Kappert, Kai MD*; Leppänen, Olli MD†; Paulsson, Janna MSc*; Furuhashi, Masao MD, PhD‡; Carlsson, Mari-Anne MSc†; Heldin, Carl-Henrik PhD‡; Fätkenheuer, Gerd MD§; Rosenkranz, Stephan MD∥¶; Östman, Arne PhD*
Highly active antiretroviral therapy (HAART) has led to a dramatic decline of morbidity and mortality in HIV-infected patients.1 HAART is associated with significant metabolic adverse effects, however, such as alterations of the lipid profile and insulin resistance, which are risk factors for atherogenesis.2 Several studies have reported a higher risk for patients treated with HAART,3-6 whereas others have failed to establish a correlation.7,8 It is also uncertain whether the reported adverse effects are attributable to longer survival associated with HAART, and therefore reflect the age-associated prevalence of atherosclerotic disease, or whether antiretroviral agents have direct or indirect influences on the vessel wall. HIV infection itself as well as HAART (through direct or indirect effects [eg, lipid elevations]) might influence the restenosis rate in patients. Recently, a direct link between HAART and impaired endothelial function was pointed out in HIV-infected individuals.9 The causal relations are hard to establish from the clinical data of infected individuals, however.
Atherosclerosis is considered to be a chronic inflammatory disease. Several vascular and nonvascular cell types are involved in the onset and progression of atherogenesis. Endothelial dysfunction is an early indicator of atherogenesis; it accelerates further hallmark mechanisms of atherosclerosis and restenosis, such as the migration and proliferation of vascular smooth muscle cells (VSMCs), which ultimately lead to lesion formation. It is therefore of special interest whether these processes are promoted by HAART in vivo and whether HAART-mediated effects can be reversed by concomitant medication.
During the past decade, numerous trials have demonstrated that 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors (statins) significantly reduce cardiovascular mortality in patients with and without hypercholesterolemia.10-13 Recently, rosuvastatin was shown to accelerate re-endothelialization and decrease neointima formation in a carotid artery injury model.14 These effects may counteract the harmful influence of HAART on the vessel wall.
Protease inhibitors (PIs) included in HIV treatment have been shown to influence endothelial cell survival and apoptosis directly on the cellular level and to affect reactive oxygen species production and nitric oxide synthase expression in isolated arteries.15-18 Hence, it is currently unclear whether HAART affects the integrity and regenerative capacity of the vessel wall via direct or indirect mechanisms. Conversely, beneficial effects of HAART on VSMCs and the vasculature have also been demonstrated in vitro and in vivo.19,20
The aim of this study was to analyze the influence of HAART on neointima formation and re-endothelialization after vascular injury in a rat carotid model in vivo and to investigate possible protective effects of concomitant statin therapy.
MATERIALS AND METHODS
Animals and Intervention Procedure
Sprague-Dawley rats (370-450 g; Mollegaard Breeding Center, Ry, Denmark) were randomly allocated to treatment substances or placebo control (carrier, sterile 0.9% sodium chloride [NaCl]). The animals were monitored for weight and general well-being. The experimental protocol was reviewed and approved by the Uppsala University Ethics Committee, Sweden, according to the European Union guidelines.
Animals were anesthetized through intraperitoneal administration of 0.33 mL per 100 g of body weight (BW) of 1 part fentanyl/fluanisone (10 mg/mL of fluanisone, 0.2 mg/mL of fentanyl; Hypnorm Vet, Janssen Pharmaceutica, Beerse, Belgium), 1 part midazolam (5 mg/mL of Dormicum; L. Hoffman-La Roche AG, Basel, Switzerland), and 2 parts sterile water, and the left common carotid artery (LCCA) was injured with a 2-French embolectomy catheter (Baxter Healthcare Corporation, Irvine, CA) as described earlier.21 Briefly, a midline skin incision was made, and the ACC and bifurcation into the internal and external carotid artery were exposed. A 2-French atherectomy catheter (V-Technician AB, Göteborg, Sweden) was introduced into the external left carotid artery (ECA), pushed caudal to the aortic root of the ACC, gently inflated, pulled back under constant rotation to the ECA, and then deflated. This procedure was repeated 3 times. A caudal ligation was added to the ECA, and the catheter was retracted.
HAART (10 mg/kg of BW of lopinavir, 2.5 mg/kg of BW of ritonavir, 2.5 mg/kg of BW of lamivudine, and 5 mg/kg of BW of zidovudine) and rosuvastatin (1 mg/kg of BW) were dissolved in sterile 0.9% NaCl shortly before administration via gavage. Drug administration was performed twice daily for HAART (with 12-hour interception) and once daily for rosuvastatin in a maximal volume of 1 mL. The first doses were given 24 hours before injury, and the subsequent doses were given every 24 or 12 hours thereafter, as described previously.
Eight or 14 days after injury, the animals were anesthetized as described previously. Three hours before surgery, the animals received an intravenous injection of 7 mg of bromodeoxyuridine (BrdU) diluted in 40% ethanol, and 20 minutes before surgery, an intravenous injection of 1.0 mL of 0.5% Evans blue dye in phosphate-buffered saline (PBS) was given to allow identification of the de-endothelialized vessel segment. Immediately before euthanasia, approximately 2 mL of blood was taken from animals and serum was cleared and stored at -80°C until further analyses. The animals were euthanatized with an intravenous overdose of the anesthetic agents, and the vasculature was cleared of blood by in situ perfusion with Ringer saline at 100 mm Hg. The distal halves of the right common carotid artery and ACC were processed for histopathologic analyses, and the remaining proximal segments were perfused in situ with 4% paraformaldehyde in 15% sucrose, pH 7.4, and processed for paraffin embedding.22 For scanning electronic microscopy (SEM) analysis, specimens were fixed with 2.5% glutaraldehyde in PBS and immediately processed for SEM using a Philips (Phillips Electron Optics, Eindhoven, The Netherlands) XL30 microscope.
Histopathologic Analyses
For measurement of re-endothelialization, the distal injured left carotid vessel segments were surgically extracted, incised longitudinally, pinned down on cork (exposing the luminal surface), and photographed using a stereomicroscope connected to a digital camera (Leica, Solms Germany). Re-endothelialization was determined directly after surgical extraction. The area that remained unstained after Evans blue dye application was measured as well as the distance from the carotid bifurcation, indicating re-endothelialization by continuous growth from an uninjured and nondenuded vessel segment. The presence of endothelial coverage in unstained segments and the lack of endothelial cells in Evans blue dye-stained regions were confirmed by SEM. Quantification was performed with National Institutes of Health (NIH, Bethesda, MD) Image 1.41 software.
For SEM, the specimens were prefixed with 2% glutaraldehyde in PBS (pH 7.4) at 4°C. Thereafter, they were washed 3 times in phosphate buffer. fixed in 1% osmium tetroxide for 2 hours, and washed again 3 times in phosphate buffer, followed by dehydration with 50%, 70%, 90%, 95%, and absolute ethanol twice (all ethanol stages at 15-minute intervals). The samples were then transferred to a critical point dryer. After the samples were mounted on Cambridge aluminium stubs using LEIT C conductive carbon cement, the stubs were then gold-sputtered (22 nm). All images were taken using a Philips XL30 electron microscope.
Immunohistologic and Morphometric Analyses
From each formalin-fixed vessel specimen, beginning from the distal cut end, 3 evenly spaced vessel segments approximately 1 mm apart were cut, serially sectioned, and stained with Verhoeff elastin stain, hematoxylin, hematoxylin-eosin, and Picro-Sirius red collagen stain.
Sections were digitalized with an Olympus (Olympus Mikroskopie, Hamburg, Germany) BH-2 microscope connected to a Sony (Sony, Tokyo, Japan) DKC-5000 camera at ×10 magnification. Areas for the lumen, tunica intima, tunica media, external elastic lamina (EEL), and luminal circumference were measured by NIH Image 1.41 software, and the neointima/media ratio was calculated. The mean value of 2 sections from 3 segments was used for statistical analysis.
Paraffin sections from the proximal end of the snap-frozen specimens were stained for BrdU (1:50 ratio, DakoCytomation, Glostrup, Denmark). The BrdU-positive nuclei were counted in the tunica intima, tunica media, and tunica adventitia, and the total number of positively stained nuclei was determined. For proliferating cell nuclear antigen (PCNA) staining, sections were incubated with a mouse monoclonal anti-PCNA antibody (DakoCytomation) at a dilution of 1:800. Biotinylated horse- (Vector Laboratories, Buringame, CA) and goat- (DakoCytomation) anti-mouse IgGs were used as secondary antibodies. Counterstaining was performed with Mayer hematoxylin. 3,3-Diaminobenzidine (DAB) was used as the chromogenic substrate.
Quantitative Real-Time Polymerase Chain Reaction
Eight days after injury, 50 μm of artery was sectioned separately from frozen tissue (control: n = 6, HAART: n = 6) and pooled. RNA was isolated with the Arcturus PicoPure RNA Isolation kit, transcribed to cDNA using random primers, and subjected to quantitative real-time polymerase chain reaction (qRT-PCR; SybrGreen Universal PCR Master Mix; Applied Biosystems, Foster City, CA). The reaction was performed in triplicate with the ABI PRISM 7500HT RT-PCR cycler (Applied Biosystems). Transcript levels are shown as the ratio between Noxa, CD163, or colony-stimulating factor-1 and the expression of the housekeeping gene hypoxanthine-guanine phosphoribosyl transferase (HPRT). NOXA expression in the control-treated group was arbitrarily set to 1, and the value for the HAART-treated group was adjusted accordingly. The results presented show the mean and SD of 2 independent experiments. Primer sequences for HPRT (ensemble gene ID: ENSRNOG00000031367) were CTCATGGACTGATATGGACAGGAC (forward) and GCAGGTCAGCAAAGAACTTATAGCC (reverse); for Noxa (ENSRNOG00000018770), they were: TGGAGTGCACCGGACATAAC (forward) and GTGCTCTTTCGCGACTTCTTG (reverse); for CD163 (ENSRNOG00000010253), they were GCATGGCACAGGTCATTCAA (forward) and CGTCGCTTCAGAGTCCACAAG (reverse); and for colony-stimulating factor-1 receptor (ENSRNOG00000018414), they were GAACAACCTGCAATTTGGTAAGACT (forward) and TTCTTTGCCCAGACCAAAGG (reverse).
Analyses of Serum Lipids
Serum total cholesterol, triglycerides, and high-density lipoprotein cholesterol (HDL-C) were measured by homogeneous enzymatic colorimetric assays (CHOD-PAP, HDL-C plus second generation, and GPO-PAP), according to the manufacturer's recommendations (Roche Diagnostic, Boehringer Mannheim Systems, Mannheim, Germany). All measurements were performed in quadruplicate.
All instrumentation and measurements were performed by 2 individuals (KK and OL) masked to treatment allocation.
Statistical Analysis
Data are presented as the mean ± standard error of the mean or as the mean ± SD, as indicated. Statistical comparisons were determined by the unpaired Student t test. Statistical significance was accepted at P < 0.05.
RESULTS
The animals were randomly classified to 6 different treatment groups. The medical treatment started 1 day before the vessel injury procedure and lasted throughout the study period for 8 or 14 days.
HAART Does Not Lead to Alterations in Weight or Lipid Parameters
All animals were weighed at least twice a week, and no differences were detected between the groups (Table 1A). The rosuvastatin-treated animals displayed higher total cholesterol values. None of the treatments led to significant differences with regard to triglycerides or HDL (see Table 1B).
HAART Increases the Intima/Media Ratio After Balloon Injury
Effects of HAART and rosuvastatin on neointima formation were analyzed in the rat carotid balloon injury model. No differences in overall vessel morphology were observed within the different groups in noninjured vessels (not shown). No difference in the amount of elastic fibers (Verhoeff elastin stain) or collagen content within the vessel wall (Picro-Sirius red collagen stain) was detected between the control group and different treatment groups 14 days after vessel injury (Fig. 1A). Furthermore, there was no obvious difference in neointimal and medial cellular content (cell number per defined area), as shown by hematoxylin-eosin staining (see Fig. 1A).
To analyze the lumen, we compared the circumference of the inner border of the neointima to that of the lumen. Comparable results were obtained between the control group and the animals subjected to HAART. There was a benefit in vessel morphology in the rosuvastatin group (P < 0.05 compared with controls) that was not seen in combination treatment with HAART (Table 2).
The neointima/media ratio in the HAART group was increased to 1.31 ± 0.20 versus 1.14 ± 0.32 for controls (P < 0.05). A lesser effect was observed after cotreatment with rosuvastatin. No significant reduction in the intima/media ratio was observed after treatment with rosuvastatin alone (1.24 ± 0.29). The neointima area was almost equal in all groups, however, and differences in the neointima/media ratio could be partially explained by a thinning of the medial layer in HAART-treated animals (see Table 2).
Remodeling was determined by evaluating the area surrounded by the EEL. None of the treatments induced significant differences as compared to the control-treated group, even though a small benefit was seen in the group treated with rosuvastatin (see Table 2).
In summary, the HAART-treated animals displayed a moderate increase in the neointima/media ratio, which occurred as a consequence of a concomitant decrease in the media and increase in the neointima.
HAART Does Not Alter Neointimal Proliferation
In addition to morphometry, lesions were further analyzed to investigate the cellular processes underlying neointima formation. To characterize the effects on VSMCs, we determined the number of VSMCs undergoing proliferation and apoptosis. Proliferation and apoptosis showed the highest upregulation at early time points after intervention (data not shown). Therefore, we measured the effect of HAART on these cellular responses 8 days after vascular injury.
To assess proliferation of VSMCs within the neointima and media, we administered BrdU before euthanasia. Incubation of sections without specific primary antibody confirmed the specificity of the staining (Fig. 2A, upper panel). No BrdU-positive cells were observed in noninjured vessels (see Fig. 2A, lower panel). A slight but nonsignificant alteration in VSMC proliferation, as determined by BrdU incorporation, was observed in the HAART group compared with the control group (see Fig. 2A, lower panel). Figure 2B shows the quantification of BrdU-positive cells in the different tissue layers of the neointima, media, and adventitia. No significant differences were observed between control- and HAART-treated animals in any of the 3 layers. To confirm these findings, we performed additional PCNA immunohistochemistry, which revealed similar staining patterns (see Fig. 2C).
Because no significant differences with regard to vascular cell proliferation between controls and HAART-treated animals were detected, we further analyzed apoptosis in vessel lesions. Interestingly, the transcript levels of Noxa, a member of the proapoptotic BH3-only proteins, was significantly higher in the HAART-treated group than in the control group (see Fig. 2D), suggesting enhanced apoptosis as a consequence of HAART treatment in injured vessels.
HAART Leads to Significant Inhibition of Re-Endothelialization
Before euthanasia, Evans blue dye was administered to distinguish between nonendothelialized and re-endothelialized vessel segments. Figure 3A shows quantification of the re-endothelialized area and the maximal length of re-endothelialization for control-treated animals and the HAART-treated group 8 days after intervention and for all 4 groups after 14 days. At 8 days after intervention, no difference was observed between the 2 groups regarding endothelial growth starting from the carotid bifurcation, whereas a significant inhibition of re-endothelialization in the HAART group could be demonstrated after 14 days. No further development of re-endothelialization between the 8- and 14-day time points was seen in the HAART group, whereas the control group showed dynamic endothelial recovery.
Figure 3B shows microscopic images of vessels of control- and HAART-treated animals at 8 and 14 days after de-endothelialization. Figure 3C is a representative sample showing recovered endothelium, the front of re-endothelializing cells, and de-endothelialized vessel segments by SEM.
HAART Does Not Alter Macrophage Infiltration
Because HAART may be involved in the progression of atherosclerosis, which includes the infiltration and transdifferentiation of monocytes and/or macrophages in the vessel wall, we further analyzed the amounts of the monocyte- and macrophage-specific transcript levels of CD163 and colony-stimulating factor-1 receptor in vessel lesions 8 days after injury. Both markers were significantly increased in restenotic vessels compared with uninjured control arteries (not shown). No differences were observed in restenotic lesions between the control- and HAART-treated groups (Fig. 4), however, arguing against the possibility that HAART treatment is followed by enhanced monocyte infiltration at an early phase after balloon injury.
DISCUSSION
Among the unwanted effects of HAART, possible direct or indirect effects on the vascular wall leading to initiation or progression of cardiovascular disease have received particular interest. In this study, we have analyzed in an animal model for the first time the effects of HAART treatment on vessel wall biology using a rat model of vascular injury. Interestingly, HAART treatment was found to be associated with an increased neointima/media ratio and reduced re-endothelialization. Furthermore, these effects were not observed after cotreatment with rosuvastatin and HAART.
The significant increase in the neointima/media ratio by HAART occurred as a consequence of concomitant thickening of the neointima and thinning of the medial layer. These alterations were not associated with significant alterations in VSMC proliferation, and thus suggest effects of HAART on VSMC migration. The mechanisms underlying these phenotypic changes merit further investigation. One possible factor might be altered apoptosis as a consequence of HAART treatment, as suggested by increased transcript levels of the proapoptotic BH3-only protein Noxa, which has been shown to be regulated on the transcriptional level23 in injured vessels of HAART-treated animals. Given the well-established roles of such growth factors as fibroblast growth factor (FGF) and platelet-derived growth factor (PDGF) in these processes, it is of interest to analyze whether HAART treatment modulates VSMC responses to these proteins. To date, only limited information is available from tissue culture studies on the effects of HAART on VSMCs. Nevertheless, a single study has reported antiproliferative effects of the HAART component ritonavir on cultured VSMCs at clinical concentrations and even apoptotic effects of ritonavir at higher doses.19
Statins, potent inhibitors of cholesterol synthesis, have been shown to lower total cholesterol, low-density lipoprotein (LDL), and triglyceride levels.24 Moreover, statins exhibit cholesterol-independent or pleiotropic effects.25,26 Whether clinically relevant concentrations, which were shown to be effective in altering other biologic parameters (eg, vascular resistance),27 are capable of reducing neointima formation or accelerating endothelial recovery was not previously tested. Rosuvastatin is a new highly effective HMG-CoA reductase inhibitor that possesses numerous advantageous pharmacologic properties.28 In the present study, combination treatment of HAART and rosuvastatin was associated with neointima/media ratio levels similar to those of control treated animals. This particularly involved abolishment of medial thinning. It is noteworthy that the effects occurred with a low dose of rosuvastatin, which failed to alter lipid parameters greatly. Although indirect effects cannot be ruled out, the results are most compatible with direct effects of rosuvastatin on VSMCs that interfere with the effects of HAART. The mechanisms underlying these beneficial effects deserve further attention.
Re-endothelialization was determined taking advantage of the fact that a defined area of endothelium was removed, reaching from the carotid bifurcation to the root of the common carotid artery at the aortic arch. We observed a reduction in endothelium recovery in HAART-treated animals. Interestingly, this experimental finding is in line with the clinical observation of an increase in in-stent thrombosis and/or restenosis in HAART-treated individuals (unpublished observation). Direct cytotoxic and apoptotic effects of the PIs ritonavir, which was part of the HAART regimen in this study, and saquinavir have been described in vitro15,16 and might be responsible for the observed effects. Further studies should focus on the underlying mechanisms of HAART-induced reduction of re-endothelialization and on identifying the mechanisms causing these unwanted phenomena. The effects of rosuvastatin are interesting, although still incompletely understood. Previous studies have demonstrated that rosuvastatin leads to enhanced release of nitric oxide from the vascular endothelium.29 Furthermore, treatment with high concentrations of rosuvastatin (20 mg/kg of BW) enhanced the circulating pool of endothelial progenitor cells in mice in a carotid artery injury model, leading to accelerated re-endothelialization and decreased neointima formation.14 To what extent alterations in endothelial progenitor cell recruitment were involved in the effects of HAART or rosuvastatin in this animal model constitutes a valid topic for future investigations.
In this study, we analyzed the early phase of restenotic tissue remodeling, which should be clearly distinguished from chronic vessel diseases, such as atherosclerosis, that involve other alterations in cell and matrix compositions of the vessel wall. Rapid injury-induced restenosis has a much lesser component of inflammatory changes, including macrophage infiltration, than atherosclerosis. In this respect, even though we did not detect changes in the amount of monocytes and/or macrophages in restenotic vessels of control- and HAART-treated animals, we cannot rule out the possibility that HAART treatment might include long-term inflammatory changes.
Several limitations of the study should be taken into account. A variety of different HAART regimens are currently used in clinical practice. In this study, we analyzed a single important HAART regimen (lopinavir, ritonavir, lamivudine, and zidovudine) that is commonly prescribed in Europe. We cannot rule out the possibility that different HAART regimens may affect neointima formation and re-endothelialization in a different way, however, as demonstrated in this study. Furthermore, the effects of HAART and statins should be studied in additional animal models of restenosis and atherosclerosis that show a larger dependence on lipids than the model used in this study. In addition, we selected doses of HAART components that had been used in earlier studies in animal models,30,31 which most likely reach plasma levels below the levels reached in humans. Therefore, the effects observed in our study might underestimate the effects in HAART-treated humans.
In conclusion, we present evidence that HAART may negatively influence the process of healing after coronary artery endothelial damage in vivo independently of HIV infection or extensive lipid abnormalities. This occurs through mechanisms that involve alterations in responses of VSMCs and endothelial cells. Concomitant statin therapy was at least partially able to reverse the effects of HAART on the vessel wall. Continued studies are therefore highly warranted to explore effects of HAART on different cell types of the vessel wall and the potential therapeutic benefit of combination treatment with statins. Ultimately, such studies should allow continued improvement of HAART-based treatments.
REFERENCES
1. Sabin CA. The changing clinical epidemiology of AIDS in the highly active antiretroviral therapy era. AIDS. 2002;16(Suppl 4):S61-S68.
2. de Gaetano Donati K, Rabagliati R, Iacoviello L, et al. HIV infection, HAART, and endothelial adhesion molecules: current perspectives. Lancet Infect Dis. 2004;4:213-222.
3. Friis-Moller N, Weber R, Reiss P, et al. Cardiovascular disease risk factors in HIV patients-association with antiretroviral therapy. Results from the DAD study. AIDS. 2003;17:1179-1193.
4. Holmberg SD, Moorman AC, Williamson JM, et al. Protease inhibitors and cardiovascular outcomes in patients with HIV-1. Lancet. 2002;360:1747-1748.
5. Currier JS, Taylor A, Boyd F, et al. Coronary heart disease in HIV-infected individuals. J Acquir Immune Defic Syndr. 2003;33:506-512.
6. Chironi G, Escaut L, Gariepy J, et al. Brief report: carotid intima-media thickness in heavily pretreated HIV-infected patients. J Acquir Immune Defic Syndr. 2003;32:490-493.
7. Klein D, Hurley LB, Quesenberry CP, Jr, et al. Do protease inhibitors increase the risk for coronary heart disease in patients with HIV-1 infection? J Acquir Immune Defic Syndr. 2002;30:471-477.
8. Bozzette SA, Ake CF, Tam HK, et al. Cardiovascular and cerebrovascular events in patients treated for human immunodeficiency virus infection. N Engl J Med. 2003;348:702-710.
9. de Gaetano Donati K, Rabagliati R, Tumbarello M, et al. Increased soluble markers of endothelial dysfunction in HIV-positive patients under highly active antiretroviral therapy. AIDS. 2003;17:765-768.
10. Shepherd J, Cobbe SM, Ford I, et al. Prevention of coronary heart disease with pravastatin in men with hypercholesterolemia. West of Scotland Coronary Prevention Study Group. N Engl J Med. 1995;333:1301-1307.
11. Long-Term Intervention with Pravastatin in Ischaemic Disease (LIPID) Study Group. Prevention of cardiovascular events and death with pravastatin in patients with coronary heart disease and a broad range of initial cholesterol levels. N Engl J Med. 1998;339:1349-1357.
12. Randomised trial of cholesterol lowering in 4444 patients with coronary heart disease: the Scandinavian Simvastatin Survival Study (4S). Lancet. 1994;344:1383-1389.
13. Sacks FM, Pfeffer MA, Moye LA, et al. The effect of pravastatin on coronary events after myocardial infarction in patients with average cholesterol levels. Cholesterol and Recurrent Events Trial investigators. N Engl J Med. 1996;335:1001-1009.
14. Werner N, Priller J, Laufs U, et al. Bone marrow-derived progenitor cells modulate vascular reendothelialization and neointimal formation: effect of 3-hydroxy-3-methylglutaryl coenzyme a reductase inhibition. Arterioscler Thromb Vasc Biol. 2002;22:1567-1572.
15. Zhong DS, Lu XH, Conklin BS, et al. HIV protease inhibitor ritonavir induces cytotoxicity of human endothelial cells. Arterioscler Thromb Vasc Biol. 2002;22:1560-1566.
16. Baliga RS, Liu C, Hoyt DG, et al. Vascular endothelial toxicity induced by HIV protease inhibitor: evidence of oxidant-related dysfunction and apoptosis. Cardiovasc Toxicol. 2004;4:199-206.
17. Chai H, Yang H, Yan S, et al. Effects of 5 HIV protease inhibitors on vasomotor function and superoxide anion production in porcine coronary arteries. J Acquir Immune Defic Syndr. 2005;40:12-19.
18. Fu W, Chai H, Yao Q, et al. Effects of HIV protease inhibitor ritonavir on vasomotor function and endothelial nitric oxide synthase expression. J Acquir Immune Defic Syndr. 2005;39:152-158.
19. Kappert K, Caglayan E, Baumer AT, et al. Ritonavir exhibits anti-atherogenic properties on vascular smooth muscle cells. AIDS. 2004;18:403-411.
20. Wolf K, Tsakiris DA, Weber R, et al. Antiretroviral therapy reduces markers of endothelial and coagulation activation in patients infected with human immunodeficiency virus type 1. J Infect Dis. 2002;185:456-462.
21. Leppanen O, Janjic N, Carlsson MA, et al. Intimal hyperplasia recurs after removal of PDGF-AB and -BB inhibition in the rat carotid artery injury model. Arterioscler Thromb Vasc Biol. 2000;20:E89-E95.
22. Blaschke F, Leppanen O, Takata Y, et al. Liver X receptor agonists suppress vascular smooth muscle cell proliferation and inhibit neointima formation in balloon-injured rat carotid arteries. Circ Res. 2004;95:e110-e123.
23. Flinterman M, Guelen L, Ezzati-Nik S, et al. E1A activates transcription of p73 and Noxa to induce apoptosis. J Biol Chem. 2005;280:5945-5959.
24. Blumenthal RS. Statins: effective antiatherosclerotic therapy. Am Heart J. 2000;139:577-583.
25. Treasure CB, Klein JL, Weintraub WS, et al. Beneficial effects of cholesterol-lowering therapy on the coronary endothelium in patients with coronary artery disease. N Engl J Med. 1995;332:481-487.
26. Laufs U, La Fata V, Plutzky J, et al. Upregulation of endothelial nitric oxide synthase by HMG CoA reductase inhibitors. Circulation. 1998;97:1129-1135.
27. Susic D, Varagic J, Ahn J, et al. Beneficial pleiotropic vascular effects of rosuvastatin in two hypertensive models. J Am Coll Cardiol. 2003;42:1091-1097.
28. Olsson AG, McTaggart F, Raza A. Rosuvastatin: a highly effective new HMG-CoA reductase inhibitor. Cardiovasc Drug Rev. 2002;20:303-328.
29. Stalker TJ, Lefer AM, Scalia R. A new HMG-CoA reductase inhibitor, rosuvastatin, exerts anti-inflammatory effects on the microvascular endothelium: the role of mevalonic acid. Br J Pharmacol. 2001;133:406-412.
30. Yan Q, Hruz PW. Direct comparison of the acute in vivo effects of HIV protease inhibitors on peripheral glucose disposal. J Acquir Immune Defic Syndr. 2005;40:398-403.
31. Kumar GN, Jayanti VK, Johnson MK, et al. Metabolism and disposition of the HIV-1 protease inhibitor lopinavir (ABT-378) given in combination with ritonavir in rats, dogs, and humans. Pharm Res. 2004;21:1622-1630.
© 2006 Lippincott Williams & Wilkins, Inc.