer's instructions. One microgram of RNA was retrotranscribed to complementary DNA (cDNA) using the Reverse Transcription System (Promega Corporation, Madison, WI) in a final volume of 20 μL.

Back to Top | Article Outline
Real-Time Quantitative Polymerase Chain Reaction
Back to Top | Article Outline
Primers

The following primers were used: 5′ggatgaggatggagatgacc3′ and 5′gcagaagagccagaggagat3′ for specific lamin A isoform, 5′ggatgaggatggagatgacc3′ and 5″cacgggggaggctggggagag3′ for specific lamin C isoform, 5′ctatggagttcatgcttgtg3′ and 5′gtactgacatttattt3′ for peroxisome proliferator activated receptor gamma (PPARγ), 5′gagcactgaaagcatgatcc3′ and 5′gctggttatctctcagctcca3′ for tumor necrosis factor-α (TNFα), 5′cggtacatcctcgacgg3′ and 5′tgatgattttcaccaggc3′ for IL-6, and 5′tctgtgcctgctgctcatag3′ and 5′cagatctccttggccacaat3′ for monocyte chemoattractant protein-1 (MCP-1). The housekeeping genes used to normalize gene expression were: β-actin 5′ggacttcgagcaagagatgg3′ and 5′agcactgtgttggcgtacag3′ and cyclophilin A (CYPA) 5′caaatgctggacccaacac3′ and 5′gcctccacaatattcatgccttctt3′.

Back to Top | Article Outline
Real-Time Polymerase Chain Reaction

Gene expression analysis was performed on a LightCycler Instrument (Roche Diagnostics, Basel, Switzerland), using the SYBR green fluorescence method.

Back to Top | Article Outline
Results Analysis

For each sample, the derived gene quantification was calculated from an external standard curve, created with serial dilutions of a cloned polymerase chain reaction (PCR) fragment from the respective gene, using LightCycler Software version 3.5 (Roche Diagnostics).

Adipose tissue expression relative quantification levels of each gene were normalized using a weighted mean of β-actin and CYPA. Statistical analysis showed no differences in gene expression for these housekeeping genes among the studied groups.

Back to Top | Article Outline
Statistical Analysis

Statistical analysis was performed by using the SPSS/PC+ statistical package (v. 13.0 for Windows; SPSS, Chicago, IL). Data are expressed as mean value ± SD. Variables that did not have a Gaussian distribution were logarithmically transformed to perform statistical analysis or were analyzed by nonparametric tests. Differences in concentrations and in clinical or laboratory parameters between groups were compared by using an independent samples t test, ANOVA, or a nonparametric test when appropriate. Differences in gender and in retroviral treatment used between studied groups were analyzed by the Pearson/Fisher χ2 test. The relation between variables was tested using Pearson/Spearman correlation analysis and stepwise multiple linear regression analysis. Statistical significance occurred if the computed 2-tailed probability value was <0.05.

Back to Top | Article Outline

RESULTS

Anthropometric and Biochemical Characteristics of the Study Groups

Clinical characteristics, anthropometric characteristics, CT scan measurements, and analytic characteristics of the subjects studied are shown in Table 1. All HIV-positive groups had received HAART for 51.8 ± 28.7 months, and the duration of antiretroviral combination therapy were comparable in HALS-negative and HALS-positive groups (see Table 1). All patients in HALS-negative and HALS-positive groups were currently receiving nucleoside reverse transcriptase inhibitors (NRTIs). There were no significant differences between HALS groups in the frequency of receiving nonnucleoside reverse transcriptase inhibitors (NNRTIs) and protease inhibitors (PIs). There were no significant differences between HALS groups in the number of patients who received a specific agent, except for stavudine (see Table 1). Of the NRTI class of antiretroviral agents, lamivudine (33%) was most frequently used in the HIV-positive HALS-negative group and stavudine (26%) and lamivudine (24%) were most frequently used in the HIV-positive HALS-positive group. Of the NNRTIs, efavirenz was most frequently used in both groups (60% and 68%, respectively). The most common PI used was indinavir in both groups (37% and 32%, respectively). There were no significant differences in the length of treatment of each specific agent between groups.

Table 1
Table 1
Image Tools

HIV-positive subjects had higher plasma IL-6 levels, and HALS-positive patients showed lower SI than the HALS-negative group. Despite the fact that adiponectin levels were not statistically different between the studied cohorts, a positive correlation was observed with SI (R = 0.616, P = 0.001).

Back to Top | Article Outline
Subcutaneous Adipose Tissue Gene Expression

The mRNA expression levels of the different genes studied are shown in Figure 1. Lamin A mRNA levels were significantly lower in HIV-positive patients compared with controls. No differences between HIV-positive patients and controls in lamin C mRNA levels were observed (see Fig. 1). We found no significant differences in lamin A and C mRNA levels between different HAART-based regimens (HAART with PI [n = 24] vs. NRTI + NNRTI [n = 15]; P = 0.155 for lamin A and P = 0.506 for lamin C). We also calculated lamin A/C ratio expression (quotient between lamin A and C expression), which is thought to be close to 1 in normal adipose cells (HIV: 1.01 ± 0.39, HIV+HALS: 0.71 ± 0.60; HIV+HALS+: 0.76 ± 0.62; see Fig. 1).

Figure 1
Figure 1
Image Tools

PPARγ mRNA tended to be lower in the HIV-positive patients compared with HIV-negative subjects and in HALS-positive patients compared with HALS-negative patients, respectively, but differences were not statistically significant. HIV-positive subjects had significantly higher IL-6 mRNA and tended to have higher levels of MCP-1 and TNFα compared with HIV-negative controls.

Back to Top | Article Outline
Correlation and Regression Analysis

All HIV subjects (n = 39) were considered in the correlation and regression analysis, and the presence of lipodystrophy was taken into consideration. In the bivariate correlation analysis, lamin A mRNA expression levels were found to be positively correlated with lamin C isoform (R = 0.382, P = 0.020) and age (R = 0.440, P = 0.005) and negatively correlated with PPARγ (R = −0.479, P = 0.003). The regression analysis showed that age (β = 0.561, P = 0.002; Fig. 2A) and IL-6 mRNA expression levels (β = 0.369, P = 0.030) were determinants of lamin A mRNA levels, with independence of the presence of lipodystrophy (see Fig. 2B). SAT lamin C mRNA expression was correlated positively with lamin A isoform (R = 0.382, P = 0.020) and with MCP-1 and TNFα mRNA (R = 0.431, P = 0.008; R = 0.347, P = 0.038, respectively) and correlated negatively with PPARγ mRNA (R = −0.486, P = 0.002). In the multiple regression analysis, MCP-1 mRNA (β = 0.624, P = 0.001) was the only determinant of lamin C mRNA levels (see Fig. 2C).

Figure 2
Figure 2
Image Tools
Back to Top | Article Outline

DISCUSSION

In this cross-sectional study, we have analyzed abdominal SAT biopsies of HIV-infected patients treated with HAART and we have observed the existence of an altered lamin A/lamin C expression ratio attributable to a decrease in lamin A levels. Interestingly, these findings were not dependent on the presence of lipodystrophy; hence, the lower lamin A expression observed in HIV-positive patients studied here seems to be related to HIV itself or to HAART rather than to the presence of HALS. In HIV-positive patients, we have also found that PPARγ mRNA levels were a positive determinant of LMNA expression and local inflammatory mediators were negative determinants.

The downregulation of lamin A in adipose tissue of our HIV cohort is in accordance with previous observations in some laminopathies, in which the prevalent alteration is accounted for by altered lamin A levels without alterations in lamin C expression. The fact that lamin A levels rather than lamin C levels are frequently found altered in diverse pathologic conditions is in line with the downregulated lamin A levels shown in our patients. In vitro studies with mice deficient cells for lamin A with normal levels of lamin C did not display full recovery of nuclear properties (nuclear shape and resistance to deformability), suggesting that lamin A might be important in the assembly of a robust lamin network.12 In humans, the data about lamin A/C mRNA expression are scarce and reduced to patients affected with lipodystrophy secondary to laminopathies. In this sense, individuals with FPLD showed similar relative amounts of lamin A and C proteins in fibroblasts compared with healthy subjects.18 In some LMNA mutations causing FPLD, a loss of function affecting the nuclear lamina or its interaction with other nuclear proteins has been described,19,20 whereas other mutations produce proteins indistinguishable from wild-type proteins.21-23

The lower lamin A levels observed in HAART-treated HIV-infected subjects compared with HIV-negative controls reinforces the idea that altered lamin A levels (or unbalanced lamin A/C ratio) could reflect a pathogenic condition, although we cannot determine whether this was an effect of antiretroviral treatment or attributable to the HIV itself. The analysis of HIV-infected subjects naive to antiretroviral drugs should aid in answering this question.

There is some controversy about LMNA genotypic association with insulin resistance, with some authors suggesting susceptibility to insulin resistance for some polymorphisms24,25 and description of a mutation causing marked insulin resistance.11 Other authors have found no association with type 2 diabetes or the metabolic syndrome, however.26-28 We have observed an absence of correlation between LMNA adipose tissue expression and peripheral SI measured by minimal model analysis. The close relation between both isoforms and proinflammatory cytokines and the negative association with the adipogenic gene PPARγ make us to speculate about the possible participation of this gene in paracrine mechanisms that contribute to insulin resistance in adipose tissue.

The LMNA gene is also implicated in the activation of the nuclear factor-κB (NF-κB) pathway,29 which has an important role in HIV transactivation.30 In our study, lamin A and C isoforms were dependent on the adipose tissue expression levels of IL-6 and MCP-1, respectively. This was observed in HIV-positive patients with or without lipodystrophy. HIV infection itself is characterized by the expression of several proinflammatory cytokines. Moreover, several HIV proteins (Nef, Tat, and Vpr) use proinflammatory cytokine signaling pathways, further underlining the potential importance of inflammation in HIV pathogenesis.31

PIs have been shown to reduce adipocyte differentiation and increase apoptosis of adipocytes in vitro. Indinavir led to altered retinoic acid signaling, mostly by activation of the RAR/RXR heterodimer.32 Because LMNA is regulated by a retinoic acid-responsive element (L-RARE) in the promoter region,33 indinavir may impair retinoic acid homeostasis and/or interact by means of the L-RARE within the LMNA promoter. It has been suggested that this would result in altered LMNA expression and subsequent impaired adipocyte differentiation, lipodystrophic body habitus, and metabolic disturbances in HIV-infected patients receiving HAART.5 It is possible that analyzing isolated mature adipocyte cells may help to detect if there is any alteration in LMNA transcriptional regulation by retinoic acid in indinavir-treated patients.

In our study, age was an important determinant variable of lamin A mRNA levels. An LMNA mutation leading to Hutchinson-Gilford progeria syndrome (HGPS) generates Δ50 lamin A; a truncated dominant isoform of lamin A.34 Moreover, as in patients who have HGPS, cells from old healthy individuals express the Δ50 lamin A mRNA and lamin A is aberrantly localized at the nuclear periphery, implicating the LMNA gene in physiologic aging.35 In the present study, it is worth mentioning that our selected primers for lamin A quantification do not amplify Δ50 lamin A. The analysis of the protein localization or the presence of abnormal levels of prelamin A in our cohort could help us to understand the close relation observed between age and lamin expression.

Back to Top | Article Outline

ACKNOWLEDGMENTS

The authors thank the patients for their participation in this study. The constructive comments and criticisms of the anonymous reviewers are highly appreciated.

Back to Top | Article Outline

REFERENCES

1. Moir RD, Spann TP. The structure and function of nuclear lamins: implications for disease. Cell Mol Life Sci. 2001;58:1748-1757.

2. Lloyd DJ, Trembath RC, Shackleton S. A novel interaction between lamin A and SREBP1: implications for partial lipodystrophy and other laminopathies. Hum Mol Genet. 2002;7:769-777.

3. Shackleton S, Lloyd DJ, Jackson SN, et al. LMNA, encoding lamin A/C, is mutated in partial lipodystrophy. Nat Genet. 2000;24:153-156.

4. Behrens GM, Lloyd D, Schmidt HH, et al. Lessons from lipodystrophy: LMNA, encoding lamin A/C, in HIV therapy-associated lipodystrophy. AIDS. 2000;14:1854-1855.

5. Behrens GM, Genschel J, Schmidt RE, et al. Lack of mutations in LMNA, its promoter region, and the cellular retinoic acid binding protein II (CRABP II) in HIV associated lipodystrophy. Eur J Med Res. 2003;8:221-225.

6. Domingo P, Baiget M, Arroyo JA, et al. Absence of mutations in exon 8 of the gene in combination antiretroviral therapy-associated partial lipodystrophy. J Acquir Immune Defic Syndr. 2002;30:457-458.

7. Behrens GM, Stoll M, Schmidt RE. Lipodystrophy syndrome in HIV infection: what is it, what causes it and how can it be managed? Drug Saf. 2000;23:57-76.

8. Caron M, Auclair M, Sterlingot H, et al. Some HIV protease inhibitors alter lamin A/C maturation and stability, SREBP-1 nuclear localization and adipocyte differentiation. AIDS. 2003;17:2437-2444.

9. Kudlow BA, Jameson SA, Kennedy BK. HIV protease inhibitors block adipocyte differentiation independently of lamin A/C. AIDS. 2005;19:1565-1573.

10. Garg A, Vinaitheerthan M, Weatherall P, et al. Phenotypic heterogeneity in patients with familial partial lipodystrophy (Dunnigan variety) related to the site of mis-sense mutations in lamin A/C (LMNA) gene. J Clin Endocrinol Metab. 2001;86:59-65.

11. Young J, Morbois-Trabut L, Couzinet B, et al. Type A insulin resistance syndrome revealing a novel lamin A mutation. Diabetes. 2005;54:1873-1878.

12. Fong LG, Ng JK, Lammerding J, et al. Prelamin A and lamin A appear to be dispensable in the nuclear lamina. J Clin Invest. 2006;116:743-752.

13. Lelliott CJ, Logie L, Sewter CP, et al. Lamin expression in human adipose cells in relation to anatomical site and differentiation state. J Clin Endocrinol Metab. 2002;87:728-734.

14. Machiels BM, Broers JLV, Raymond Y, et al. Abnormal A-type lamin organisation in a human lung carcinoma cell line. Eur J Cell Biol. 1995;67:328-335.

15. Machiels BM, Ramaekers FC, Kuijpers HJ, et al. Nuclear lamin expression in normal testis and testicular germ cell tumours of adolescents and adults. J Pathol. 1997;182:197-204.

16. Carr A, Samaras K, Thorisdottir A, et al. Diagnosis, prediction, and natural course of HIV-1 protease-inhibitor-associated lipodystrophy, hyperlipidaemia, and diabetes mellitus: a cohort study. Lancet. 1999;353:2093-2099.

17. Fernandez-Real JM, Broch M, Ricart W, et al. Plasma levels of the soluble fraction of tumor necrosis factor receptor 2 and insulin resistance. Diabetes. 1998;47:1757-1762.

18. Vigouroux C, Auclair M, Dubosclard E, et al. Nuclear envelope disorganization in fibroblasts from lipodystrophic patients with heterozygous R482Q/W mutations in the lamin A/C gene. J Cell Sci. 2001;114:4459-4468.

19. Capanni C, Cenni V, Mattioli E, et al. Failure of lamin A/C to functionally assemble in R482L mutated familial partial lipodystrophy fibroblasts: altered intermolecular interaction with emerin and implications for gene transcription. Exp Cell Res. 2003;291:122-134.

20. Broers JL, Kuijpers HJ, Ostlund C, et al. Both lamin A and lamin C mutations cause lamina instability as well as loss of internal nuclear lamin organization. Exp Cell Res. 2005;304:582-592.

21. Raharjo WH, Enarson P, Sullivan T, et al. Nuclear envelope defects associated with LMNA mutations cause dilated cardiomyopathy and Emery-Dreifuss muscular dystrophy. J Cell Sci. 2001;114:4447-4457.

22. Holt I, Clements L, Manilal S, et al. The R482Q lamin A/C mutation that causes lipodystrophy does not prevent nuclear targeting of lamin A in adipocytes or its interaction with emerin. Eur J Hum Genet. 2001;9:204-208.

23. Östlund C, Bonne G, Schwartz K, et al. Properties of lamin A mutants found in Emery-Dreifuss muscular dystrophy, cardiomyopathy and Dunnigan-type partial lipodystrophy. J Cell Sci. 2001;114:4435-4445.

24. Murase Y, Yagi K, Katsuda Y, et al. An LMNA variant is associated with dyslipidemia and insulin resistance in the Japanese. Metabolism. 2002;51:1017-1021.

25. Owen KR, Groves CJ, Hanson RL, et al. Common variation in the LMNA gene (encoding lamin A/C) and type 2 diabetes: association analyses in 9,518 subjects. Diabetes. 2007;56:879-883.

26. Wolford JK, Hanson RL, Bogardus C, et al. Analysis of the lamin A/C gene as a candidate for type II diabetes susceptibility in Pima Indians. Diabetologia. 2001;44:779-782.

27. Yiannakouris N, Melistas L, Kontogianni M, et al. The Val81 missense mutation of the melanocortin 3 receptor gene, but not the 1908c/T nucleotide polymorphism in lamin A/C gene, is associated with hyperleptinemia and hyperinsulinemia in obese Greek Caucasians. J Endocrinol Invest. 2004;27:714-720.

28. Mesa JL, Loos RJ, Franks PW, et al. Lamin A/C polymorphisms, type 2 diabetes, and the metabolic syndrome: case-control and quantitative trait studies. Diabetes. 2007;56:884-889.

29. Lammerding J, Schulze PC, Takahashi T, et al. Lamin A/C deficiency causes defective nuclear mechanics and mechanotransduction. J Clin Invest. 2004;113:370-378.

30. Equils O, Faure E, Thomas L, et al. Bacterial lipopolysaccharide activates HIV long terminal repeat through Toll-like receptor 4. J Immunol. 2001;166:2342-2347.

31. Decrion AZ, Dichamp I, Varin A, et al. HIV and inflammation. Current HIV Research. 2005;3:243-259.

32. Lenhard JM, Furfine ES, Jain RG, et al. HIV protease inhibitors block adipogenesis and increase lipolysis in vitro. Antiviral Res. 2000;47:121-129.

33. Okumura K, Nakamachi K, Hosoe Y, et al. Identification of a novel retinoic acid-responsive element within the lamin A/C promoter. Biochem Biophys Res Commun. 2000;269:197-202.

34. Eriksson M, Brown WT, Gordon LB, et al. Recurrent de novo point mutations in lamin A cause Hutchinson-Gilford progeria syndrome. Nature. 2003;423:293-298.

35. Scaffidi P, Misteli T. Lamin A-dependent nuclear defects in human aging. Science. 2006;312:1059-1063.

Cited By:

This article has been cited 2 time(s).

Plos One
HIV Protease Inhibitors Do Not Cause the Accumulation of Prelamin A in PBMCs from Patients Receiving First Line Therapy: The ANRS EP45 "Aging" Study
Perrin, S; Cremer, J; Faucher, O; Reynes, J; Dellamonica, P; Micallef, J; Solas, C; Lacarelle, B; Stretti, C; Kaspi, E; Robaglia-Schlupp, A; Tamalet, CNBC; Levy, N; Poizot-Martin, I; Cau, P; Roll, P
Plos One, 7(): -.
ARTN e53035
CrossRef
Genes & Development
Nuclear lamins: major factors in the structural organization and function of the nucleus and chromatin
Dechat, T; Pfleghaar, K; Sengupta, K; Shimi, T; Shumaker, DK; Solimando, L; Goldman, RD
Genes & Development, 22(7): 832-853.
10.1101/gad.1652708
CrossRef
Back to Top | Article Outline
Keywords:

highly active antiretroviral therapy; HIV infection; lipodystrophy; LMNA

© 2007 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.