Skip Navigation LinksHome > August 15, 2005 - Volume 39 - Issue 5 > Predominance of a Rare Type of HIV-1 in Estonia
JAIDS Journal of Acquired Immune Deficiency Syndromes:
Epidemiology and Social Science

Predominance of a Rare Type of HIV-1 in Estonia

Adojaan, Maarja MSc*†; Kivisild, Toomas PhD‡; Männik, Andres PhD*; Krispin, Tõnu PhD, Dr. Sci§; Ustina, Valentina PhD∥; Zilmer, Kai MD∥; Liebert, Elo¶; Jaroslavtsev, Nikolai MD#; Priimägi, Ludmilla Dr. Sci, PhD**; Tefanova, Valentina PhD**; Schmidt, Jelena MD††; Krohn, Kai MD, PhD*; Villems, Richard MD, Dr. Sci†‡; Salminen, Mika PhD‡‡; Ustav, Mart PhD*§§

Free Access
Article Outline
Collapse Box

Author Information

From the *FIT Biotech Oyj Plc Eesti, Tartu, Estonia; †Department of Evolutionary Biology, Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia; ‡Estonian Biocentre, Tartu, Estonia; §Institute of Microbiology, University of Tartu, Tartu, Estonia; ∥West-Tallinn Central Hospital Centre for Infectious Diseases, Tallinn, Estonia; ¶Ministery of Justice, Department of Prisons, Tallinn, Estonia; #Prison of Tallinn, Central Hospital of Prisons, Tallinn, Estonia; **National Institute for Health Development, Tallinn, Estonia; ††Puru Hospital, Kohtla-Järve, Estonia; ‡‡HIV-Laboratory, Department of Infectious Disease Epidemiology, National Public Health Institute, Helsinki, Finland; and §§Institute of Technology, University of Tartu, Tartu, Estonia.

Received for publication September 22, 2004; accepted January 3, 2005.

The new sequences have been deposited in the GenBank under the following accession numbers: AY535519-AY535658 (gp41); AY535661-AY535799 (gag/pol) and AY535659-AY535660 (near-full-length genomes).

Reprints: Maarja Adojaan, FIT Biotech Oyj Plc Eesti Nooruse 9, Tartu 50411, Estonia (e-mail: mart.ustav@fitbiotech.com).

Collapse Box

Abstract

An earlier study has indicated that a complex recombinant HIV-1 strain dominates the epidemic in Estonia. The objective of this study was to further investigate the molecular epidemiology and genetic structure of HIV-1 in Estonia. Most of the investigated individuals became infected after August 2000 when HIV-1 started to spread rapidly among Estonian intravenous drug users (IDUs). Two viral DNA regions, gag/pol and gp41, were sequenced and subtyped from peripheral blood mononuclear cells or plasma from 141 individuals. Phylogenetic analysis in the gp41 region revealed that the most frequent type of the virus among IDUs was a circulating recombinant form, CRF06_cpx, whereas a few samples showed highest sequence similarity to a subtype A strain circulating in Ukraine and Russia. Likewise, in the gag/pol region, most of the samples were classified as CRF06_cpx, with a few classified as subtype A. In this region, however, 16% of the sequences turned out to be mosaic unique recombinant forms consisting of CRF06_cpx and subtype A. At least 9 mosaic forms were identified, each with distinct patterns of multiple crossover. To characterize Estonian CRF06_cpx as well as recombinant isolates in more detail, 4 near-full-length HIV-1 genomes were sequenced.

Except for a few N and O group lineages restricted to Africa, most HIV-1 strains share their most recent common ancestor in group M.1 Different subtypes of group M show characteristic geographic patterns in their spread, with subtype C, for example, being a frequent HIV-1 subtype in India, China, Ethiopia, and the southern part of Africa, whereas subtype B has been shown to predominate in Europe, North America, and Australia.2 Subtype A viruses are most prevalent in central and eastern Africa and in eastern European countries constituting the former Soviet Union.3,4 In regions where 2 or more different strains are cocirculating, intersubtype recombination is common. Such recombinant forms can frequently occur in AIDS epidemics and are designated as circulating recombinant forms (CRFs) (for review, see articles by Kahn2 and Peeters5). To date, at least 15 different CRFs have been characterized (http://www.hiv.lanl.gov/content/hiv-db/CRFs/CRFs.html). It has been assumed that CRFs constitute 10% to 20% of newly identified strains; moreover, in some cases, recombination between CRFs has also been reported.6-8 In addition to circulating recombinants, the presence of multiple mosaic viruses that do not fulfill the requirements associated with CRFs has been shown recently; these are called unique recombinant forms (URFs). In some areas, URFs exhibit remarkable diversity with multiple recombination breakpoints.9

The spread of HIV-1 in eastern European countries has been closely linked with the rise of injecting drug use, which increased promptly after the collapse of Soviet Union in the 1990s.10 The HIV-1 epidemic among intravenous drug users (IDUs) started in 1996 in southern Ukraine with subtype A and, to a limited extent, subtype B.11,12 In Estonia, during the 1990s, the reported number of HIV-1 cases was relatively low and the predominant HIV-1 type was B (likewise in other Baltic countries), with a limited distribution of subtypes A, C, D, F, and G as well as CRF02_AG.13,14 For example, in 1999, Estonia reported 96 diagnosed HIV cases, only 4% of which were detected among IDUs. This situation changed drastically in August 2000 when the number of IDU-associated HIV-positive cases started to increase rapidly and comprised nearly 90% of the new HIV cases reported in 2000.15 Most new HIV cases are still associated with IDUs, although the role of heterosexual transmission has gradually risen from less than 10% in 2000 to approximately 33% by the end of 2003 (unpublished data, 2003, AIDS Prevention Center, Tallinn, Estonia). A recently published study has shown a role of recombinant strains for the Estonian epidemic.16

This study was initiated to establish the exact genetic structure of the HIV-1 strains causing the IDU-associated epidemic outbreak of HIV-1 infection in Estonia after August 2000.

Back to Top | Article Outline

MATERIAL AND METHODS

Selection and Preparation of Samples

One hundred forty-one blood samples were obtained from HIV-1-positive individuals. Eighty-seven percent (n = 123) of the samples came from persons who identify themselves as IDUs and were infected during the outbreak of the virus in 2000 through 2003. Six samples belong to long-term patients infected sexually in 1988 through 1994, and 12 samples are from patients who were infected sexually in 2000 through 2003. Sample collection roughly represents the present situation of HIV-1 distribution in Estonia geographically by age, by gender, and by route of transmission. All subjects provided informed consent when giving blood for testing.

The blood samples were collected in BD Vacutainer Cell Preparation Tubes (CPTs; BD Diagnostics, Becton Dickinson, Mountainview, CA), and peripheral blood mononuclear cells (PBMCs) were isolated as buffy coats by density gradient centrifugation. Subsequently, genomic DNA was extracted and purified from the samples using the Qiamp Blood Mini Kit (QIAGEN, Hilden, Germany) in accordance with the manufacturer's instructions. For preparation of the viral genomic RNA, the material from 1 mL of patient plasma was extracted using Qiaquick Viral RNA-kits (QIAGEN) and eluted in 30 μL of sterile RNAse-free water. Two microliters of extracted RNA was translated into complementary DNA (cDNA) using Superscript RT (Stratagene).

Back to Top | Article Outline
Polymerase Chain Reaction and Sequencing

Two proviral genomic regions were selected to identify existing strains and to detect possible recombination events: a 430-base pair (bp) fragment of the gag/pol region (corresponding to 1915-2344 bp in the reference HIV-1 sequence HXB2) and a 387-bp fragment of gp41 (corresponding to 7880-8266 bp in HXB2). Both regions have been shown to contain nucleotide divergence that is sufficient for subtype determination; yet, both are conserved enough to permit the design of conserved primers and to create the DNA sequence alignments.16-20 Nested polymerase chain reaction (PCR) was performed from purified genomic DNA samples using primers bjgag1 (5′TAGAAGAAATGATGACAGCATG3′), bjpol2 (5′TGGCTTTAATTTTACTGGTACAAG3′), msgag7 (5′GATGACAGCATGTCAGGGAG3′), and bjpol3 (5′GTTGACAGGTGTAGGTCCTAC3′) for the gag/pol region, as previously described,16-18,20 and primers gp40F1 (5′TCTTAGGAGCAGCAGGAAGCAGTATGGG3′), gp41R1 (5′AACGACAAAGGTGAGTATCCCTGCCTAA3′), gp46F2 (5′ACAATTATTGTCTGGTATAGTGCAACAGCA3′), and gp47R2 (5′TTAAACCTATCAAGCCTCCTACTATCATTA3′) for the gp41 region, as described in the study by Pieniazek et al.19 Nested PCR was followed by sequencing using the DYEnamic ET Terminator Cycle Sequencing Kit (Amersham Biosciences, Buckinghamshire, United Kingdom).

Amplification of near-full-length proviral genomic DNA was carried out from PBMC genomic DNA samples by nested PCR, resulting in a set of overlapping DNA fragments. The following primers were used: gag-region nef1 (5′CAAGGGACTTTCCGCTGGGGAC3′), jupp1f (5′CTCGAAAGCGAAAGTTCCAGAG3′), jupp1r (5′ATTTGCATAGCTGCCTGGTGTC3′), and gagakr (5′GTGTAGCTGCTGGTCCTAATGC3′); pol-region jupp3f (5′GGAGCAGATGATACAGTATTAGAAG3′), jupp3r (5′CCATGTATTGATAGATCACCATTTC3′), xfow (5′CTTCCACAGGGATGGAAAGG3′), and yrev (5′TGCTCCTACTATGGGCTCTG3′); accessory gene-region afow (5′CCCTAGTCTGGCAGACCAAC3′) and brev (5′GGGTACACAAGCATGTGTAG3′); env-region jupp8r (5′GTTAATAGTAGTCCTGTAATGTTTG3′), jupp9f (5′GAATAACATGACCTGGATAGAATG3′), and jupp9r (5′TGGTCTTAAAGGCACCTGAG3′); and nef-region nefy (5′ATGGGTGGCAAGTGGTCAAA3′) and nef1 (5′CAAGGGACTTTCCGCTGGGGAC3′). PCR products were cloned into pTZ57R/T or pUC18 vector and sequenced using M13F24 and M13R22 universal sequencing primers (MBI Fermentas, Vilnius, Lithuania). As a next step, the obtained fragments were assembled into contiguous sequences.

From reverse-transcribed viral genomic RNA samples, virtually the entire genome was further amplified by nested PCR into 4 segments using the following primers: gag-region f12 (5′AAATCTCTAGCAGTGGCGCCCGAACAG3′), f14 (5′TCTCTCGACGCAGGACTCGGCTTG3′), G40 (5′GACTAGCGGAGGCTAGAAG3′), BJGAG3 (5′TCCCTAAAAAATTAGCCTGTC3′), BJPOL2 (5′TGGCTTTAATTTTACTGGTACAG3′), and BJPOL3 (5′GTTGACAGGTGTAGGTCCTAC3′); pol-region MSGAG7 (5′GATGACAGCATGTCAGGGAG3′), Int3′-1 (5′CAATCATCACCTGCCATCTG3′), pol5′-2 (5′CCCCTAGRAAAAAGGGYTGT3′), and pol3′-11 (5′GGRTCTCTGCTGTCYCTGTAA3′); accessory gene-region vif-vpu5′out (5′ATCCCCAAAGYCAAGGAGTA3′), vif-vpu3′out (5′TCCAYACAGGYACCCCATA3′), vif-vpu5′in (5′GACAGCAGTACARATGGCAG3′), and vif-vpu3′in (5′CTCTCATTGCCACTRTCYTC3′); and env-region JL86 (5′TGCTGTTTATTCATTTCAGAATTGG3′), JL89 (5′TCCAGTCCCCCCTTTTCTTTTAAAAA3′), JL88 (5′TAAGTCATTGGTCTTAAAGGTACCTG3′), and ed3 (5′TTAGGCATCTCCTATGGCAGGAAGAAGCGG3′). PCR products were directly sequenced after Qiaquick PCR cleanup-kit (QIAGEN) purification and primer walking using Bigdye 3.0 fluorescent terminator sequencing chemistry (Applied Biosystems) and the inner PCR primers. Fragments were assembled into contiguous genome sequences.

Back to Top | Article Outline
Sequence Analysis

Sequence data were aligned using BioEdit Sequence Alignment Editor,21 version 5.0.9, (T. Hall, 2001; distributed by the author) and Align Plus 5, version 5.01 (Scientific & Educational Software) software. The alignments were corrected manually and subjected to a basic local alignment search tool (BLAST) search against the HIV database (http://www.hiv.lanl.gov/content/hiv-db/BASIC_BLAST/basic_blast.html). Informative sites were determined, and phylogenetic analysis was carried out using a Kimura 2-parameter 22 model and neighbor-joining (NJ) approach23 with 1000 bootstrap replications in Molecular Evolutionary Genetics Analysis, version 2, software (MEGA2).24

For identification of intersubtype recombination breakpoints, a bootscanning analysis25 was carried out using SimPlot,26 version 2.5 (S. C. Ray, 1999; distributed by the author) and PHYLIP (Phylogeny Inference Package),27 version 3.5c (J. Felsenstein, 1993; distributed by the author) software.

Back to Top | Article Outline

RESULTS

gp41 Region

As represented in Figure 1A, the phylogenetic tree based on the gp41 region grouped most (n = 131) of the Estonian isolates from recently infected individuals together in a single lineage cluster with low pairwise genetic nucleotide diversity (d = 0.003 ± 0.001), supported by a high bootstrap value (see group I in Fig. 1A). A BLAST search of the sequences of this cluster gave highest similarity with CRF06_cpx type HIV-1 sequences. Consistent with this, 4 known CRF06_cpx sequences and several subtype G sequences (the CRF06_cpx shows similarity to G-type sequences in the gp41 region selected) were closely related to the Estonian isolates.

Figure 1
Figure 1
Image Tools

The remaining sequences from recent infections (n = 4) clustered with subtype A sequences (see group II in Fig. 1A). All Estonian subtype A-like sequences (d = 0.015 ± 0.005) demonstrated remarkable similarity with a subtype A sequence isolate (98UA0116) derived from Ukraine. Closely related variants of this isolate and recombinants derived from it are thought to be responsible for the explosive epidemic among a large number of Ukrainian IDUs since 1996.3,12,28,29 As expected, the samples of long-term patients (n = 6) grouped together with subtype B reference sequences (d = 0.047 ± 0.007; see group III in Fig. 1A).

Back to Top | Article Outline
gag/pol Region

The NJ tree constructed from the gag/pol sequences revealed the existence of 3 distinct clades with substantial bootstrap support among Estonian samples (see Fig. 1B). Most (93%) of the gag/pol lineages again showed the highest similarity with the CRF06_cpx and subtype G sequences (CRF06_cpx also has a subtype G-like sequence in the gag/pol region), whereas the remaining few sequences clustered together with subtype A and B reference sequences. Two distinct groups of isolates could be distinguished on the tree within the major CRF06_cpx clade (see groups IA and IB in Fig. 1B). The first group, including most of the sequences (n = 108), was composed of highly homogeneous lineages with an average pairwise genetic distance (d = 0.008 ± 0.001; see group IA in Fig. 1B). In 8 sequences showing long branch lengths (083, K19, 041, K5, K35, TV44, TV5, and TV77) a G-to-A hypermutation pattern was observed.

The second group in CRF06_cpx clade (see group IB in Fig. 1B) comprises a diverse set of sequences (d = 0.019 ± 0.004). An initial BLAST search and alignment of these sequences exposed their mosaic structure in the gag/pol region resembling subtype A in the first part of the segment and CRF06_cpx in the second. For a more detailed analysis, 2 consensus sequences were generated: the first from the Estonian homogeneous cluster of CRF06_cpx-like sequences (see group IA in Fig. 1B) and the second from the Estonian subtype A-like sequences (see group II in Fig. 1B). Comparison of the mosaic gag/pol sequences at the positions where the 2 consensus sequences differed revealed the presence of multiple different types of mosaic forms, with each type showing a different pattern of potential crossover points. Sequences that differed from each other by less than 3 consecutive character changes were grouped together, defining 9 different groups (Fig. 2).

Figure 2
Figure 2
Image Tools

Four sequences in the gag/pol region and 4 sequences in the gp41 region of Estonian IDU samples showed high sequence homology with subtype A. Interestingly, among these, there were 3 samples that showed homology with subtype A in the gag/pol region clustered together with CRF06_cpx-type sequences in the gp41 region, and vice versa. Only 1 isolate, EST2002-394, showed a subtype A sequence in both regions (see Fig. 1; Table 1).

Table 1
Table 1
Image Tools

The long-term sexually infected patients formed an independent group (d = 0.043 ± 0.005) intermingling with similar B lineages uncovered elsewhere in Europe (see group 3 in Fig. 1B). All sequences (n = 12) from sexually infected individuals who were infected with HIV after August 2000 showed the highest similarity to CRF06_cpx sequences in the gag/pol and gp41 regions.

Back to Top | Article Outline
Near-Full-Length Genomes

To study the more prevalent Estonian HIV-1 forms in more detail, 2 representative HIV-1 near-full-length proviral genomes (EE0359 as a common variant among Estonian IDUs and EE0369 as a putative new recombinant form) were sequenced. Two additional nearly complete sequences were generated from viral genomic RNA by reverse transcriptase PCR from samples EST2002-1169 (another putative recombinant form) and EST2002-394 (subtype A according to gag/pol and gp41 sequences).

An NJ tree of these sequences (samples EE0359, EE0369, and EST2002-1169), together with CRF06_cpx reference genomes, is shown in Figure 3. In contrast to the other sequences, the EST2002-394 isolate clustered with eastern European subtype A sequences. The results of the bootscanning analyses confirmed that 2 of the 4 sequences (isolates EE0369 and EST2002-1169) were recombinants between subtype A and CRF06_cpx. They both share a similar structure, CRF06_cpx/A/CRF06_cpx (Fig. 4), belonging to recombinant form type 4 (see Fig. 2). When subjected to the BLAST search, the approximately 900-bp fraction of the subtype A-like sequence showed remarkable similarity to several subtype A and CRF03_AB forms of HIV-1 isolated from Ukraine, Russia, and Belarus.

Figure 3
Figure 3
Image Tools
Figure 4
Figure 4
Image Tools
Back to Top | Article Outline

DISCUSSION

As previously has been reported, this study confirms that a rare CRF of HIV-1, CRF06_cpx, is predominant in the population of Estonian HIV-1-positive individuals.16 CRF06_cpx is a complex mosaic form of the virus composed of successive fragments of subtypes A, G, K, and J and shows similarity to G sequences in the selected gp41 and gag/pol regions.30,31 Four near-full-length genomes of CRF06_cpx have been sequenced previously.30,32,33 All originated in West Africa, whereas sequencing of shorter fragments has reveled that this virus variant has also been introduced to other continents (at least to Europe and Australia). Although CRF06_cpx is spreading in different countries, its prevalence has been documented to be low.5,31,32

Studies carried out in the 1990s determined subtype B to be a predominant form of HIV-1 in the Estonian population.13,14 In accordance with the NJ tree based on the gp41 or gag/pol region, individuals with a long history of infection formed an independent group intermingling with similar B lineages uncovered elsewhere in Europe (see group III in Fig. 1A, B). This finding, as well as the highest genetic diversity of this clade in Estonians, possibly suggests that the B lineages in Estonia do not derive from a single recent founder-a conclusion consistent with this population's medical histories tracing back 10 years or longer.

The data presented here, and in an earlier study, demonstrate that the burst of the IDU-associated epidemic outbreak of HIV-1 infection since 2000 coincides with the drastic shift in genetic structure of HIV-1 in Estonia.16 The phenomenon that the beginning of a new epidemic or change in the epidemic pattern is frequently accompanied by a change in the molecular structure of the virus has been observed in Thailand, Uruguay, Argentina, and South Africa, for example.34-36 In Estonia, the new epidemic is among IDUs as opposed to sexually exposed people. The CRF06_cpx-like IDU virus isolates that are circulating in Estonia form a remarkably homogeneous cluster with an average pairwise genetic distance (d) of 0.003 ± 0.001 in the gp41 region, which is more than 10-fold lower than the average distance between Estonian B isolates (0.047 ± 0.007). This finding also suggests a recent introduction of the CRF06_cpx strain to Estonia, probably through a single carrier. Because of the small number of available reference sequences from geographically remote areas, the significant difference of our sequences from other CRF06_cpx isolates comes as no surprise. Hence, the origin of the CRF06_cpx lineage in Estonia remains unknown until other isolates with higher sequence similarity are found. The remarkably high incidence of a single particular lineage with low genetic variability in Estonia is consistent with the country's small area, population size, and transmission type.

A high incidence of different recombinant forms in the Estonian IDU population indicates that coinfection with different strains of HIV-1 occurs frequently among drug users. The fact that 1 particular type (type 4, see Fig. 2) comprises one third of all unique recombinant forms in Estonia, supported by data on 2 full-length and 6 partial sequences with the same recombinant structure, allows us to designate this as the emergence of a new CRF. It is noteworthy that the crossover sites of Estonian gag/pol URFs correspond to the genomic region (5′ end of pol) of HIV-1, which has been characterized as a recombination “hot spot”.37,38 As summarized in Table 1, in many individuals, discordant results of subtype determination became obvious between gag/pol and gp41 sequence data. In principle, this finding could reflect the existence of additional recombinant forms or the presence of 2 circulating strains in a single individual. Although a crossover site (gag/pol CRF06_cpx/A, gp41 CRF06_cpx) was detected inside sequenced regions for 23 samples, the presence and exact location of the recombination spot in 4 samples with discordant phylogenetic affiliations in the gp41 and gag/pol regions (see Table 1) remained outside the sequenced regions.

To conclude, first, we have confirmed the predominance of a rare HIV-1 form, CRF06_cpx, in the Estonian HIV-1-infected population. This is in strong association with the rapid spread of intravenous drug use. Second, we report the first complete CRF_06cpx-type provirus sequence in Europe. More data from Eastern Europe are needed to trace the origin and trafficking of the unusual HIV-1 subtype. Finally, a high proportion of the Estonian variants in gag/pol sequences were shown to fall into multiple types of CRF06/subtype A mosaics. A high frequency of some of the newly described unique recombinant types suggests that they may contribute to the pool of circulating genetic forms of HIV-1 in Estonia and neighboring countries.

Back to Top | Article Outline

ACKNOWLEDGMENTS

The authors thank Jüri Parik for his advice and helpful discussions throughout the course of this study and Jaan Lind for excellent technical assistance. We are grateful to Katrin Kaldma, Tiit Talpsep, Olev Lumiste, and Tartu University Hospital Blood Center personnel for their kind help. The authors thank Michael Tristem for support in preparing the manuscript. This work was partially funded by basic research grant 0182566503 from the Estonian government.

Back to Top | Article Outline

REFERENCES

1. Vidal N, Peeters M, Mulanga-Kabeya C, et al. Unprecedented degree of human immunodeficiency virus type 1 (HIV-1) group M genetic diversity in the Democratic Republic of Congo suggests that the HIV-1 pandemic originated in Central Africa. J Virol. 2000;74:10498-10507.

2. Kahn P. Do clades matter for HIV vaccines? International AIDS Vaccine Initiative Report. 2003;7:1-16.

3. Bobkov A, Cheingsong-Popov R, Selimova L, et al. An HIV type 1 epidemic among injecting drug users in the former Soviet Union caused by a homogeneous subtype A strain. AIDS Res Hum Retroviruses. 1997;13:1195-1201.

4. Ferdats A, Konicheva V, Dievberna I, et al. An HIV type 1 subtype A outbreak among injecting drug users in Latvia. AIDS Res Hum Retroviruses. 1999;15:1487-1490.

5. Peeters M. Recombinant HIV sequences: their role in the global epidemic. In: Kuiken CL, Foley B, Hahn B, et al, eds. HIV Sequence Compendium 2000. Los Alamos: Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, 2000;I-39-I-54.

6. Korber B, Gaschen B, Yusim K, et al. Evolutionary and immunological implications of contemporary HIV-1 variation. Br Med Bull. 2001;58:19-42.

7. Yang R, Kusagawa S, Zhang C, et al. Identification and characterization of a new class of human immunodeficiency virus type 1 recombinants comprised of two circulating recombinant forms, CRF07_BC and CRF08_BC, in China. J Virol. 2003;77:685-695.

8. Thomson MM, Delgado E, Herrero I, et al. Diversity of mosaic structures and common ancestry of human immunodeficiency virus type 1 BF intersubtype recombinant viruses from Argentina revealed by analysis of near full-length genome sequences. J Gen Virol. 2002;83:107-119.

9. Takebe Y, Motomura K, Tatsumi M, et al. High prevalence of diverse forms of HIV-1 intersubtype recombinants in Central Myanmar: geographical hot spot of extensive recombination. AIDS. 2003;17:2077-2087.

10. Hamers FF, Downs AM. HIV in central and eastern Europe. Lancet. 2003;361:1035-1044.

11. Nabatov AA, Kravchenko ON, Lyulchuk MG, et al. Simultaneous introduction of HIV type 1 subtype A and B viruses into injecting drug users in southern Ukraine at the beginning of the epidemic in the former Soviet Union. AIDS Res Hum Retroviruses. 2002;18:891-895.

12. Naganawa S, Sato S, Nossik D, et al. First report of CRF03_AB recombinant HIV type 1 in injecting drug users in Ukraine. AIDS Res Hum Retroviruses. 2002;18:1145-1149.

13. Liitsola K, Laukkanen T, Denisova A, et al. Genetic characterization of HIV-1 strains in the Baltic countries and Russia. Scand J Infect Dis. 1996;28:537-541.

14. Ustina V, Zilmer K, Tammai L, et al. Epidemiology of HIV in Estonia. AIDS Res Hum Retroviruses. 2001;17:81-85.

15. Uusküla A, Kalikova A, Zilmer K, et al. The role of injection drug use in the emergence of human immunodeficiency virus infection in Estonia. Int J Infect Dis. 2002;6:23-27.

16. Zetterberg V, Ustina V, Liitsola K, et al. Two viral strains and a possible novel recombinant are responsible for the injecting drug use-associated HIV-epidemic in Estonia. AIDS Res Hum Retroviruses. 2004;20:1148-1156.

17. Liitsola K, Holmstrom P, Laukkanen T, et al. Analysis of HIV-1 genetic subtypes in Finland reveals good correlation between molecular and epidemiological data. Scand J Infect Dis. 2000;32:475-480.

18. Laukkanen T, Liitsola K, Salminen M, et al. HIV-1 D subtype viruses in Finland. Clin Diagn Virol. 1996;5:205-210.

19. Pieniazek D, Yang C, Lal RB. Phylogenetic analyses of gp41 envelope of HIV-1 groups M, N, and O strains provide an alternate region for subtype determination. In: Korber B, Kuiken CL, Foley B, et al, eds. Human Retroviruses and AIDS. Los Alamos: Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, 1998;III-112-III-117.

20. Salminen M. Rapid and simple characterization of in vivo HIV-1 sequences using solid-phase direct sequencing. AIDS Res Hum Retroviruses. 1992;8:1733-1742.

21. Hall T. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999;41:95-98.

22. Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 1980;16:111-120.

23. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406-425.

24. Kumar S, Tamura K, Jakobsen IB, et al. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics. 2001;17:1244-1245.

25. Salminen MO, Carr JK, Burke DS, et al. Identification of breakpoints in intergenotypic recombinants of HIV type 1 by bootscanning. AIDS Res Hum Retroviruses. 1995;11:1423-1425.

26. Lole KS, Bollinger RC, Paranjape RS, et al. Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination. J Virol. 1999;73:152-160.

27. Felsenstein J. PHYLIP: Phylogeny Inference Package (version 3.2). Cladistics. 1989;5:164-166.

28. Liitsola K, Tashkinova I, Laukkanen T, et al. The explosive IDU associated HIV-1 epidemic in Kaliningrad is caused by a subtype A/B recombinant strain. AIDS. 1998;12:1907-1919.

29. Masharsky AE, Klimov NA, Kozlov AP. Molecular cloning and analysis of full-length genome of HIV type 1 strains prevalent in countries of the former Soviet Union. AIDS Res Hum Retroviruses. 2003;19:933-939.

30. Montavon C, Bibollet-Ruche F, Robertson D, et al. The identification of a complex A/G/I/J recombinant HIV type 1 virus in various West African countries. AIDS Res Hum Retroviruses. 1999;15:1707-1712.

31. Montavon C, Toure-Kane C, Nkengasong JN, et al. CRF06-cpx: a new circulating recombinant form of HIV-1 in West Africa involving subtypes A, G, K, and J. J Acquir Immune Defic Syndr. 2002;29:522-530.

32. Oelrichs RB, Workman C, Laukkanen T, et al. A novel subtype A/G/J recombinant full-length HIV type 1 genome from Burkina Faso. AIDS Res Hum Retroviruses. 1998;14:1495-1500.

33. Triques K, Bourgeois A, Vidal N, et al. Near-full-length genome sequencing of divergent African HIV type 1 subtype F viruses leads to the identification of a new HIV type 1 subtype designated K. AIDS Res Hum Retroviruses. 2000;16:139-151.

34. Tovanabutra S, Beyrer C, Sakkhachornphop S, et al. The changing molecular epidemiology of HIV type 1 among northern Thai drug users, 1999 to 2002. AIDS Res Hum Retroviruses. 2004;20:465-475.

35. Hierholzer J, Montano S, Hoelscher M, et al. Molecular epidemiology of HIV type 1 in Ecuador, Peru, Bolivia, Uruguay, and Argentina. AIDS Res Hum Retroviruses. 2002;18:1339-1350.

36. Puren AJ. The HIV- 1 epidemic in South Africa. Oral Dis. 2002;8(Suppl 2):27-31.

37. Jetzt AE, Yu H, Klarmann GJ, et al. High rate of recombination throughout the human immunodeficiency virus type 1 genome. J Virol. 2000;74:1234-1240.

38. Zhuang J, Jetzt AE, Sun G, et al. Human immunodeficiency virus type 1 recombination: rate, fidelity, and putative hot spots. J Virol. 2002;76:11273-11282.

Cited By:

This article has been cited 14 time(s).

Plos One
CCR5 Haplotypes Influence HCV Serostatus in Caucasian Intravenous Drug Users
Huik, K; Avi, R; Carrillo, A; Harper, N; Pauskar, M; Sadam, M; Karki, T; Krispin, T; Kongo, UK; Jermilova, T; Ruutel, K; Talu, A; Abel-Ollo, K; Uuskula, A; Ahuja, SK; He, WJ; Lutsar, I
Plos One, 8(7): -.
ARTN e70561
CrossRef
Virologie
Origin and genetic diversity of the Human Immunodeficiency Virus: where does it come from, where is it going?
Peeters, M; Chaix, ML
Virologie, 17(3): 119-131.

AIDS Research and Human Retroviruses
Distinct HIV Type 1 Strains in Different Risk Groups and the Absence of New Infections by Drug-Resistant Strains in Lithuania
Caplinskas, S; Loukachov, VV; Gasich, EL; Gilyazova, AV; Caplinskiene, I; Lukashov, VV
AIDS Research and Human Retroviruses, 29(4): 732-737.
10.1089/aid.2012.0312
CrossRef
AIDS Reviews
Molecular epidemiology of HIV-1 variants in the global aids pandemic: an update
Thomson, MM; Najera, R
AIDS Reviews, 7(4): 210-224.

AIDS Research and Human Retroviruses
Identification and Characterization of CRF02_AG, CRF06_cpx, and CRF09_cpx Recombinant Subtypes in Mali, West Africa
Imamichi, H; Koita, O; Dabitao, D; Dao, S; Ibrah, M; Sogoba, D; Dewar, RL; Berg, SC; Jiang, MK; Parta, M; Washington, JA; Polis, MA; Lane, HC; Tounkara, A
AIDS Research and Human Retroviruses, 25(1): 45-55.
10.1089/aid.2008.0111
CrossRef
Journal of Medical Virology
Absence of Genotypic Drug Resistance and Presence of Several Naturally Occurring Polymorphisms of Human Immunodeficiency Virus-1 CRF06_cpx in Treatment-Naive Patients in Estonia
Avi, R; Huik, K; Sadam, M; Karki, T; Krispin, T; Ainsalu, K; Paap, P; Schmidt, J; Nikitina, N; Lutsar, I
Journal of Medical Virology, 81(6): 953-958.
10.1002/jmv.21482
CrossRef
Infection Genetics and Evolution
Multiple HIV-1 introductions into the Swedish intravenous drug user population
Skar, H; Sylvan, S; Hansson, HB; Gustavsson, O; Boman, H; Albert, J; Leitner, T
Infection Genetics and Evolution, 8(5): 545-552.
10.1016/j.meegid.2008.03.004
CrossRef
AIDS Research and Human Retroviruses
High prevalence of the CCR5 Delta 32 HIV-resistance mutation among Estonian HIV type 1-infected individuals
Adojaan, M; Molder, T; Mannik, A; Kivisild, T; Villems, R; Krispin, T; Ustav, M
AIDS Research and Human Retroviruses, 23(2): 193-197.
10.1089/aid.2006.0113
CrossRef
Journal of Infectious Diseases
CCL3L1 Copy Number Is a Strong Genetic Determinant of HIV Seropositivity in Caucasian Intravenous Drug Users
Huik, K; Sadam, M; Karki, T; Avi, R; Krispin, T; Paap, P; Ruutel, K; Uuskula, A; Talu, A; Abel-Ollo, K; Lutsar, I
Journal of Infectious Diseases, 201(5): 730-739.
10.1086/650491
CrossRef
Biostatistics
StepBrothers: inferring partially shared ancestries among recombinant viral sequences
Bloomquist, EW; Dorman, KS; Suchard, MA
Biostatistics, 10(1): 106-120.
10.1093/biostatistics/kxn019
CrossRef
Journal of Infectious Diseases
Increasing HIV-1 genetic diversity in Europe
Thomson, MM; Najera, R
Journal of Infectious Diseases, 196(8): 1120-1124.
10.1086/521683
CrossRef
AIDS Research and Human Retroviruses
HIV epidemiology in the northwestern Federal District of Russia: Dominance of HIV type 1 subtype A
Smolskaya, T; Liitsola, K; Zetterberg, V; Golovanova, E; Kevlova, N; Konovalova, N; Sevastianova, K; Brummer-Korvenkontio, H; Salminen, M
AIDS Research and Human Retroviruses, 22(): 1074-1080.

JAIDS Journal of Acquired Immune Deficiency Syndromes
Identification of a Novel Second-Generation Circulating Recombinant Form (CRF48_01B) in Malaysia: A Descendant of the Previously Identified CRF33_01B
Li, Y; Tee, KK; Liao, H; Hase, S; Uenishi, R; Li, X; Tsuchiura, T; Yang, R; Govindasamy, S; Yong, YK; Tan, HY; Pybus, OG; Kamarulzaman, A; Takebe, Y
JAIDS Journal of Acquired Immune Deficiency Syndromes, 54(2): 129-136.
10.1097/QAI.0b013e3181d82ce5
PDF (718) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
Molecular Epidemiology of HIV-1 in St Petersburg, Russia: Predominance of Subtype A, Former Soviet Union Variant, and Identification of Intrasubtype Subclusters
Thomson, MM; Vinogradova, A; Delgado, E; Rakhmanova, A; Yakovlev, A; Cuevas, MT; Muñoz, M; Pinilla, M; Vega, Y; Pérez-Álvarez, L; Osmanov, S; Nájera, R
JAIDS Journal of Acquired Immune Deficiency Syndromes, 51(3): 332-339.
10.1097/QAI.0b013e31819c1757
PDF (235) | CrossRef
Back to Top | Article Outline
Keywords:

circulating recombinant form CRF06_cpx; intravenous drug users; unique recombinant forms

© 2005 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.