Skip Navigation LinksHome > October 1, 2005 - Volume 40 - Issue 2 > Viral, Nutritional, and Bacterial Safety of Flash-Heated and...
JAIDS Journal of Acquired Immune Deficiency Syndromes:
Clinical Science

Viral, Nutritional, and Bacterial Safety of Flash-Heated and Pretoria-Pasteurized Breast Milk to Prevent Mother-to-Child Transmission of HIV in Resource-Poor Countries: A Pilot Study

Israel-Ballard, Kiersten MPH*; Chantry, Caroline MD†; Dewey, Kathryn PhD‡; Lönnerdal, Bo PhD‡; Sheppard, Haynes PhD§; Donovan, Richard PhD§; Carlson, James PhD∥; Sage, Allyson RN, MPH¶; Abrams, Barbara DrPH#

Free Access
Article Outline
Collapse Box

Author Information

From the *Division of Epidemiology, School of Public Health, University of California, Berkeley, CA; †Department of Pediatrics, University of California, Davis Medical Center, Sacramento, CA; ‡Department of Nutrition, University of California, Davis, Davis, CA; §California Department of Health Services Viral and Rickettsial Disease Laboratory, Richmond, CA; ∥Focus Diagnostics and the Department of Pathology and Laboratory Medicine, University of California Davis Medical Center, Sacramento, CA; ¶University of California, Davis M.I.N.D. Institute, Sacramento, CA; and #Division of Epidemiology, School of Public Health, University of California, Berkeley, CA.

Received for publication February 24, 2005; accepted July 12, 2005.

Supported by the North-Central California Center for AIDS Research, a National Institutes of Health-funded program (P30-AI49366-01); James B. Pendleton Charitable Trust; University of California at Davis Children's Miracle Network; and contributions from Stephen Luczo, Julie Still, and William and Denise Watkins.

Reprints: Kiersten Israel-Ballard, Division of Epidemiology, School of Public Health, University of California, 140 Earl Warren Hall, Berkeley, CA (e-mail: ballardk@berkeley.edu).

Collapse Box

Abstract

Background: Heat-treated breast milk of HIV-positive mothers has potential to reduce vertical transmission. This study compared the impact of flash-heating (FH) and Pretoria pasteurization (PP) on HIV, nutrients, and antimicrobial properties in human milk.

Methods: Milk samples were spiked with 1 × 108 copies/mL of clade C HIV-1 and treated with FH and PP. We measured HIV reverse transcriptase (RT) activity before and after heating (n = 5). Heat impact on vitamins A, B6, B12, and C; folate, riboflavin, thiamin, and antimicrobial proteins (lactoferrin and lysozyme) was assessed. Storage safety was evaluated by spiking with Escherichia coli or Staphylococcus aureus.

Results: Both methods inactivated ≥3 logs of HIV-1. FH resulted in undetectable RT activity. Neither method caused significant decrease in any vitamin, although reductions in vitamins C and E were noted. Heat decreased immunoreactive lactoferrin (P < 0.05) but not the proportions of lactoferrin and lysozyme surviving digestion. FH seems to retain more antibacterial activity. Both treatments eliminated spiked bacteria.

Conclusions: FH may be superior to PP in eliminating all viral activity; both methods retained nutrients and destroyed bacterial contamination. Heat-treated breast milk merits further study as a safe and practical infant feeding option for HIV-positive mothers in developing countries.

In developed countries, obstetric intervention, antiretroviral (ARV) drugs, and avoidance of breast-feeding have drastically reduced mother-to-child transmission (MTCT) of HIV, but these options are not available to most women in the developing world. One third to one half of pediatric HIV infections in sub-Saharan Africa are attributed to breast-feeding.1 Complete avoidance of breast-feeding for HIV-positive mothers in resource-poor communities may not be possible because of cost, lack of safe water, unsanitary conditions, and sociocultural factors. In these settings, formula feeding has been associated with a 14- to 25-fold increase in diarrhea-associated infant mortality2-6 because of contamination and lack of the protective factors intrinsic to breast milk. Thus, many HIV-positive mothers and health care workers face a desperate dilemma: risk HIV transmission through breast-feeding versus increased morbidity and mortality with infant formula or other breast milk substitutes.

Although the prevailing form of breast-feeding worldwide is mixed breast-feeding (supplementing with non-breast milk liquids and/or solids),7 several recent studies suggest that this may increase the risk of HIV transmission up to 4-fold compared with exclusive breast-feeding (EBF) to 6 months.8-10 Increased risk among mixed feeders is hypothesized to be attributable to an increased risk of maternal mastitis, causing an increase in milk viral load, and to the introduction of antigens, which may compromise the infant's gut integrity.11,12 Currently, the World Health Organization (WHO) recommends that HIV-positive mothers in developing countries practice EBF for the first months and then wean unless alternative feeding options are acceptable, feasible, affordable, safe, and sustainable.13-15 One WHO-endorsed alternative, manually expressed heat-treated breast milk, has not yet been fully investigated.16,17 The WHO lists (1) direct boiling, shown to cause significant nutritional damage, and (2) pasteurization, such as Holder pasteurization (62.5°C for 30 minutes),16 which has been reported to inactivate HIV, although retaining most of breast milk's protective elements,18-21 but requires temperature gauges and timing devices unavailable in most at-risk communities.22 This pilot study investigated and compared the virologic, nutritional, and antimicrobial safety of flash-heating (FH) and Pretoria pasteurization (PP), 2 recently developed heat treatments that a mother in a developing country could implement over a fire or in her kitchen.23,24

Back to Top | Article Outline

METHODS

Sample Collection

Healthy lactating women, 2 to 12 months postpartum and not receiving antibiotics or corticosteroids, were recruited in northern California between August 2003 and May 2004. Institutional review board approval and written informed consent were obtained. After cleansing each breast with soap and water to reduce contamination from normal skin flora, each woman donated 80 to 120 mL of breast milk using a pump or hand expression. Samples were transferred to sterile containers and transported on ice for laboratory assays within 2 hours of expression.

Back to Top | Article Outline
Heat Treatments

Two methods of heat treatment were performed using a single-burner butane stove to imitate the intense heat of a fire. PP has been described elsewhere.23,25,26 Briefly, 450 mL of water was brought to a boil in a 1:1 Hart 1 quart aluminum pan and then removed from the heat. A 50-mL sample of breast milk in a 16-oz glass peanut butter jar with a lid was placed in the water bath for 20 minutes; it was then removed from the water bath, uncovered, and allowed to cool to 37.0°C. The FH method was modified from methods described elsewhere.24 Using the same equipment, a 50-mL sample of breast milk in an uncovered glass peanut butter jar was placed in 450 mL of water in an aluminum pan. The water and milk were heated together over a flame until the water reached 100°C and was at a rolling boil. The breast milk was immediately removed from the water and allowed to cool to 37.0°C. Temperature data were collected at 15-second intervals using thermometer probes (Cole-Palmer Digi-Sense DuaLogR Thermocouple Thermometers).

Back to Top | Article Outline
HIV Assays

Five fresh whole breast milk samples and phosphate-buffered saline (PBS) were inoculated with 1 × 108 copies/mL of cell-free clade C HIV and aliquoted to (1) unheated HIV-spiked milk, (2) FH HIV-spiked milk, (3) PP HIV-spiked milk, (4) unheated HIV-spiked PBS, (5) FH HIV-spiked PBS, (6) PP HIV-spiked PBS, and (7) unheated milk not spiked with HIV.

Samples were assayed for HIV using 3 techniques: (1) TaqMan real-time RNA polymerase chain reaction (PCR; TaqMan PCR), (2) reverse transcriptase (RT) enzymatic activity assay, and (3) semiquantitative cultures. We compared these assay methods because it was necessary to discriminate between live and inactivated HIV. Because TaqMan PCR assays detect only viral nucleic acid and do not distinguish between viable and nonviable HIV, we required an additional assay to assess the viability of HIV. Because previous studies have shown the RT assay to correlate well with RNA quantification and because functional RT is required for cellular infection, we chose quantitative measurement of RT activity as a quantitative marker for the presence of viable HIV.27

RNA was extracted using the Viral RNA Kit (Qiagen, Valencia, CA). The TaqMan PCR assay methods have been described elsewhere.28 TaqMan oligonucleotides were HIVB-579f: ACATCAAGCAGCCATGCAAAT, HIVB-682r: TCTGGCCTGGTGCAATAGG, and HIVB-612p: CTATCCCATTCTGCAGCTTCCTCATTGATG. The ExaVir Quantitative HIV-Reverse Transcriptase Load Kit (Cavidi, Uppsala, Sweden) was used according to the manufacturer's instructions.

Semiquantitative culture was performed using established techniques.29 Briefly, 5 × 104 PM1 cells in 100 μL of RPMI 1640/10% fetal bovine serum (FBS) were placed into a 96-well plate in 6 groups of 4 wells each (quadruplicate). One hundred microliters of serial 10-fold dilutions of the milk or PBS sample diluted 10−1 to 10−6 in RPMI 1640/10% FBS were added to the appropriate well. Cultures were incubated at 37°C in 5% CO2. To remove residual virus, on day 1, cultures were washed 3 times by removing tissue culture medium, adding fresh medium, respinning the cells, and centrifuging at 400 g for 10 minutes. Cultures were fed every 3 days beginning at day 1 by removing 150 μL of culture supernatant and replacing it with an equal volume of medium. Samples were taken for p24 assays at days 1 and 3 (background residual p24 from inoculum) and at days 7, 14, 21, and 28.

Back to Top | Article Outline
Nutrient Assays

Vitamin and protein analyses were performed on unspiked, fresh, whole breast milk samples (120 mL) collected from mothers as described previously. Sample sizes varied per nutrient assay (Table 1). Each milk sample was aliquoted to (1) unheated, (2) FH, or (3) PP and was frozen at −20°C to await analysis.

Table 1
Table 1
Image Tools

For the vitamin A analysis, the sample was mixed with ethanolic potassium hydroxide-containing pyrogallol and heated for 1 hour at 60°C. Retinol was extracted into hexane using o-ethyl-retinal-oxime as an internal standard and was analyzed by reverse-phase high-performance liquid chromatography (HPLC) as previously described.30

For the ascorbic acid analysis, an aliquot of sample was mixed with an equal volume of metaphosphoric acid. After centrifugation, vitamin C was measured by HPLC.

Thiamin diphosphate was measured by HPLC after derivatization with alkaline ferricyanide in a slightly modified version as described by Lynch et al31 and Baines.32

After precipitation with metaphosphoric acid, riboflavin was measured by reverse-phase HPLC.

After protein precipitation with 10% metaphosphoric acid, plasma pyridoxal-5 phosphate (vitamin B6) was measured using HPLC with on-line derivatization with sodium bisulfite and fluorometric detection.

Folate and vitamin B12 were measured using automated competitive chemiluminescent immunoassays on the Bayer Advia: Centaur instrument.

Lactoferrin was quantified before and after treatment by a sandwich enzyme-linked immunosorbent assay (ELISA).33,34 In vitro digestion was performed as previously described34,35 with minor modifications. Milk samples were adjusted to pH 3.8 with 1 M of HCl, and porcine pepsin (Sigma, St. Louis, MO) was added to make a pepsin/protein ratio of 0.08. The mixtures were incubated for 30 minutes at 37°C with shaking at 200 rpm. After incubation, pH was adjusted to 7.0 with 1 M of sodium bicarbonate. Porcine pancreatin (Sigma, 8 × United States Pharmacopoeia) was then added to make a pancreatin/initial protein ratio of 0.016. After 1 hour of incubation at 37°C with shaking at 200 rpm, enzymes were inactivated by heating (85°C for 3 minutes). Undigested proteins were separated from peptides and low-molecular-weight compounds by rapid gel filtration using PD-10 columns. Total protein and undigested protein were analyzed by the Lowry method, which is known to correlate well with micro-Kjeldahl analysis,36 and digested protein by difference. Proteins remaining after in vitro digestion were identified by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and Western blotting with specific antibodies. Samples were applied for SDS-PAGE under reducing conditions, and the gels were stained with Coomassie blue. For Western blotting, an SDS-PAGE gel was electroblotted to a 0.45-μm nitrocellulose membrane using a Mini Trans-Blot Electrophoretic Transfer Cell (Bio-Rad, Hercules, CA). The blot was blocked with 5% nonfat dry milk in PBS, pH 7.4, for at least 2 hours, followed by 3 washes with PBS, pH 7.4, for 10 minutes each. Membranes were incubated with 5% bovine serum albumin and 0.05% Tween-20 in PBS for 1 hour to block nonspecific binding. Membranes were washed 3 times and then incubated with horseradish peroxidase-conjugated antibodies against lactoferrin and lysozyme for 1 hour at room temperature. After another wash, immunologically active proteins were detected by enhanced chemoluminescence Western blot detection reagent (Amersham Pharmacia Biotech, Piscataway, NJ).

Back to Top | Article Outline
Microbiology Assays

To determine the effect of heat treatments on the natural antimicrobial properties of fresh whole breast milk, 1 sample each was aliquoted to (1) unheated milk, (2) FH milk, (3) PP milk, and (4) a saline control and was inoculated with 1 × 106 colony-forming units (CFUs)/mL of Staphylococcus aureus or Escherichia coli. Samples were incubated at 25°C for 12 hours, and quantitative subcultures were then performed using salt blood agar (SBA) (Fig. 1). To determine if storing before heating or heating before storing breast milk was safer, 1100 mL of fresh whole breast milk pooled from 10 mothers was spiked with 1 × 106 E coli or S aureus and then aliquoted to (1) FH, (2) PP, or (3) unheated. Samples 1 and 2 were further aliquoted to (1) FH or PP immediately and then stored at 25°C and subcultured on SBA at 0, 4, 8, and 12 hours or (2) stored for 0, 4, 8, or 12 hours at 25°C and then FH or PP and subcultured on SBA. Unheated, unspiked breast milk served as a control.

Figure 1
Figure 1
Image Tools
Back to Top | Article Outline

RESULTS

Heat Treatments

Figure 2 shows typical temperature curves of the FH and PP. FH methods typically reached temperatures higher than 56.0°C for 6 minutes 15 seconds and peaked at 72.9°C. PP methods typically reached temperatures greater than 56.0°C for 13 minutes 52 seconds and peaked at 63.8°C.

Figure 2
Figure 2
Image Tools
Back to Top | Article Outline
HIV Assays

TaqMan PCR assay showed no decrease in the amount of cell-free viral RNA when comparing unheated controls (8.00 log, SD = 0.030) with samples heated using FH (7.95 log, SD = 0.032) or PP (7.99 log, SD = 0.038). Both heating methods showed inactivation of ≥3 logs of HIV-1 as detected by enzymatic activity of RT, however. Figure 1 shows no evidence of RT in all 5 samples of FH milk, whereas a small amount of residual RT activity was observed in 4 of 5 samples that underwent PP. Similarly, 0 of 5 FH samples were positive for virus on coculture compared with 1 of 5 PP samples and 3 of 5 unheated controls.

Back to Top | Article Outline
Nutrient Assays

Table 1 shows that both treatments significantly reduced the concentration of lactoferrin (FH by 84% [SD = 20] and PP by 38% [SD = 18]), although reductions in the more biologically active measures of digestibility of lactoferrin (FH by 4% [SD = 12] and PP by 8% [SD = 10]) and lysozyme (FH by 21% [SD = 24] and PP by 15% [SD = 18]) were not statistically significant. Reductions in vitamin C (FH by 21% [SD = 47] and PP by 32% [SD = 42]) and vitamin E (FH by 10% [SD = 67] and PP by 20% [SD = 43]) were also observed, although these differences were not significant. Both heat treatments were associated with increases in concentrations of the B vitamins and significantly so for folate.

Back to Top | Article Outline
Microbiology Assays

At 12 hours after inoculation, the unheated breast milk sample showed greater inhibition of E coli and S aureus when compared with FH and PP samples as detected by quantitative subcultures (Fig. 3). FH inhibited S aureus and E coli growth by factors of 2.2 and 2.9, respectively, when compared with PP. In the samples spiked with bacteria before heating, FH and PP successfully eliminated the spiked S aureus or E coli, with <100 CFUs in all but 1 sample with 200 CFUs and maintained bacterial inhibition regardless of whether heating was done before or after the storage period of 0, 4, 8, and 12 hours (data not shown).

Figure 3
Figure 3
Image Tools
Back to Top | Article Outline

DISCUSSION

This preliminary work suggests that FH and PP can denature HIV, although retaining most of the nutritional as well as some of the antimicrobial properties of breast milk. Detecting cell-free HIV in heat-treated breast milk was a challenge, however. TaqMan PCR assays were not useful in differentiating active virus versus inactive viral fragments. Although coculture is generally considered the “gold standard” for determining infectivity, it is difficult to demonstrate total inactivity because of the inherent insensitivity of cocultures, particularly in breast milk, as previously reported.37 The RT assay was an effective assay in determining inactivity of cell-free HIV-1 in breast milk, however. Although both heating methods inactivated 3 logs or more of HIV-1, the FH method more effectively eliminated RT activity (and infectivity as measured by the less reliable coculture) than PP.

Recent data suggest that cell-associated HIV may play a more important role in transmission of HIV via breast-feeding than does cell-free virus,38 which was studied here. We hypothesize that the cell-associated HIV provirus should become inactive on cell death, which is likely to occur when the temperature is higher than 45°C for a few minutes and that any remaining HIV should have thermal inactivation properties similar to cell-free virus. Thus, we are confident that the FH method would inactive cell-free and cell-associated HIV in breast milk.

The nutritional results were encouraging. The substantial decreases in the overall amount of lactoferrin observed with FH and PP may be attributable to partial denaturation of the lactoferrin, resulting in less recognition by the antibody used in the assay. It is likely that such denaturation does not impair the biologic activity of lactoferrin.34,39,40 Treatment effects on the in vitro digestibility (the relative proportion that survives digestion) were much more modest, again suggesting that biologic activity may persist in the infant's gastrointestinal tract. Additional research is needed to investigate the impact of these heating methods on the bioactivity of these proteins as well as on other important anti-infective components in breast milk, particularly secretory immunoglobulin A.

No significant decreases were observed in the vitamins assayed because of heat treatment, although power was limited because of the small sample size. Postheating increases in amounts of vitamins A and B12, folate, riboflavin, and thiamin may be attributable to release of the vitamins from binding proteins in the milk; similar findings have been reported elsewhere.41

Because many mothers in developing countries do not have access to refrigeration, safe storage of expressed breast milk is of particular concern.42-45 In samples spiked with E coli and S aureus after heating, bacterial growth was greater than in unheated controls, suggesting that heat inhibited the natural antimicrobial components in human milk that reduce the ability of pathogens to multiply.42-45 This effect was less marked with FH than with PP. In samples spiked before heating, both methods eliminated inoculated as well as naturally occurring bacteria, regardless of whether the milk was heated or stored first. This finding confirms the findings of a previous study showing PP to be capable of killing bacteria in expressed breast milk, allowing it to be safely stored without refrigeration for up to 12 hours.25 This suggests that the safest approach in the field may be to use the same container to store the expressed breast milk and then to heat-treat the milk just before use, because heat would destroy not only the HIV but any potential contamination.25

Both heat treatments were adapted from established heating methods. PP is similar to the low temperature, long time (LTLT) method, such as Holder pasteurization at 62.5°C for 30 minutes. Although it is widely held that LTLT-treated milk maintains most of its immunologic components and macronutrients, previous research has demonstrated a reduction in lactoferrin, vitamins, and immunoglobulins as well as inactivation of a major lipase with Holder pasteurization.46-49 FH is similar to the high temperature, short time (HTST) heat treatment method used commercially, typically heating to 72°C for 15 seconds. Studies have shown that the HTST method effectively killed bacteria and cytomegalovirus, with no decrease in vitamins, lactoferrin, total IgA concentrations, or secretory IgA activity; thus, it is viewed as the preferable heating technique.41,50,51 Our findings are in agreement with previous studies that showed the D69°C of HIV, the time required to reduce the titer or concentration of HIV by 10-fold at 69°C, in culture media to be <1 second; thus, 15 seconds at this temperature would result in a reduction of viral titer by >15 logs.18 Our FH temperatures typically reached greater than 72°C, whereas PP peaked near 62°C, explaining the residual HIV activity after PP and the total viral destruction achieved with FH.

The small number of breast milk samples from healthy women in the United States limits application of these findings to the field. These safety data require verification in a large enough number of naturally infected breast milk samples from HIV-positive mothers from developing countries to ensure statistical power and relevance to the mothers and infants in need of this option. We only examined a single possible scenario, 50 mL of breast milk heated in a 450-mL water bath over a butane stove, but a variety of volumes, containers, and heat sources may influence milk temperatures, and thus effectiveness of heat treatment in the home setting. The findings of Jeffery and Mercer23 that there was little temperature variation in PP because of varying volumes is reassuring,23 but additional work is needed to evaluate variations in milk and water volumes, jar or pan size or shape, heat source, and even altitude on the effectiveness of heat treatments before transferring the method to the field. Finally, this study did not address acceptability and feasibility issues because of the stigma that may arise for a mother who is not breast-feeding or who is expressing and heat-treating her milk. Our previous qualitative study in Zimbabwe, however, found that mothers and other stake holders in infant feeding concluded that heat-treated breast milk, if proven safe and nutritious, could be a more sustainable and low-cost alternative for mothers than infant formula,22 but more research on attitudes, barriers, and feasibility in different settings is required.

ARVs may offer protection during breast-feeding,52-56 and extended regimens are currently under investigation; however, they are unlikely to be widely implemented in the near future.57 Because breast-feeding is a key route of MTCT in developing countries, even in the presence of ARVs, practical infant feeding alternatives are urgently needed for HIV-positive mothers in these settings.58 Manually expressed heat-treated breast milk, which is then fed to the infant using a cup or spoon without the need for breast pumps or bottles, could serve as an affordable mother-controlled alternative in settings in which safe formula is not possible. It may also serve as a low-tech pasteurization process for milk banks in resource-poor areas. Enhanced counseling and support, including method demonstrations, may be necessary for mothers and communities to implement this option successfully.59

Heat treatment may be most feasible on the introduction of complementary foods, because milk production would be well established after months of EBF. This may also be the time when heating breast milk is most efficacious in preventing MTCT of HIV while still providing continued immune protection, because mixed feeding carries a greater risk than does EBF.8,9 It may, however, also be feasible that heat-treated breast milk could be partially or totally substituted for feeding infants at the breast at any age.4,9,60 Results from a study of Kenyan mothers suggest that even a partial reduction in exposure to HIV-infected breast milk could translate into a meaningful reduction in the risk of HIV infection for infants.61,62 This might be accomplished by providing the infant with 1 or more feedings of heat-treated milk per day.

In summary, our findings suggest that these 2 simple heating methods, which do not require technical equipment, may be capable of HIV denaturation while retaining many of the protective elements of breast milk. FH may be more reliable than PP for complete viral destruction and may have less impact on nutritional and antimicrobial properties. Heat treatment of breast milk could play an important role in the promotion of safer breast-feeding practices to reduce MTCT of HIV in developing countries.

Back to Top | Article Outline

ACKNOWLEDGMENTS

The authors acknowledge the Biochemical Genetics Laboratory of the Department of Laboratory Medicine, Mayo Clinic (Rochester, MN), for performing vitamin assays and Annika Bryant and Marjorie Haskell of the Department of Nutrition at the University of California at Davis for performing protein and vitamin A assays. We especially thank the mothers who donated milk for this study.

Back to Top | Article Outline

REFERENCES

1. De Cock KM, Fowler MG, Mercier E, et al. Prevention of mother-to-child HIV transmission in resource-poor countries: translating research into policy and practice. JAMA. 2000;283:1175-1182.

2. Coutsoudis A. Breast-feeding and HIV transmission. In: Black RE, Michaelsen KF, eds. Public Health Issues in Infant and Child Nutrition. Nestle Nutrition Workshop Series. Lippincott, Williams and Wilkins, Antioch, CA. 2002;48:147-166.

3. Morrison P. HIV and infant feeding: to breastfeed or not to breastfeed: the dilemma of competing risks. Part 2. Breastfeed Rev. 1999;7:11-20.

4. Coutsoudis A, Pillay K, Spooner E, et al. Influence of infant-feeding patterns on early mother-to-child transmission of HIV-1 in Durban, South Africa: a prospective cohort study. South African Vitamin A Study Group. Lancet. 1999;354:471-476.

5. Coutsoudis A, Goga AE, Rollins N, et al. Free formula milk for infants of HIV-infected women: blessing or curse? Health Policy Plan. 2002;17:154-160.

6. Victora CG, Smith PG, Vaughan JP, et al. Evidence for protection by breast-feeding against infant deaths from infectious diseases in Brazil. Lancet. 1987;2:319-322.

7. WHO, UNICEF. HIV and Infant Feeding. Guidelines for Decision-Makers. Geneva: World Health Organization; 1998.

8. Iliff PJ, Piwoz EG, Tavengwa NV, et al. Early exclusive breast-feeding reduces the risk of postnatal HIV-1 transmission and increases HIV-free survival. AIDS. 2005;19:699-708.

9. Coutsoudis A, Pillay K, Kuhn L, et al. Method of feeding and transmission of HIV-1 from mothers to children by 15 months of age: prospective cohort study from Durban, South Africa. AIDS. 2001;15:379-387.

10. Leroy V, Becquet R, Rouet F, et al. Postnatal transmission risk according to feeding modalities in children born to HIV-infected mothers in a PMTCT project in Abidjan, Côte d'Ivoire. DITRAME PLUS Project ANRS 1201/1202. Presented at: XV International AIDS Conference; 2004; Bangkok.

11. Cebra JJ. Influences of microbiota on intestinal immune system development. Am J Clin Nutr. 1999;69(Suppl):1046S-1051S.

12. Semba RD, Kumwenda N, Hoover DR, et al. Human immunodeficiency virus load in breast milk, mastitis, and mother-to-child transmission of human immunodeficiency virus type 1. J Infect Dis. 1999;180:93-98.

13. WHO, UNICEF. HIV and Infant Feeding: Framework for Priority Action. Geneva: World Health Organization; 2003.

14. WHO Technical Consultation on Behalf of the UNFPA/UNICEF/WHO/UNAIDS Inter-Agency Task Team on Mother-to-Child Transmission of HIV. New Data on the Prevention of Mother to Child Transmission of HIV and Their Policy Implications. Geneva: World Health Organization, 2000.

15. WHO, UNAIDS, UNICEF, UNFPA. HIV and Infant Feeding: Guidelines for Decision-Makers. Geneva: World Health Organization; 2003.

16. WHO, UNICEF, UNAIDS. HIV and Infant Feeding Counseling: A Training Course-Participants' Manual. Geneva: World Health Organization, 2000.

17. Tomlinson RJ, Madjarov A. Global voices on HIV/AIDS. Pasteurised human breast milk should be considered. BMJ. 2002;324:1034-1035.

18. Orloff SL, Wallingford JC, McDougal JS. Inactivation of human immunodeficiency virus type I in human milk: effects of intrinsic factors in human milk and of pasteurization. J Hum Lact. 1993;9:13-17.

19. Eglin RP, Wilkinson AR. HIV infection and pasteurisation of breast milk. Lancet. 1987;1:1093.

20. McDougal JS, Martin LS, Cort SP, et al. Thermal inactivation of the acquired immunodeficiency syndrome virus, human T lymphotropic virus-III/lymphadenopathy-associated virus, with special reference to antihemophilic factor. J Clin Invest. 1985;76:875-877.

21. Lawrence R, Lawrence R. Breastfeeding: A Guide for the Medical Profession. 5th ed. St. Louis: Mosby; 1999.

22. Israel-Ballard K, Maternowska C, Abrams B, et al. Acceptability of heat-treating breast milk to prevent mother-to-child transmission of HIV in Zimbabwe: a qualitative study. J Hum Lact. (In press).

23. Jeffery BS, Mercer KG. Pretoria pasteurisation: a potential method for the reduction of postnatal mother to child transmission of the human immunodeficiency virus. J Trop Pediatr. 2000;46:219-223.

24. Chantry CJ, Morrison P, Panchula J, et al. Effects of lipolysis or heat treatment on HIV-1 provirus in breast milk. J Acquir Immune Defic Syndr. 2000;24:325-329.

25. Jeffery BS, Soma-Pillay P, Moolman G. The effect of Pretoria pasteurization on bacterial contamination of hand-expressed human breast milk. J Trop Pediatr. 2003;49:240-244.

26. Jeffery BS, Webber L, Mokhondo KR, et al. Determination of the effectiveness of inactivation of human immunodeficiency virus by Pretoria pasteurization. J Trop Pediatr. 2001;47:345-349.

27. Stevens G, Rekhviashvili N, Scott LE, et al. Evaluation of two commercially available, inexpensive alternative assays used for assessing viral load in a cohort of human immunodeficiency virus type 1 subtype C-infected patients from South Africa. J Clin Microbiol. 2005;43:857-861.

28. Yun Z, Fredriksson E, Sonnerborg A. Quantification of human immunodeficiency virus type 1 proviral DNA by the TaqMan real-time PCR assay. J Clin Microbiol. 2002;40:3883-3884.

29. Peden K, Martin M. Virological and molecular genetic techniques for studies of established HIV isolates. In: Karn J, ed. HIV: A Practical Approach. 1st ed. New York, NY: IRL Press at Oxford University Press; 1995:25-26.

30. Handelman G, Shen B, Krinsky N. High resolution analysis of carotenoids in human plasma by high-performance liquid chromatography. Methods Enzymol. 1992;213:336-346.

31. Lynch PL, Trimble ER, Young IS. High-performance liquid chromatographic determination of thiamine diphosphate in erythrocytes using internal standard methodology. J Chromatogr B Biomed Sci Appl. 1997;701:120-123.

32. Baines M. Improved high performance liquid chromatographic determination of thiamin diphosphate in erythrocytes. Clin Chim Acta. 1985;153:43-48.

33. Nandi S, Suzuki Y, Huang J, et al. Expression of human lactoferrin in transgenic rice gains for the application in infant formula. Plant Science. 2002;163:713-722.

34. Suzuki YA, Kelleher SL, Yalda D, et al. Expression, characterization, and biological activity of recombinant human lactoferrin in rice. J Pediatr Gastroenterol Nutr. 2003;36:190-199.

35. Lonnerdal B, Glazier C. An approach to assessing trace element bioavailability from milk in vitro. Extrinsic labeling and proteolytic degradation. Biol Trace Elem Res. 1989;19:57-69.

36. Lonnerdal B, Woodhouse LR, Glazier C. Compartmentalization and quantitation of protein in human milk. J Nutr. 1987;117:1385-1395.

37. Piatak M Jr, Saag MS, Yang LC, et al. Determination of plasma viral load in HIV-1 infection by quantitative competitive polymerase chain reaction. AIDS. 1993;7(Suppl 2):S65-S71.

38. Rousseau CM, Nduati RW, Richardson BA, et al. Association of levels of HIV-1-infected breast milk cells and risk of mother-to-child transmission. J Infect Dis. 2004;190:1880-1888.

39. Lonnerdal B, Iyer S. Lactoferrin: molecular structure and biological function. Annu Rev Nutr. 1995;15:93-110.

40. Kelleher SL, Lonnerdal B. Immunological activities associated with milk. Adv Nutr Res. 2001;10:39-65.

41. Goldblum RM, Dill CW, Albrecht TB, et al. Rapid high-temperature treatment of human milk. J Pediatr. 1984;104:380-385.

42. Goldman AS. The immune system of human milk: antimicrobial, antiinflammatory and immunomodulating properties. Pediatr Infect Dis J. 1993;12:664-671.

43. Sosa R, Barness L. Bacterial growth in refrigerated human milk. Am J Dis Child. 1987;141:111-112.

44. Hamosh M, Ellis LA, Pollock DR, et al. Breastfeeding and the working mother: effect of time and temperature of short-term storage on proteolysis, lipolysis, and bacterial growth in milk. Pediatrics. 1996;97:492-498.

45. Slusser W, Frantz K. High-technology breastfeeding. Pediatr Clin North Am. 2001;48:505-516.

46. Hernell O, Olivecrona T. Human milk lipases. II. Bile salt-stimulated lipase. Biochim Biophys Acta. 1974;369:234-244.

47. Ford JE, Law BA, Marshall VM, et al. Influence of the heat treatment of human milk on some of its protective constituents. J Pediatr. 1977;90:29-35.

48. Van Zoeren-Grobben D, Schrijver J, Van den Berg H, et al. Human milk vitamin content after pasteurisation, storage, or tube feeding. Arch Dis Child. 1987;62:161-165.

49. Bjorksten B, Burman LG, De Chateau P, et al. Collecting and banking human milk: to heat or not to heat? BMJ. 1980;281:765-769.

50. Morgan JN, Lin FJ, Eitenmiller RR, et al. Thermal destruction of Escherichia coli and Klebsiella pneumoniae in human milk. J Food Prot. 1988;51:132-136.

51. Dhar J, Fichtali J, Skura BJ. Pasteurization efficiency of a HTST system for human milk. J Food Sci. 1996;61:569-573.

52. Guay LA, Musoke P, Fleming T, et al. Intrapartum and neonatal single-dose nevirapine compared with zidovudine for prevention of mother-to-child transmission of HIV-1 in Kampala, Uganda: HIVNET 012 randomised trial. Lancet. 1999;354:795-802.

53. Moodley D, Moodley J, Coovadia H, et al. A multicenter randomized controlled trial of nevirapine versus a combination of zidovudine and lamivudine to reduce intrapartum and early postpartum mother-to-child transmission of human immunodeficiency virus type 1. J Infect Dis. 2003;187:725-735.

54. Leroy V, Karon JM, Alioum A, et al. Twenty-four month efficacy of a maternal short-course zidovudine regimen to prevent mother-to-child transmission of HIV-1 in West Africa. AIDS. 2002;16:631-641.

55. The Petra Study Team. Efficacy of three short-course regimens of zidovudine and lamivudine in preventing early and late transmission of HIV-1 from mother to child in Tanzania, South Africa, and Uganda (Petra study): a randomised, double-blind, placebo-controlled trial. Lancet. 2002;359:1178-1186.

56. Jackson JB, Musoke P, Fleming T, et al. Intrapartum and neonatal single-dose nevirapine compared with zidovudine for prevention of mother-to-child transmission of HIV-1 in Kampala, Uganda: 18-month follow-up of the HIVNET 012 randomised trial. Lancet. 2003;362:859-868.

57. Gaillard P, Fowler MG, Dabis F, et al. Use of antiretroviral drugs to prevent HIV-1 transmission through breast-feeding: from animal studies to randomized clinical trials. J Acquir Immune Defic Syndr. 2004;35:178-187.

58. Wilfert CM, Ammann A, Bayer R, et al. Science, ethics, and the future of research into maternal infant transmission of HIV-1: consensus statement. Lancet North Am Ed. 1999;353:832-835.

59. Coutsoudis A. Infant feeding dilemmas created by HIV: South African experiences. J Nutr. 2005;135:956-959.

60. Rollins N, Meda N, Becquet R, et al. Preventing postnatal transmission of HIV-1 through breast-feeding: modifying infant feeding practices. J Acquir Immune Defic Syndr. 2004;35:188-195.

61. Richardson BA, John-Stewart GC, Hughes JP, et al. Breast-milk infectivity in human immunodeficiency virus type 1-infected mothers. J Infect Dis. 2003;187:736-740.

62. Downs AM, De Vincenzi I. Probability of heterosexual transmission of HIV: relationship to the number of unprotected sexual contacts. European Study Group in Heterosexual Transmission of HIV. J Acquir Immune Defic Syndr Hum Retrovirol. 1996;11:388-395.

Cited By:

This article has been cited 23 time(s).

Journal of Human Lactation
Acceptability of heat treating breast milk to prevent mother-to-child transmission of human immunodeficiency virus in Zimbabwe: A qualitative study
Israel-Ballard, KA; Maternowska, MC; Abrams, BF; Morrison, P; Chitibura, L; Chipato, T; Chirenje, ZM; Padian, NS; Chantry, CJ
Journal of Human Lactation, 22(1): 48-60.
10.1177/0890334405283621
CrossRef
Food Chemistry
Effect of pasteurisation on ascorbic acid, dehydroascorbic acid, tocopherols and fatty acids in pooled mature human milk
Romeu-Nadal, M; Castellote, AI; Gaya, A; Lopez-Sabater, MC
Food Chemistry, 107(1): 434-438.
10.1016/j.foodchem.2007.06.060
CrossRef
AIDS Research and Human Retroviruses
Reverse transcriptase viral load correlates with RNA in SIV/SHIV-infected Macaques
Corrigan, GE; Hansson, EO; Morner, A; Berry, N; Kallander, CFR; Thorstensson, R
AIDS Research and Human Retroviruses, 22(9): 917-923.

Trends in Biotechnology
Humanizing infant milk formula to decrease postnatal HIV transmission
Blais, DR; Altosaar, I
Trends in Biotechnology, 25(9): 376-384.
10.1016/j.tibtech.2007.07.003
CrossRef
Presse Medicale
The challenges of preventing mother-to-child transmission of HIV in Africa
Becquet, R; Leroy, V
Presse Medicale, 36(): 1947-1957.
10.1016/j.Ipm.2007.02.031
CrossRef
Implementation Science
Translating global recommendations on HIV and infant feeding to the local context: the development of culturally sensitive counselling tools in the Kilimanjaro Region, Tanzania
Leshabari, SC; Koniz-Booher, P; Astrom, AN; de Paoli, MM; Moland, KM
Implementation Science, 1(): -.
ARTN 22
CrossRef
Journal of Human Lactation
Effect of Pasteurization on the Bactericidal Capacity of Human Milk
Silvestre, D; Ruiz, P; Martinez-Costa, C; Plaza, A; Lopez, MC
Journal of Human Lactation, 24(4): 371-376.
10.1177/0890334408319158
CrossRef
Journal of Tropical Pediatrics
Bacterial safety of flash-heated and unheated expressed breastmilk during storage
Israel-Ballard, K; Coutsoudis, A; Chantry, CJ; Sturm, AW; Karim, F; Sibeko, L; Abrams, B
Journal of Tropical Pediatrics, 52(6): 399-405.
10.1093/tropej/fml043
CrossRef
Journal of Human Lactation
Heat treating breast milk as an infant feeding option
Israel-Ballard, KA; Chantry, CJ; Dewey, KG; Donovan, RM; Sheppard, HW; Abrams, BF
Journal of Human Lactation, 22(3): 267-268.
10.1177/0890334406290005
CrossRef
Journal of Human Lactation
Heat treating breast milk as an infant feeding option - Response
Hartmann, SU; Berlin, CM; Howett, MK
Journal of Human Lactation, 22(3): 268.

Anales De Pediatria
Breastfeeding by HIV infected mothers in Spain. Is it worthwhile and advisable?
Marti, AM; Lopez-Vilchez, MA; Cottado, JM; Sierra, AM
Anales De Pediatria, 70(5): 506-507.
10.1016/j.anpedi.2009.01.008
CrossRef
Cochrane Database of Systematic Reviews
Interventions for preventing late postnatal mother-to-child transmission of HIV
Horvath, T; Madi, BC; Iuppa, IM; Kennedy, GE; Rutherford, G; Read, JS
Cochrane Database of Systematic Reviews, (1): -.
ARTN CD006734
CrossRef
Pediatric Clinics of North America
Donor Human Milk Banking and the Emergence of Milk Sharing
Landers, S; Hartmann, BT
Pediatric Clinics of North America, 60(1): 247-+.
10.1016/j.pcl.2012.09.009
CrossRef
Pediatric Annals
The Risks and Benefits of Human Donor Breast Milk
Brent, N
Pediatric Annals, 42(5): 84-90.
10.3928/00904481-20130426-11
CrossRef
Journal of Medical Virology
Transient heating of expressed breast milk up to 65 degrees C inactivates HIV-1 in milk: A simple, rapid, and cost-effective method to prevent postnatal transmission
Hoque, SA; Hoshino, H; Anwar, KS; Tanaka, A; Shinagawa, M; Hayakawa, Y; Okitsu, S; Wada, Y; Ushijima, H
Journal of Medical Virology, 85(2): 187-193.
10.1002/jmv.23457
CrossRef
2012 Annual International Conference of the Ieee Engineering in Medicine and Biology Society (Embc)
Novel Device to Conduct Flash-Heat Treatment in Efforts to Reduce Mother-to-Child HIV Transmission in Low-Resource Areas
Suresh, A; Harn, C; Pollack, E; Kroon, M; Poluta, M; Kelso, D; Glucksberg, M
2012 Annual International Conference of the Ieee Engineering in Medicine and Biology Society (Embc), (): 988-991.

Journal of Tropical Pediatrics
How Long Does Flash-Heated Breast Milk Remain Safe for a Baby to Drink at Room Temperature?
Besser, M; Jackson, DJ; Besser, MJ; Goosen, L
Journal of Tropical Pediatrics, 59(1): 73-75.
10.1093/tropej/fms046
CrossRef
Breastfeeding Medicine
Barriers and Promoters of Home-Based Pasteurization of Breastmilk Among HIV-Infected Mothers in Greater Dar es Salaam, Tanzania
Young, S; Leshabari, S; Arkfeld, C; Singler, J; Dantzer, E; Israel-Ballard, K; Mashio, C; Maternowska, C; Chantry, C
Breastfeeding Medicine, 8(3): 321-326.
10.1089/bfm.2012.0044
CrossRef
AIDS
Children and HIV/AIDS: from research to policy and action in resource-limited settings
Orne-Gliemann, J; Becquet, R; Ekouevi, DK; Leroy, V; Perez, F; Dabis, F
AIDS, 22(7): 797-805.
10.1097/QAD.0b013e3282f4f45a
PDF (143) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
Erratum

JAIDS Journal of Acquired Immune Deficiency Syndromes, 41(3): 396.
10.1097/01.qai.0000214821.33905.5c
PDF (88) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
Flash-Heat Inactivation of HIV-1 in Human Milk: A Potential Method to Reduce Postnatal Transmission in Developing Countries
Israel-Ballard, K; Donovan, R; Chantry, C; Coutsoudis, A; Sheppard, H; Sibeko, L; Abrams, B
JAIDS Journal of Acquired Immune Deficiency Syndromes, 45(3): 318-323.
10.1097/QAI.0b013e318074eeca
PDF (109) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
Effect of Flash-Heat Treatment on Immunoglobulins in Breast Milk
Chantry, CJ; Israel-Ballard, K; Moldoveanu, Z; Peerson, J; Coutsoudis, A; Sibeko, L; Abrams, B
JAIDS Journal of Acquired Immune Deficiency Syndromes, 51(3): 264-267.
10.1097/QAI.0b013e3181aa12f2
PDF (99) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
Vitamin Content of Breast Milk From HIV-1-Infected Mothers Before and After Flash-Heat Treatment
Israel-Ballard, KA; Abrams, BF; Coutsoudis, A; Sibeko, LN; Cheryk, LA; Chantry, CJ
JAIDS Journal of Acquired Immune Deficiency Syndromes, 48(4): 444-449.
10.1097/QAI.0b013e31817beb8d
PDF (166) | CrossRef
Back to Top | Article Outline
Keywords:

HIV; breast milk; mother-to-child transmission; pasteurization; heat treatment; perinatal transmission

© 2005 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.