Skip Navigation LinksHome > October 1, 2007 - Volume 46 - Issue 2 > Low-Level K65R Mutation in HIV-1 Reverse Transcriptase of Tr...
JAIDS Journal of Acquired Immune Deficiency Syndromes:
doi: 10.1097/QAI.0b013e31814258c0
Clinical Science

Low-Level K65R Mutation in HIV-1 Reverse Transcriptase of Treatment-Experienced Patients Exposed to Abacavir or Didanosine

Svarovskaia, Evguenia S PhD*; Margot, Nicolas A MA†; Bae, Andrew S BA*; Waters, Joshua M BS*; Goodman, Derrick BS*; Zhong, Lijie PhD†; Borroto-Esoda, Katyna MS*; Miller, Michael D PhD†

Free Access
Article Outline
Collapse Box

Author Information

From *Gilead Sciences, Inc., Durham, NC; and †Gilead Sciences, Inc., Foster City, CA.

Received for publication January 17, 2007; accepted June 14, 2007.

Supported by Gilead Sciences, Inc.

Previously presented in part at the XV International HIV Drug Resistance Workshop, Sitges, Spain, June 13-17, 2006.

All authors are employees of Gilead Sciences, Inc.

Correspondence to: Michael Miller, PhD, Gilead Sciences, 333 Lakeside Drive, Foster City, CA 94404 (e-mail: michael.miller@gilead.com).

Collapse Box

Abstract

Background: Prior abacavir (ABC) or didanosine (ddI) therapy can result in the L74V/I or K65R mutation in HIV-1 reverse transcriptase. Preexisting K65R may have an impact on the treatment response to tenofovir disoproxil fumarate (TDF).

Methods: An allele-specific polymerase chain reaction (AS-PCR) assay was developed to detect K65R with a lower limit of quantitation of 0.5%.

Results: Among baseline plasma samples from 63 treatment-naive patients, no K65R was detected by AS-PCR. Among baseline samples from 154 treatment-experienced patients, 8 had K65R and 44 had L74V/I by population sequencing. Low-level K65R was detected in an additional 11 patients by AS-PCR, 3 of whom subsequently developed full K65R. Baseline K65R correlated with absence of thymidine analog mutations (TAMs; P = 0.003) and use of ABC or ddI (P = 0.004). Patients with full or low-level K65R at baseline or with L74V/I showed a diminished TDF response. Multivariate analyses confirmed that multiple TAMs, K65R, and L74V/I were independent predictors of diminished TDF response.

Conclusions: Prior therapy with ABC or ddI can result in a population genotype that shows K65R or L74V/I but does not reveal low-level K65R present in some patients. Subsequent treatment intensification with TDF resulted in a poor virologic response and may result in expansion of the preexisting K65R mutant.

Overlapping drug resistance profiles can result in cross-resistance among members of the same class of antiviral drugs and subsequent poor treatment responses in patients with cross-resistance. Use of HIV-1 genotyping and phenotyping assays is part of clinical practice to assess the presence of resistance and potential cross-resistance to other drugs. Current genotyping assays are based on population sequencing of the HIV-1 quasispecies within an infected individual and have limits of detection for minority variants of approximately 20% to 30%.1 However, minority variants at lower frequencies than detectable by standard sequencing may have an impact on treatment response, as has been shown for resistance within the nonnucleoside reverse transcriptase (NNRTI) inhibitor class.2-4

The K65R mutation in HIV-1 reverse transcriptase (RT) is associated with didanosine (ddI), abacavir (ABC), stavudine (d4T) and tenofovir disoproxil fumarate (TDF) therapy. TDF seems to select exclusively for a K65R mutation; however, some reports have also shown the development of a K70E mutation that may represent a temporally intermediate resistance pattern for TDF.5-7 Both ddI and ABC can select for a K65R or L74V mutation in RT, as evidenced by monotherapy studies in which resistance was characterized.8-10 For ABC, an M184V mutation typically occurred first (independent of lamivudine [3TC] use), followed by K65R or L74V, and possibly Y115F. At the dose of 300 mg administered twice daily, ABC selected more frequently for L74V than for K65R and both patterns did not generally occur in the same patients. Similar observations have been made for combination therapy with ABC, 3TC, and efavirenz (EFV).11 In the case of ddI, the pattern of resistance was similar to that of ABC; a K65R or L74V mutation may develop.10 In this monotherapy study, clonal analysis was performed from 3 patients who had evidence of both patterns. In all clones analyzed, the mutation patterns appeared on independent genomes. These findings may be related to the biochemical observations showing that an RT mutant containing both mutations is severely impaired in its enzymatic function.12

Patients treated with ddI or ABC who had developed a detectable K65R mutation would not be considered candidates for subsequent TDF therapy. Patients with no detectable resistance or an L74V mutation would be considered candidates because the L74V RT mutant of HIV-1 remains fully susceptible to tenofovir in vitro.13 However, clinical data have suggested a reduced TDF response in patients with an L74V mutation.14,15 We have recently developed an allele-specific (AS) real-time polymerase chain reaction (PCR) assay for the detection of low-level K65R.16 The current study assesses the presence of low-level K65R among patients pretreated with ddI or ABC and its potential effect on subsequent treatment with TDF.

Back to Top | Article Outline

METHODS

Clinical Study Description

Studies 902 and 907 were randomized, placebo-controlled, double-blind phase 2/3 studies of the safety and efficacy of TDF intensification therapy. All patients had >400 copies/mL of HIV-1 RNA and >8 weeks of prior stable background antiretroviral therapy to which TDF or placebo was added. For studies 902 and 907, the maximum baseline viral loads were 100,000 and 10,000 copies/mL, respectively. The primary endpoint for efficacy was the time-weighted average change in HIV RNA at week 24 (DAVG24) for both studies. The clinical and virologic results from studies 902 and 907 have been previously published.15,17-20 Population genotypic analyses were performed on plasma samples (at baseline and end of study) from patients with a viral load >400 copies/mL (Virco Laboratories, Mechelen, Belgium). During the course of these studies, 14 patients had developed a detectable K65R mutation through up to 96 weeks of TDF therapy.

Back to Top | Article Outline
Single Genome Sequencing

HIV-1-positive patient samples were diluted, if needed, to viral loads less than 10,000 copies/mL. The HIV-1 viral RNA was then isolated, and an RT reaction using custom primers was performed to produce a complementary DNA (cDNA) product. A cDNA dilution that gives approximately a 30% yield of PCR product is required; thus, varying dilutions of cDNA were amplified through 2 rounds of PCR using custom primers in sets of 11 and then qualified by agarose gel electrophoresis to find the correct dilution. According to Poisson distribution, a cDNA dilution yielding 3 of 10 positive PCR products (∼30%) contains 1 copy of cDNA per positive result about 80% of the time.21 After establishing the correct cDNA dilution, 95 reactions were amplified through 2 rounds of PCR to attain 20 to 30 (∼30%) clones. These clones were then purified, cycle sequenced using Applied Biosystems (Foster City, CA) Big Dye Terminator chemistry, sequenced using Applied Biosystems genetic analyzer technology, and analyzed as previously described.22

Back to Top | Article Outline
Allele-Specific Polymerase Chain Reaction

Viral RNA was extracted from 140 to 750 μL of patient plasma using the QIAamp viral RNA kit (Qiagen,Valencia, CA) and eluted in 50 μL of water. To generate RT-PCR product, 20 μL of viral RNA was first reverse transcribed at 42°C for 60 minutes using HIV-1 specific primer 5′-TATCTGGTTGTGCTTGAATGATTCCTAATGCAT and SuperScript II RT (Invitrogen, Carlsbad, CA) in a total volume of 50 μL. Amplification of 20 μL HIV-1 DNA was carried out using rTth DNA polymerase XL (Applied Biosystems) in a total volume of 100 μL with the following PCR conditions: 1 cycle of 95°C for 3 minutes; 35 cycles of 95°C for 15 seconds, 66°C for 40 seconds, and 72°C for 2 minutes; and 1 cycle at 72°C for 10 minutes. The forward and reverse primers for the amplification were as follows: 5′-GAAATGATGACAGCA TGTCAGGGAGT and 5′-TATCTGGTTGTGCTTGAATGATTCCTAATGCAT. The obtained RT-PCR products were diluted and tested for the presence of K65R using AS-PCR, as previously described.16 Briefly, PCR primers were used as follows: curative primer, 5′-GAAAATCCAT ACAATACTCCAGTATTTGCCATAAAGA; K65K primer, 5′-ACAGGTAGTATTTGCCATAAAGAA; K65R primer, 5′-GACATGAGTATTTGCCATAAAGAG; and reverse primer 5′-CCTGCIGGA TGTGGTATTCCTA, where “I” is a deoxyinosine. For each assay, PCR primers were used at the following concentrations: forward curative primer at 5 nM, AS primers at 100 nM, and reverse primer at 400 nM. The PCR conditions involved 25-μL reaction mixtures in 1 × ISOlution buffer (EraGen Biosciences, Madison, WI) and Titanium Taq DNA polymerase (Clontech, Palo Alto, CA) at the manufacturer's recommended concentration. PCR cycling steps were carried out with the rapid ramping rate of 20°C per second unless otherwise specified on the Roche LightCycler 1.2 (Roche, Indianapolis, IN) and were as follows: 2 minutes at 95°C; 3 cycles of 5 seconds at 95°C, 5 seconds at 61°C, and a ramp of 1°C per second to 10 seconds at 72°C; 1 cycle of 5 seconds at 95°C, 5 seconds at 45°C, and a ramp at 1°C per second to 20 seconds at 72°C; 80 cycles of 5 seconds at 95°C, 5 seconds at 55°C, and 20 seconds at 72°C (fluorescence read); and melt at 60°C to 95°C with a ramp at 0.4°C per second ramp (fluorescence step read). Fluorescence data were collected in 2 channels corresponding to the labels on AS primers for K65R and K65K. Fluorescence data were exported and analyzed with MultiCode-RTx analysis software (EraGen Biosciences). Delta threshold cycle (Ct) values were calculated as Ct of K65R amplification minus Ct of K65K amplification. Standard curve RNA samples generated from viral mixtures containing 0% to 50% of K65R site-directed HIV-1 RT mutant virus were processed in parallel with patient plasma samples. Delta Ct values of standard curve samples were used to quantify the presence of the K65R allele in each plasma sample (SigmaPlot/SigmaStat 9.01; SYSTAT Software, San Jose, CA).

Back to Top | Article Outline
Statistical Analyses

All HIV-1 RNA statistical analyses were performed using SAS (version 8.1; SAS Institute, Cary, NC). P values <0.05 were considered significant. Multivariate linear regression analyses were performed to evaluate the impact of different mutations along with other baseline parameters on HIV-1 RNA response. A stepwise method was applied with a significance level of 0.15 for entry and staying in the model. P values were not adjusted for multiple comparisons.

Back to Top | Article Outline

RESULTS

A total of 437 patients were initially evaluated for the development of resistance and had baseline genotypic data from studies 902 and 907 combined. Each patient was exposed to TDF for a period of 24 to 96 weeks. During this follow-up period, 14 patients developed the K65R mutation by population sequencing. Within this group, there was a striking negative association with the presence of baseline thymidine analog mutations (TAMs [M41L, D67N, K70R, L210W, T215Y/F, and K219Q/E/N]), with none of the 311 patients with baseline TAMs developing K65R (Table 1). Among patients without baseline TAMs, patients with baseline L74V showed a positive correlation with the development of K65R (4 of 10 patients; P = 0.014), although there were few patients within this group.

Table 1
Table 1
Image Tools
Back to Top | Article Outline
Single-Genome Sequencing Analysis

We further investigated the 4 patients with baseline L74V who subsequently developed K65R by single-genome sequencing (SGS) analysis to determine whether there was any detectable K65R at baseline and whether it was expressed on the same genome as L74V. Baseline plasma samples were available for 3 of these 4 patients. SGS was performed for these 3 patients at baseline, with 91, 77, and 63 individual genomes analyzed for patients 4055, 2076, and 1278, respectively (Table 2). Of the 91 baseline HIV-1 RT genomes sequenced from patient 4055, all expressed L74V/I with no detectable K65R at baseline. By week 8, K65R was observed in 3.8% of RT genomes and then in 72% of RT genomes by week 16. Interestingly, a substantial fraction of these K65R genomes also included an L74I mutation that was only detected as a minor population at baseline (2%); all clones containing L74V were wild type at K65. For patients 2076 and 1278, however, low-level K65R was detected at baseline in 2.6% and 6.3% of the RT genomes analyzed, respectively. By week 4 of TDF intensification, these percentages had increased to 46% and 56%, respectively, with further increases at week 8. There was a concomitant decrease in the fraction with L74V in these patients, and none of the RT genomes analyzed expressed the K65R and L74V mutations together. At baseline, patient 1278 was taking ddI, EFV, saquinavir, and ritonavir, whereas patient 2076 was taking ABC, 3TC, and amprenavir. Their HIV RNA responses at week 24 were −0.13 and −0.22 log10, respectively.

Table 2
Table 2
Image Tools
Back to Top | Article Outline
Allele-Specific Real-Time PCR

Given the observations by SGS of low-level K65R associated with 2 patients treated with ddI or ABC, we developed a higher throughput assay for the detection of low-level K65R using AS primers and real-time PCR.16 Starting from RT-PCR products of plasma HIV-1, this AS-PCR assay demonstrates a lower limit of detection for K65R mutant genomes of 0.5% for subtype B HIV-1. Plasma samples from 63 treatment-naive HIV-1-infected patients showed no detectable K65R minority species in our assay with its cutoff of 0.5%. Plasma samples from 154 treatment-experienced patients from study 907 were also analyzed. Within this group, we analyzed all patients from study 907 with L74V/I by population sequencing (n = 44) and a random sample of patients without L74V/I who were taking ddI or ABC (n = 51) or not taking ddI or ABC (n = 51), including 10 of the 14 patients who had developed K65R (the other 4 patients had no remaining baseline samples). As positive controls, we also analyzed patients with K65R by population sequencing, all 8 of whom were taking ABC (n = 4), ddI (n = 3), or ABC and ddI (n = 1) on study entry.

As expected, all patients with K65R by population sequencing showed >50% K65R by AS-PCR (7 of 8 patients >90% K65R; Fig. 1). In addition, we detected low-level K65R by AS-PCR in 11 (7.5%) of 146 analyzed patients, including the 2 patients who showed low-level K65R by SGS. Among the 11 patients with low-level K65R, the percentage of minority species K65R ranged from 0.7% to 25% of viral sequences as quantified by AS-PCR. The patient with 25% K65R by AS-PCR did not show detectable K65R by population sequencing, suggesting that the limit of K65R detection by population sequencing is >25%. The remaining patients had K65R percentages of <11%, with 8 of 11 patients having <3%. Ten of these 11 patients with low-level K65R were taking ddI (n = 5), ABC (n = 3), or ddI and ABC (n = 2) on study entry. Overall, the presence of baseline K65R, at the population sequencing level or as a minority variant, correlated positively with the use of ABC or ddI (P = 0.004) and negatively with the presence of baseline TAMs (P = 0.003) (Table 3). Among patients with baseline L74V/I by population sequencing, there was a trend toward the detection of K65R by AS-PCR, with 6 of 44 samples analyzed showing low-level K65R (13.6% vs. 4.9% without L74V/I; P = 0.088).

Figure 1
Figure 1
Image Tools
Table 3
Table 3
Image Tools
Back to Top | Article Outline
Development of K65R

Among the 10 analyzed patients who had developed K65R by population sequencing, 3 had detectable K65R in their baseline sequence by AS-PCR. As described above, SGS analyses of 2 of these patients also showed low-level K65R at baseline and then subsequent expansion of K65R on addition of TDF treatment. The third patient with low-level K65R had the Q151M complex of multinucleoside resistance mutations at baseline (A62V, V75I, F116Y, and Q151M) and then developed full K65R by week 12. The remaining 7 patients who had developed K65R did not have detectable K65R at baseline by AS-PCR. Development of K65R in these patients likely reflects de novo K65R selection because of incomplete viral load suppression and TDF therapy in combination with other NRTIs.

Back to Top | Article Outline
Treatment Response to Tenofovir Disoproxil Fumarate

HIV RNA responses to intensification treatment with TDF are shown in Figure 2. Among TDF-treated patients with baseline genotypic data in these studies, the mean viral load reduction was −0.62 log10 copies/mL (DAVG24). Patients with baseline TAMs, L74V, or K65R by population sequencing showed diminished responses relative to the overall treatment response. The effects of baseline TAMs and K65R on the treatment response to TDF have been previously described in a subset of the patients analyzed in the current study.15 Patients with low-level K65R that was only detected by AS-PCR also showed a strongly reduced mean response to TDF treatment (−0.11 log10 copies/mL, n = 11). Although most patients with baseline L74V also had multiple TAMs, a few patients with baseline L74V in the absence of TAMs also showed a reduced treatment response to TDF of −0.31 log10 copies/mL.

Figure 2
Figure 2
Image Tools

We performed a multivariate statistical analysis using baseline genotypic, HIV disease, and demographic data as parameters for HIV RNA response at week 24. As shown in Table 4, treatment with TDF, baseline HIV-1 RNA levels, and baseline CD4 cell counts were all significant predictors of HIV RNA response. The 4 TAMs (M41L, D67N, L210W, and T215Y) predicted a reduced HIV RNA response in agreement with previous studies.15 The K65R mutation at baseline by population sequencing showed the strongest negative effect on treatment response, with a parameter estimate of +0.61 log10 copies/mL nearly ablating all the TDF treatment effect of −0.66 log10 copies/mL. Independent of K65R and TAMs, the L74V mutation also showed a negative effect on HIV RNA response, with a parameter estimate of +0.29 log10 copies/mL. Finally, as previously described, the M184V mutation showed a modest positive effect on treatment response of −0.13 log10 copies/mL.

Table 4
Table 4
Image Tools
Back to Top | Article Outline

DISCUSSION

New technologies are permitting the characterization of minority variants of HIV-1 within an infected individual.23-25 Some of these techniques, such as SGS or clonal analysis, are highly labor-intensive but reveal complete sequence information for an individual viral genome.21 Others, such as AS-PCR or ligation-amplification PCR,26 provide for higher throughput analysis of viral subpopulations but do not provide complete sequence information and must be developed individually for each mutation being assessed. We have developed an AS-PCR technique specifically for the K65R mutant of HIV-1 RT and assessed plasma samples from treatment-naive and treatment-experienced HIV-1-infected patients for the presence of low-level K65R. In no case have we observed >0.5% K65R among plasma samples from 63 treatment-naive patients. The cutoff of 0.5% was set based on the background signal observed with RT-PCR products of a clonal virus population containing only wild-type HIV-1, as previously described.16 A specific cutoff must be established for each mutant in AS-PCR, and this can vary, in our experience, from 0.05% to 0.5% for a given HIV-1 RT mutant. Similar mutant-specific cutoffs have been described by others with analogous AS-PCR systems.25,27,28 From these studies, it seems that interrogation of K65R is associated with a fairly high degree of nonspecific signal presumably attributable to the specific surrounding nucleotide sequence at this position. Thus, interpretation of a true positive signal must be carefully distinguished from background in these systems, and appropriate cutoffs must be determined. Of note, we observed high background with some subtype B HIV-1 patient sequences corresponding to AAA AAG at codons 64 and 65. Because this is the predominant sequence for subtype C viruses, our AS-PCR assay is not currently amenable to subtype C analysis. Subtype specificity has also been reported by others for PCR-based assays.23

Once detected, the clinical relevance of minority HIV-1 variants needs to be established. In the case of minority variants of nonnucleoside reverse transcriptase inhibitor (NNRTI)-resistant viruses, at least 3 studies have demonstrated that the presence of minority populations of resistant virus has a negative effect on subsequent treatment with an NNRTI-based regimen. In Adult Clinical Trials Group (ACTG) 398, initial efficacy observations showed that NNRTI-experienced patients who had no detectable NNRTI-associated resistance mutations by population sequencing demonstrated an inferior treatment response to a new EFV and protease inhibitor (PI)-based regimen as compared with those naive to NNRTIs.29 Similar observations have been made in multiple other clinical studies with NNRTIs. In ACTG 398, a subset of the NNRTI-experienced patients was analyzed by SGS, and 6 of 10 subjects showed evidence of NNRTI-resistant minority variants (3% to 30% of genomes).4 In a more recent study, AS-PCR was used to detect K103N, Y181C, or M184V among treatment-naive patients who failed a regimen of ABC, 3TC, and EFV.27 Among 70 virologic failures analyzed, 7 patients had 1 or more of these mutations only detectable by AS-PCR at baseline. A strong correlation was shown between the presence of these mutations as minority species at baseline and subsequent virologic failure (P = 0.005). Of note, 2 patients only had the M184V mutation detected at baseline, suggesting that even a minor population of this mutant may jeopardize the treatment response to a regimen of ABC, 3TC, and EFV. Finally, multiple studies of single-dose nevirapine administered intrapartum have demonstrated the development of nevirapine resistance in a substantial fraction of mothers and subsequent impaired treatment responses to nevirapine-based regimens.2,30-33

In the current study, low-level minority variants of K65R were observed in 11 (7.5%) of 146 treatment-experienced patients analyzed. There was a significantly inferior treatment response to TDF among these patients (−0.11 log10 copies/mL) as compared with the overall patient population. Among these patients, 3 went on to develop a full K65R mutation on addition of TDF therapy. Among the other patients not developing a full K65R mutation, there was limited follow-up and/or addition of other antiretrovirals (eg, lopinavir) that precluded further longitudinal analysis of resistance development. Overall, combining patients with K65R by population sequencing and those with K65R by AS-PCR, there was a positive correlation of baseline K65R with concurrent ABC or ddI use (P = 0.004) and a negative correlation with TAMs (P = 0.003). These results are consistent with the established resistance profiles of ABC and ddI and with multiple publications showing negative interactions between K65R and TAMs.34-37 Of note, we did observe 1 patient who had K65R and multiple TAMs on the same genome (M41L, D67N, L210W, and T215Y). Thus, this negative correlation is not absolute, as has been shown by others.38

The vast majority of patients with detectable K65R in our study (18 of 19 patients) by population sequencing or AS-PCR had prior exposure to ddI or ABC. Recent observations have demonstrated that d4T can also select for K65R in vitro and in vivo, however.39,40 The single patient with K65R in our study who was not taking ddI or ABC was taking d4T and 3TC as NRTIs. Although d4T typically selects for TAM-associated mutations, selection of K65R may be favored under certain NRTI combinations (eg, d4T, 3TC, nevirapine) and may have clinical consequences for continued or new use of NRTIs such as TDF.

Interestingly, 6 of the 11 patients with low-level K65R had L74V/I at baseline, and the presence of L74V in the absence of TAMs was significantly associated with the development of K65R. Thus, the relation between K65R and L74V/I is of interest. Both ABC and ddI can select for either mutation, and, in general, these mutations are seen on different viral genomes. Within an individual, however, both mutants may exist as competing mutant populations and L74V is generally the dominant population. The results of our SGS analysis of 3 patients are in agreement with the earlier clonal analyses and demonstrated the typical genomic exclusivity of K65R and L74V. In patient 4055, however, we did observe K65R and L74I on the same viral genome, whereas L74V was always observed with wild-type K65. A recent publication has also demonstrated the occurrence of K65R and L74V/I on the same genome.38 These observations of K65R and L74V/I together on the same genome seem to be rare, however, and may reflect the presence of additional mutations potentially compensating for the demonstrated reduced replication capacity of this double mutant.12

Previous multivariate analyses of treatment response to TDF have indicated that the L74V mutation was associated with a reduced treatment response to TDF.14,15 These results were initially puzzling, because L74V itself has no demonstrable phenotypic effect on TDF susceptibility in vitro.13 In the current analyses with a larger data set of TDF-treated patients, we confirm that L74V is a predictor of reduced treatment response. In most patients, L74V is associated with multiple TAMs, and those patients have a strong reduction in treatment response that seems to be primarily attributable to the effects of the TAMs. Among those patients without TAMs, however, there is still an apparent decrease in TDF treatment response (−0.31 log10 copies/mL). Our current data suggest that the presence of low-level K65R among some of these patients may be partially responsible for the reduced treatment response to TDF in these patients. Minority variants of other NRTI mutations (eg, M184V, TAMs) may also have an impact on subsequent therapies. Of note, the treatment responses observed in this study are limited by the intensification design of the clinical study. Minority variants of K65R and other NRTI mutations need to be further assessed for clinical relevance under conditions of optimized new therapies and in less advanced patient populations to determine their clinical relevance in these settings. Overall, however, our studies describe the potential for further expansion of minority K65R variants that were preexisting because of prior ABC or ddI therapy and their negative impact on treatment responses to TDF.

Back to Top | Article Outline

ACKNOWLEDGMENTS

The authors thank the study personnel, investigators, and patients from studies 902 and 907. They also thank Hans Reiser for review of this manuscript and Margaret Benton for administrative assistance and document preparation.

Back to Top | Article Outline

REFERENCES

1. Halvas EK, Aldrovandi GM, Balfe P, et al. Blinded, multicenter comparison of methods to detect a drug-resistant mutant of human immunodeficiency virus type 1 at low frequency. J Clin Microbiol. 2006;44:2612-2614.

2. Jourdain G, Ngo-Giang-Huong N, Le Coeur S, et al. Intrapartum exposure to nevirapine and subsequent maternal responses to nevirapine-based antiretroviral therapy. N Engl J Med. 2004;351:229-240.

3. Lecossier D, Shulman NS, Morand-Joubert L, et al. Detection of minority populations of HIV-1 expressing the K103N resistance mutation in patients failing nevirapine. J Acquir Immune Defic Syndr. 2005;38:37-42.

4. Mellors J, Palmer S, Nissley D, et al. Low frequency non-nucleoside reverse transcriptase inhibitor (NNRTI)-resistant variants contribute to failure of efavirenz-containing regimens in NNRTI-experienced patients with negative standard genotypes for NNRTI mutations [abstract]. Antivir Ther. 2003;8:5150.

5. Delaugerre C, Roudiere L, Peytavin G, et al. Selection of a rare resistance profile in an HIV-1-infected patient exhibiting a failure to an antiretroviral regimen including tenofovir DF. J Clin Virol. 2005;32:241-244.

6. Ross L, Gerondelis P, Liao Q, et al. Selection of the HIV-1 reverse transcriptase mutation K70E in antiretroviral-naive subjects treated with tenofovir/abacavir/lamivudine therapy [poster number 92]. Presented at: XIV International Drug Resistance Workshop; 2005; Quebec City.

7. Van Rompay KKA, Johnson JA, Blackwood E, et al. Sequential emergence and clinical implications of viral mutants with K70E and K65R mutation in reverse transcriptase during prolonged tenofovir monotherapy in rhesus macaques with chronic RT-SHIV infection [abstract]. Antivir Ther. 2006;11(Suppl 1):S41.

8. Harrigan PR, Stone C, Griffin P, et al. Resistance profile of the human immunodeficiency virus type 1 reverse transcriptase inhibitor abacavir (1592U89) after monotherapy and combination therapy. J Infect Dis. 2000;181:912-920.

9. Miller V, Ait-Khaled M, Stone C, et al. HIV-1 reverse transcriptase (RT) genotype and susceptibility to RT inhibitors during abacavir monotherapy and combination therapy. AIDS. 2000;14:163-171.

10. Winters MA, Shafer RW, Jellinger RA, et al. Human immunodeficiency virus type 1 reverse transcriptase genotype and drug susceptibility changes in infected individuals receiving dideoxyinosine monotherapy for 1 to 2 years. Antimicrob Agents Chemother. 1997;41:757-762.

11. Moyle GJ, DeJesus E, Cahn P, et al. Abacavir once or twice daily combined with once-daily lamivudine and efavirenz for the treatment of antiretroviral-naive HIV-infected adults: results of the Ziagen Once Daily in Antiretroviral Combination Study. J Acquir Immune Defic Syndr. 2005;38:417-425.

12. Deval J, Navarro J-M, Selmi B, et al. A loss of viral replicative capacity correlates with altered DNA polymerization kinetics by the human immunodeficiency virus reverse transcriptase bearing the K65R and L74V dideoxynucleoside resistance substitutions. J Biol Chem. 2004;279:25489-25496.

13. Wainberg MA, Miller MD, Quan Y, et al. In vitro selection and characterization of HIV-1 with reduced susceptibility to PMPA. Antivir Ther. 1999;4:87-94.

14. Masquelier B, Tamalet C, Montes B, et al. Genotypic determinants of the virological response to tenofovir disoproxil fumarate in nucleoside reverse transcriptase inhibitor-experienced patients. Antivir Ther. 2004;9:315-323.

15. Miller MD, Margot N, Lu B, et al. Genotypic and phenotypic predictors of the magnitude of response to tenofovir disoproxil fumarate treatment in antiretroviral-experienced patients. J Infect Dis. 2004;189:837-846.

16. Svarovskaia ES, Moser MJ, Bae AS, et al. MultiCode-RTx real-time PCR system for detection of subpopulations of K65R human immunodeficiency virus type 1 reverse transcriptase mutant viruses in clinical samples. J Clin Microbiol. 2006;44:4237-4241.

17. Squires K, Pozniak AL, Pierone G Jr, et al. Tenofovir disoproxil fumarate in nucleoside-resistant HIV-1 infection. Ann Intern Med. 2003;139:313-321.

18. Schooley RT, Ruane P, Myers RA, et al. Tenofovir DF in antiretroviral-experienced patients: results from a 48-week, randomized, double-blind study. AIDS. 2002;16:1257-1263.

19. Margot NA, Isaacson E, McGowan I, et al. Genotypic and phenotypic analyses of HIV-1 in antiretroviral-experienced patients treated with tenofovir DF. AIDS. 2002;16:1227-1235.

20. McColl DJ, Margot NA, Wulfsohn M, et al. Patterns of resistance emerging in HIV-1 from antiretroviral-experienced patients undergoing intensification therapy with tenofovir disoproxil fumarate. J Acquir Immune Defic Syndr. 2004;37:1340-1350.

21. Palmer S, Kearney M, Maldarelli F, et al. Multiple, linked human immunodeficiency virus type 1 drug resistance mutations in treatment-experienced patients are missed by standard genotype analysis. J Clin Microbiol. 2005;43:406-413.

22. Saag MS, Cahn P, Raffi F, et al. Efficacy and safety of emtricitabine vs stavudine in combination therapy in antiretroviral-naive patients: a randomized trial. JAMA. 2004;292:180-190.

23. Metzner KJ, Bonhoeffer S, Fischer M, et al. Emergence of minor populations of human immunodeficiency virus type 1 carrying the M184V and L90M mutations in subjects undergoing structured treatment interruptions. J Infect Dis. 2003;188:1433-1443.

24. Nissley DV, Halvas EK, Hoppman NL, et al. Sensitive phenotypic detection of minor drug-resistant human immunodeficiency virus type 1 reverse transcriptase variants. J Clin Microbiol. 2005;43:5696-5704.

25. Palmer S, Boltz V, Maldarelli F, et al. Selection and persistence of non-nucleoside reverse transcriptase inhibitor-resistant HIV-1 in patients starting and stopping non-nucleoside therapy. AIDS. 2006;20:701-710.

26. Shi C, Eshleman SH, Jones D, et al. LigAmp for sensitive detection of single-nucleotide differences. Nature Methods. 2004;1:141-147.

27. Johnson JA, Li J-F, Wei X, et al. Baseline detection of low-frequency drug resistance-associated mutations is strongly associated with virological failure in previously antiretroviral-naive HIV-1-infected persons [abstract]. Antivir Ther. 2006;11(Suppl 1):S79.

28. Johnson JA, Rompay KK, Delwart E, et al. Short communication: a rapid and sensitive real-time PCR assay for the K65R drug resistance mutation in SIV reverse transcriptase. AIDS Res Hum Retroviruses. 2006;22:912-916.

29. Hammer SM, Vaida F, Bennett KK, et al. Dual vs single protease inhibitor therapy following antiretroviral treatment failure: a randomized trial. JAMA. 2002;288:169-180.

30. Flys T, Nissley DV, Claasen CW, et al. Sensitive drug-resistance assays reveal long-term persistence of HIV-1 variants with the K103N nevirapine (NVP) resistance mutation in some women and infants after the administration of single-dose NVP: HIVNET 012. J Infect Dis. 2005;192:24-29.

31. Flys TS, Chen S, Jones DC, et al. Quantitative analysis of HIV-1 variants with the K103N resistance mutation after single-dose nevirapine in women with HIV-1 subtypes A, C, and D. J Acquir Immune Defic Syndr. 2006;42:610-613.

32. Hammer SM. Single-dose nevirapine and drug resistance: the more you look, the more you find. J Infect Dis. 2005;192:1-3.

33. Johnson JA, Li JF, Morris L, et al. Emergence of drug-resistant HIV-1 after intrapartum administration of single-dose nevirapine is substantially underestimated. J Infect Dis. 2005;192:16-23.

34. Parikh UM, Bacheler L, Koontz D, et al. The K65R mutation in human immunodeficiency virus type 1 reverse transcriptase exhibits bidirectional phenotypic antagonism with thymidine analog mutations. J Virol. 2006;80:4971-4977.

35. Parikh UM, Barnas DC, Faruki H, et al. Antagonism between the HIV-1 reverse-transcriptase mutation K65R and thymidine-analogue mutations at the genomic level. J Infect Dis. 2006;194:651-660.

36. Valer L, Martin-Carbonero L, de Mendoza C, et al. Predictors of selection of K65R: tenofovir use and lack of thymidine analogue mutations. AIDS. 2004;18:2094-2096.

37. White KL, Chen JM, Feng JY, et al. The K65R reverse transcriptase mutation in HIV-1 reverses the excision phenotype of zidovudine resistance mutations. Antivir Ther. 2006;11:155-163.

38. Henry M, Tourres C, Colson P, et al. Coexistence of the K65R/L74V and/or K65R/T215Y mutations on the same HIV-1 genome. J Clin Virol. 2006;37:227-230.

39. Garcia-Lerma JG, MacInnes H, Bennett D, et al. A novel genetic pathway of human immunodeficiency virus type 1 resistance to stavudine mediated by the K65R mutation. J Virol. 2003;77:5685-5693.

40. Sungkanuparph S, Manosuthi W, Kiertiburanakul S, et al. Options for a second-line antiretroviral regimen for HIV type 1-infected patients whose initial regimen of a fixed-dose combination of stavudine, lamivudine, and nevirapine fails. Clin Infect Dis. 2007;44:447-452.

Cited By:

This article has been cited 12 time(s).

Journal of Infectious Diseases
Efficient Suppression of Minority Drug-Resistant HIV Type 1 (HIV-1) Variants Present at Primary HIV-1 Infection by Ritonavir-Boosted Protease Inhibitor-Containing Antiretroviral Therapy
Metzner, KJ; Rauch, P; von Wyl, V; Leemann, C; Grube, C; Kuster, H; Boni, J; Weber, R; Gunthard, HF
Journal of Infectious Diseases, 201(7): 1063-1071.
10.1086/651136
CrossRef
Journal of Infectious Diseases
Low-Abundance Drug-Resistant Viral Variants in Chronically HIV-Infected, Antiretroviral Treatment-Naive Patients Significantly Impact Treatment Outcomes
Simen, BB; Simons, JF; Hullsiek, KH; Novak, RM; MacArthur, RD; Baxter, JD; Huang, CL; Lubeski, C; Turenchalk, GS; Braverman, MS; Desany, B; Rothberg, JM; Egholm, M; Kozal, MJ
Journal of Infectious Diseases, 199(5): 693-701.
10.1086/596736
CrossRef
Hepatology
Natural presence of substitution R155K within hepatitis C virus NS3 protease from a treatment-naive chronically infected patient
Colson, P; Brouk, N; Lembo, F; Castellani, P; Tamalet, C; Gerolami, R
Hepatology, 47(2): 766-767.
10.1002/hep.22122
CrossRef
Plos One
Prevalence and Clinical Significance of HIV Drug Resistance Mutations by Ultra-Deep Sequencing in Antiretroviral-Naive Subjects in the CASTLE Study
Lataillade, M; Chiarella, J; Yang, R; Schnittman, S; Wirtz, V; Uy, J; Seekins, D; Krystal, M; Mancini, M; McGrath, D; Simen, B; Egholm, M; Kozal, M
Plos One, 5(6): -.
ARTN e10952
CrossRef
AIDS Reviews
HIV-1 Genotypic Drug Resistance Interpretation Rules-2009 Spanish Guidelines
de Mendoza, C; Anta, L; Garcia, F; Perez-Elias, J; Gutierrez, F; Llibre, JM; Menendez-Arias, L; Dalmau, D; Soriano, V
AIDS Reviews, 11(1): 39-51.

Antiviral Research
Clinical management of HIV-1 resistance
Paredes, R; Clotet, B
Antiviral Research, 85(1): 245-265.
10.1016/j.antiviral.2009.09.015
CrossRef
Antiviral Therapy
Advantages of predicted phenotypes and statistical learning models in inferring virological response to antiretroviral therapy from HIV genotype
Altmann, A; Sing, T; Vermeiren, H; Winters, B; Van Craenenbroeck, E; Van der Borght, K; Rhee, SY; Shafer, RW; Schulter, E; Kaiser, R; Peres, Y; Sonnerborg, A; Fessel, WJ; Incardona, F; Zazzi, M; Bacheler, L; Van Vlijmen, H; Lengauer, T
Antiviral Therapy, 14(2): 273-283.

Antimicrobial Agents and Chemotherapy
Development of an Allele-Specific PCR for Detection of the K65R Resistance Mutation in Patients Infected with Subtype C Human Immunodeficiency Virus Type 1
Toni, TA; Brenner, BG; Asahchop, EL; Ntemgwa, M; Moisi, D; Wainberg, MA
Antimicrobial Agents and Chemotherapy, 54(2): 907-911.
10.1128/AAC.01080-09
CrossRef
Antiviral Therapy
Prevalence, genotypic associations and phenotypic characterization of K65R, L74V and other HIV-1 RT resistance mutations in a commercial database
McColl, DJ; Chappey, C; Parkin, NT; Miller, MD
Antiviral Therapy, 13(2): 189-197.

Clinical Infectious Diseases
Minority Quasispecies of Drug-Resistant HIV-1 That Lead to Early Therapy Failure in Treatment-Naive and -Adherent Patients
Metzner, KJ; Giulieri, SG; Knoepfel, SA; Rauch, P; Burgisser, P; Yerly, S; Gunthard, HF; Cavassini, M
Clinical Infectious Diseases, 48(2): 239-247.
10.1086/595703
CrossRef
AIDS Reviews
HIV-1 drug resistance mutations: an updated framework for the second decade of HAART
Shafer, RW; Schapiro, JM
AIDS Reviews, 10(2): 67-84.

AIDS
Development of a didanosine genotypic resistance interpretation system based on large derivation and validation datasets
Assoumou, L; Cozzi-Lepri, A; Brun-Vézinet, F; DeGruttola, V; Kuritzkes, DR; Phillips, A; Zolopa, A; Miller, V; Flandre, P; Costagliola, D; on behalf of the Standardization, Clinical Relevance of HIV Drug Resistance Testing Project from the Forum for Collaborative HIV Research,
AIDS, 24(3): 365-371.
10.1097/QAD.0b013e32833338ba
PDF (404) | CrossRef
Back to Top | Article Outline
Keywords:

allele-specific polymerase chain reaction; K65R; nucleoside reverse transcriptase inhibitor resistance; quasispecies; tenofovir; tenofovir disoproxil fumarate

© 2007 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.