Skip Navigation LinksHome > August 15, 2005 - Volume 39 - Issue 5 > Outbreak of a West African Recombinant of HIV-1 in Tashkent,...
JAIDS Journal of Acquired Immune Deficiency Syndromes:
Epidemiology and Social Science

Outbreak of a West African Recombinant of HIV-1 in Tashkent, Uzbekistan

Carr, Jean K*; Nadai, Yuka*; Eyzaguirre, Lindsay*; Saad, Magdi D†; Khakimov, Mumtaz M‡; Yakubov, Shavkat K‡; Birx, Deborah L§; Graham, R Ross†; Wolfe, Nathan D∥; Earhart, Kenneth C†; Sanchez, Jose L§

Free Access
Article Outline
Collapse Box

Author Information

From the *US Military HIV Research Program, Henry M. Jackson Foundation, Rockville, MD; †Navy Medical Research Unit-3, Cairo, Egypt; ‡National AIDS Center, Tashkent, Uzbekistan; §US Military HIV Research Program, Walter Reed Army Institute of Research, Rockville, MD; and ∥Bloomberg School of Public Health, Johns Hopkins University, Baltimore, MD.

Received for publication May 19, 2004; accepted December 14, 2004

Supported by funds provided by the US Naval Medical Research and Development Command, Silver Spring, MD, Work Unit No. 62787A 873 H B0002, and by a cooperative agreement between the Henry M. Jackson Foundation and the US Department of Defense.

The views and opinions expressed herein do not necessarily reflect those of the US Army, the US Navy, or the Department of Defense.

Reprints: Jean K. Carr, Henry M. Jackson Foundation, 1 Taft Court, Suite 250, Rockville, MD 20850 (e-mail: jcarr@hivresearch.org).

Collapse Box

Abstract

Objectives: This research describes the genetic diversity of HIV-1 in Uzbekistan.

Methods: During 2002 and 2003, blood from HIV-positive patients in Uzbekistan was collected, and part of the proviral pol gene and nearly full-length genomes were sequenced and analyzed.

Results: Among 142 Uzbek strains, most clustered genetically with the subtype A strain common in the former Soviet Union. Most of these subtype A-infected drug-naive subjects (65.6%) had an accessory drug resistance mutation, A62V, in the reverse transcriptase gene. Thirteen of the strains (9.2%) clustered with CRF02_AG, an HIV strain common in West Africa. People infected with CRF02_AG were all residents of Tashkent and sampled in 2002. The CRF02_AG strains were monophyletic and probably descended from a single ancestor. Two strains were recombinant between CRF02_AG and subtype A, with each having a different subtype structure. The CRF02_AG and the subtype A elements of the recombinants were monophyletic with Uzbek CRF02_AG and subtype A. New full-length genomes of 12 Uzbek strains suggested that neither the subtype A and nor the CRF02_AG strains in this epidemic were mosaics with other subtypes or circulating recombinant forms.

Conclusion: A genetic analysis of Uzbek HIV strains demonstrated the predominance of subtype A in the epidemic. An outbreak of a West African strain of HIV-1, CRF02_AG, occurred in Tashkent, Uzbekistan in 2002, however. The cocirculation of the 2 strains has resulted in new recombinants that are apparently unique to Uzbekistan.

The HIV epidemic in former Soviet Union (FSU) countries is growing faster than it is in any other geographic region of the world, although it began there less than a decade ago.1-3 Between 1995 and 2001, the region reported one of the highest annual growth rates in HIV-infected cases; current estimates are that 1.2 to 1.8 million infected persons live in this region.2,3 Most transmission occurs among injecting drug users (IDUs) over a broad geographic area from Riga, Latvia in the west to Irkutsk, Russia in the east.4,5 An analysis of the molecular epidemiology demonstrates, however, that this is a single interconnected epidemic.6,7 Although HIV was initially concentrated in IDU networks, it is now spreading into heterosexual populations in several locations, such as Ukraine and the Russian Federation.7-9

The genetic diversity of HIV-1 is extensive because of error-prone reverse transcription and recombination.10 Worldwide, HIV-1 can be classified into 9 genetic subtypes and 2 sub-subtypes.11 Recombination between subtypes has generated many circulating recombinant forms (CRFs), with recombinants of defined structure spreading in populations; 17 different CRFs have already been identified.11 The 2 most important in the pandemic are the Southeast Asian CRF01_AE and the West African CRF02_AG.12,13

The HIV-1 genetic subtype infecting people in the FSU is, somewhat surprisingly, subtype A, otherwise common only in Africa.7,14,15 This distinguishes the epidemic from that in Europe, where subtype B is most common. Additionally, the strain of subtype A in the FSU is monophyletic, suggesting a common ancestor for all strains; this molecular form of subtype A is called FSU-A.16 Furthermore, the interstrain genetic diversity in the epidemic is unusually low even though the FSU epidemic has been growing for nearly a decade and covers an enormous geographic area.4,6

The epidemic in Uzbekistan, still nascent, is concentrated among IDU networks, where there was an exponential rise in prevalence between 2001 and 2002.7 As such, it is a prototypic “concentrated” epidemic. To date, the genetic subtypes in Uzbekistan have been predominantly FSU-A, with a minority of subtypes B and D.7 The current report documents an outbreak of CRF02_AG, a West African virus, in Tashkent, Uzbekistan in 2002.

Back to Top | Article Outline

METHODS

Study Subjects

After receiving informed consent, blood was drawn from HIV-positive patients at the National AIDS Center in Tashkent, Uzbekistan in 2002 and 2003. Blood was collected in CPT™ vacutainer tubes (Becton Dickinson), and the peripheral blood mononuclear cells (PBMCs) were purified, washed, and then frozen in 95% ethanol at −20°C. Cells were sent to the Navy Medical Research Unit No. 3 (NAMRU-3) in Cairo, Egypt for DNA extraction using QIAamp (QIAgen, Valencia, CA). Under a different study protocol, samples were also collected from residents of rural villages in Cameroon and processed using the same procedures as were used for Uzbek samples.

Back to Top | Article Outline
Genotyping

Partial pol polymerase chain reaction (PCR) amplification from PBMC DNA was performed on a convenience sample of 142 using a nested strategy. The first-round amplification was done with 2 primers: Pro5F (5′-AGAAATTGCAGGGCCCCTAGGAA) and RT3474R (5′-GAATCTCTCTGTTTTCTGCCAG), using Amplitaq Gold (Applied Biosystems, Foster City, CA) and 2 mM of MgCl++ in a total volume of 50 μL. The second-round amplification was completed using the following 2 primers: Pro3F (5′- AGAICAGAGCCAACAGCCCCACCA) and ProRT (5′- TTTCCCCACTAACTTCTGTATGTCATTGACA). Both amplification reactions began with a “hot start” to activate the polymerase, followed by 45 cycles for 30 seconds at 94°C, 30 seconds at 55°C, and 1.5 minutes at 55°C. The amplicon contained the coding sequences for the protease protein and part of the reverse transcriptase (RT) protein, corresponding to nts 2253 through 3266 on HXB-2 (Genbank Accession No. K03455). Nearly full-length genome sequences were also amplified, and all were sequenced in the Applied Biosystems 3100 automated sequencer using Big Dye terminators (Applied Biosystems).17,18

Back to Top | Article Outline
Analysis

A multiple alignment of the newly derived protease/RT sequences and full-length genome sequences with selected reference sequences was constructed, consisting of 1069 nts and 9914 nts, respectively. Phylogenetic trees were generated, and the consistency of branching order was evaluated using SEQBOOT, DNADIST, NEIGHBOR, and CONSENSE modules of the Phylogeny Inference Package (V3.52c).19 Recombinant analysis used Simplot, version 3.4,20 and alignment examination determined precise breakpoints.13,21 After breakpoint identification, each segment was extracted and analyzed phylogenetically to confirm the assignment of subtype; breakpoint locations were designated relative to HXB-2 (Genbank Accession No. K03455). The Kimura 2-parameter method was used to calculate pairwise genetic distances after removal of hypermutated strains. Analysis of the protease-RT sequences for mutations that might lead to resistance to antiretroviral drugs was also performed.22

Back to Top | Article Outline
Nucleotide Sequence

Sequences from Uzbekistan were submitted to Genbank under accession numbers AY845716 through AY845857 (partial pol) and AY829203 through AY829214 (nearly full length) and those from Cameroon under AY847362 through AY847453 (partial pol).

Back to Top | Article Outline

RESULTS

There were 142 partial pol sequences of HIV-1 from Uzbekistan and 12 nearly full-length genome sequences. Most of the samples were collected in 2002 (72.5%) and were from male subjects (90.6%), IDUs (84.8%), and residents of the capital, Tashkent (64.6%) (Table 1). Phylogenetic analysis of the sequences revealed that the strains were mostly subtype A (88.0%) and clustered with 97BL006 from Belarus (Fig. 1).23 This phylogenetic cluster of subtype A (FSU-A) has only been found in the FSU and not yet in any part of Africa (see Fig. 1).18 In addition to the subtype A strains, a significant minority were CRF02_AG (9.2%), a CRF common in West and West Central Africa and unexpected in Uzbekistan.7,12

Table 1
Table 1
Image Tools
Figure 1
Figure 1
Image Tools

There were also 2 subtype B strains and 2 strains (02UZ813, 02UZ678) that clustered neither with other strains nor with each other. These strains proved to be recombinants between CRF02_AG and FSU-A. 02UZ813 was predominantly CRF02_AG, whereas UZ678 was predominantly subtype A (Fig. 2). The subtype analysis showed that the subtype A portions of the recombinants were monophyletic with FSU-A, supporting the hypothesis that the recombinants were formed locally.

Figure 2
Figure 2
Image Tools

Isolated secondary antiretroviral resistance mutations were found in some patient sequences but none that would confer resistance. One, A62V, is a secondary RT mutation that does not confer drug resistance by itself but is common among the subtype A-infected subjects; 82 (65.6%) had this mutation.24 These strains are also monophyletic within subtype A in the phylogenetic analysis and thus are descended from a single ancestor (see Fig. 1).

The distribution of samples by subtype as well as demographic and risk factor information is shown in Table 1. The only male subject who reported having had sex with another man (MSM) was infected with subtype B. Neither sex nor transmission risk factors distinguished those having subtype A from those with CRF02_AG, but both populations were primarily male (90.4%) and IDUs (85.3%) (see Table 1). Among the 15 patients with CRF02_AG or its recombinants, only 1 reported travel (to Russia) and none reported contact with foreigners. CRF02_AG was significantly concentrated in samples collected in 2002 (P < 0.05), however, and from patients reporting Tashkent as their residence (P < 0.025). The data suggest that the CRF02_AG outbreak began in 2002 among IDUs in Tashkent.

A comparison between CRF02_AG strains from this outbreak and CRF02_AG strains from rural Cameroon, with predominantly heterosexual transmission, showed significantly less variation among the Uzbek strains (0.8%) than among the Cameroon strains (5.1%) (P < 0.001; Fig. 3) and no statistical difference from the diversity that exists among the subtype A strains (1.4%). The intersubject genetic distances between CRF02_AG strains from Uzbekistan, where injecting drug use is the predominant risk factor, were significantly lower than those between strains from sub-Saharan Africa.

Figure 3
Figure 3
Image Tools

A phylogenetic analysis of 12 selected full-length genomes from Uzbekistan consisted of 8 that were subtype A, 3 that were CRF02_AG, and 1 that was hypermutated subtype B (Fig. 4). Careful recombinant analysis of 11 of the strains demonstrated that all of the subtype A strains were entirely subtype A and that all the CRF02_AG strains were entirely CRF02_AG. Up to this time, 3 full-length examples of FSU-A existed, 1 each from Belarus, Russia, and Ukraine; now, there are 11. In addition, the 3 full-length sequences of the CRF02_AG from Uzbekistan should make the epidemic easier to track.

Figure 4
Figure 4
Image Tools
Back to Top | Article Outline

DISCUSSION

The Uzbek HIV epidemic is dominated by the same subtype A found in other countries of the FSU-FSU-A. A similar finding based on partial env sequences has been previously reported, strongly suggesting that the most common genetic form in Uzbekistan is FSU-A.7 A significant proportion of the subtype A strains in this analysis (65.6%) carried an accessory resistance mutation which, in conjunction with other mutations, would confer resistance to nucleoside RT inhibitors.24 The strains with this mutation form a monophyletic cluster, evidence of a point source introduction.

In this study of HIV-infected patients, a significant minority (9.2%) were infected with CRF02_AG, a recombinant common in West and West Central Africa.12 CRF02_AG has also spread to a small number of people in Estonia, Korea, Taiwan, Ecuador, and Israel, but most of these epidemics have been associated with self-contained transmission clusters.25,26 The outbreak of CRF02_AG in Uzbekistan may have been a single contained transmission cluster at the time of this report, but recent evidence suggests further spread (M. D. Saah, personal communication, 2004). It is possible that the strain is, in essence, a molecular marker for 1 particular drug-using network. The interconnectedness of drug-using networks in different countries of the FSU is not well understood, and the spread of this particular CRF02_AG strain might reveal some of those connections.

The presence of 2 unique recombinants of CRF02_AG and FSU-A suggests that 2 drug networks, 1 with CRF02_AG and 1 with FSU-A, may have overlapped to some extent. Unique recombinants are usually found in people who have been dually infected with both genetic forms; sampling from PBMC DNA in 1 such person over time has revealed either or both parental forms and a haphazard distribution of recombinants.27 The close genetic relationship that each of the Uzbek recombinants has to existing Uzbek strains argues for a local origin of the recombinants in Tashkent, Uzbekistan.

Low intersubject genetic diversity characterizes HIV-1 from IDU epidemics in many countries and subtypes.28 The low genetic diversity of the A epidemic in the FSU is, by far, the largest and the most enduring of these epidemics.6 It has been spreading since 1996 and now covers an immense territory. The Tashkent CRF02_AG outbreak in IDUs also has low diversity. HIV-1, like other retroviruses, is notoriously mutagenic, making approximately 1 error per replication cycle,10 with an estimated 1010 progeny virions produced each day in an untreated HIV patient29; the mechanism by which viral populations in IDUs have remained relatively unchanged is difficult to understand and deserves more thorough and systematic investigation.

The outbreak of CRF02_AG in Tashkent demonstrates the rapid spread of new viruses into drug-using networks of the FSU. When a new strain enters a drug network, it begins to recombine with extant strains and to create new recombinants unique to that drug network.30 Unfortunately, drug networks provide the ideal means for rapidly spreading HIV within core groups and represent an emerging threat for the introduction of novel or recombinant strains into larger heterosexually active communities.

Back to Top | Article Outline

ACKNOWLEDGMENT

The authors thank Robert Shafer of Stanford University for his helpful comments.

Back to Top | Article Outline

REFERENCES

1. Hamers FF. HIV infection in Ukraine (1987-1996). Epidemiol Sante Publique. 2000;48(Suppl):1S3-1S15.

2. Joint United Nations Program on HIV/AIDS (UNAIDS). AIDS Epidemic Update. UNAIDS; Geneva, Switzerland, 2003.

3. United Nations Development Programme, New York, NY, USA. HIV/AIDS in Eastern Europe and the Commonwealth of Independent States: Reversing the Epidemic, Facts and Policy Options. 2004:11-25.

4. Ferdats A, Konicheva V, Dievberna I, et al. An HIV type 1 subtype A outbreak among injecting drug users in Latvia. AIDS Res Hum Retroviruses. 1999;15:1487-1490.

5. Lukashov V, Huismans R, Rakhmanova A, et al. Circulation of subtype A and gagA/envB recombinant HIV type 1 strains among injecting drug users in St. Petersburg, Russia, correlates with geographical origin of infections. AIDS Res Hum Retroviruses. 1999;15:1577-1583.

6. Bobkov A, Kazennova E, Khanina T, et al. An HIV type 1 subtype A strain of low genetic diversity continues to spread among injecting drug users in Russia: study of the new local outbreaks in Moscow and Irkutsk. AIDS Res Hum Retroviruses. 2001;17:257-261.

7. Kurbanov F, Kondo M, Tanaka Y, et al. Human immunodeficiency virus in Uzbekistan: epidemiological and genetic analyses. AIDS Res Hum Retroviruses. 2003;19:731-738.

8. Lowndes CM, Renton A, Alary M, et al. Conditions for widespread heterosexual spread of HIV in the Russian Federation: implications for research, monitoring and prevention. Int J Drug Policy. 2003;14:45-62.

9. Mavrov GI, Bondarenko GM. The evolution of sexually transmitted infections in the Ukraine. Sex Transm Infect. 2002;78:211-221.

10. Coffin JM. HIV population dynamics in vivo: implications for genetic variation, pathogenesis, and therapy. Science. 1995;267:483-489.

11. Kuiken CL, Foley B, Freed E, et al. Sequence Compendium, vol. IV. LA-UR 03-3564, Los Alamos, NM: Theoretical Biology and Biophysics Group, Los Alamos National Laboratory; 2002.

12. Carr JK, Salminen MO, Albert J, et al. Full genome sequences of human immunodeficiency virus type 1 subtypes G and A/G intersubtype recombinants. Virology. 1998;247:22-31.

13. Carr JK, Salminen MO, Koch C, et al. Full-length sequence and mosaic structure of a human immunodeficiency virus type 1 isolate from Thailand. J Virol. 1996;70:5935-5943.

14. Novitsky VA, Montano MA, Essex M. Molecular epidemiology of an HIV-1 subtype A subcluster among injection drug users in the southern Ukraine. AIDS Res Hum Retroviruses. 1998;14:1079-1085.

15. Lukashov VV, Karamov EV, Eremin VF, et al. Extreme founder effect in an HIV type 1 subtype A epidemic among drug users in Svetlogorsk, Belarus. AIDS Res Hum Retroviruses. 1998;14:1299-1303.

16. Masharsky A, Klimov N, Kozlov AP. Molecular cloning and analysis of full-length genome of HIV type 1 strains prevalent in countries of the former Soviet Union. AIDS Res Hum Retroviruses. 2003;19:933-939.

17. Salminen M, Koch C, Sanders-Buell E, et al. Recovery of virtually full-length HIV-1 provirus of diverse subtypes from primary virus cultures using the polymerase chain reaction. Virology. 1995;213:80-86.

18. Carr JK, Laukkanen T, Salminen MO, et al. Characterization of subtype A HIV-1 from Africa by full genome sequencing. AIDS. 1999;13:1819-1826.

19. Felsenstein J. Phylip (Phylogeny Inference Package) [computer program], V3.5c. Seattle: University of Washington Department of Genetics; 1992.

20. Ray SC, Lubaki N, Dhruva BR, et al. Autologous strain-specific cytolytic T lymphocyte responses directed against human immunodeficiency virus type 1 env. AIDS Res Hum Retroviruses. 1998;14:3-13.

21. Salminen MO, Carr JK, Burke DS, et al. Identification of breakpoints in intergenotypic recombinants of HIV type 1 by bootscanning. AIDS Res Hum Retroviruses. 1995;11:1423-1425.

22. Shafer RW, Jung DR, Betts BJ, et al. Human immunodeficiency virus reverse transcriptase and protease sequence database. Nucleic Acids Res. 2000;28:346-348.

23. Liitsola K, Holm K, Bobkov A, et al. An AB recombinant and its parental HIV type 1 strains in the area of the former Soviet Union: low requirements for sequence identity in recombination. AIDS Res Hum Retroviruses. 2000;16:1047-1053.

24. Shafer RW, Jung DR, Betts BJ. Human immunodeficiency virus type 1 reverse transcriptase and protease mutation search engine for queries. Nat Med. 2000;6:1290-1292.

25. Ustina V, Zilmer K, Tammai L, et al. Epidemiology of HIV in Estonia. AIDS Res Hum Retroviruses. 2001;17:81-85.

26. Carrion G, Hierholzer J, Montano S, et al. Circulating recombinant form CRF02_AG in South America. AIDS Res Hum Retroviruses. 2003;19:329-332.

27. Salminen MO, Carr JK, Robertson DL, et al. Evolution and probable transmission of intersubtype recombinant human immunodeficiency virus type 1 in a Zambian couple. J Virol. 1997;71:2647-2655.

28. Oelrichs RB, Shrestha IL, Anderson DA, et al. The explosive human immunodeficiency virus type 1 epidemic among injecting drug users of Kathmandu, Nepal, is caused by a subtype C virus of restricted genetic diversity. J Virol. 2000;74:149-157.

29. Perelson AS, Neumann AU, Markowitz M, et al. HIV-1 dynamics in vivo: virion clearance rate, infected cell life-span, and viral generation time. Science. 1996;271:1582-1586.

30. Liitsola K, Tashkinova I, Laukkanen T, et al. HIV-1 genetic subtype A/B recombinant strain causing an explosive epidemic in injecting drug users in Kaliningrad. AIDS. 1998;12:1907-1919.

Cited By:

This article has been cited 19 time(s).

AIDS Research and Human Retroviruses
Distinct HIV Type 1 Strains in Different Risk Groups and the Absence of New Infections by Drug-Resistant Strains in Lithuania
Caplinskas, S; Loukachov, VV; Gasich, EL; Gilyazova, AV; Caplinskiene, I; Lukashov, VV
AIDS Research and Human Retroviruses, 29(4): 732-737.
10.1089/aid.2012.0312
CrossRef
Japanese Journal of Infectious Diseases
HIV-1 Subtypes and Primary Antiretroviral Resistance Mutations in Antiretroviral Therapy Naive HIV-1 Infected Individuals in Turkey
Sayan, M; Willke, A; Ozgunes, N; Sargin, F
Japanese Journal of Infectious Diseases, 66(4): 306-311.

Lancet Infectious Diseases
Central Asia: hotspot in the worldwide HIV epidemic
Thorne, C; Ferencic, N; Malyuta, R; Mimica, J; Niemiec, T
Lancet Infectious Diseases, 10(7): 479-488.

AIDS Reviews
Molecular epidemiology of HIV-1 variants in the global aids pandemic: an update
Thomson, MM; Najera, R
AIDS Reviews, 7(4): 210-224.

Antiviral Therapy
Consensus drug resistance mutations for epidemiological surveillance: basic principles and potential controversies
Shafer, RW; Rhee, SY; Bennett, DE
Antiviral Therapy, 13(): 59-68.

AIDS Research and Human Retroviruses
HIV-1 genetic diversity and genotypic drug susceptibility in the Republic of Georgia
Zarandia, M; Tsertsvadze, T; Carr, JK; Nadai, Y; Sanchez, JL; Nelson, K
AIDS Research and Human Retroviruses, 22(5): 470-476.

AIDS Research and Human Retroviruses
Genetic forms of HIV type 1 in the former Soviet Union dominate the epidemic in Azerbaijan
Saad, MD; Aliev, Q; Botros, BAM; Carr, JK; Gomatos, PJ; Nadai, Y; Michael, AA; Nasibov, Z; Sanchez, JL; Brix, DI; Earhart, KC
AIDS Research and Human Retroviruses, 22(8): 796-800.

Bmc Infectious Diseases
HIV-1 subtype A infection in a community of intravenous drug users in Pakistan
Khan, S; Rai, MA; Khanani, MR; Khan, MN; Ali, SH
Bmc Infectious Diseases, 6(): -.
ARTN 164
CrossRef
AIDS Research and Human Retroviruses
Molecular epidemiology of HIV type 1 in Ukraine: Birthplace of an epidemic
Saad, MD; Shcherbinskaya, AM; Nadai, Y; Kruglov, YV; Antonenko, SV; Lyullchuk, MG; Kravchenko, ON; Earhart, KC; Sanchez, JL; Birx, DL; Carr, JK
AIDS Research and Human Retroviruses, 22(8): 709-714.

Retrovirology
High genetic variability of HIV-1 in female sex workers from Argentina
Pando, MA; Eyzaguirre, LM; Carrion, G; Montano, SM; Sanchez, JL; Carr, JK; Avila, MM
Retrovirology, 4(): -.
ARTN 58
CrossRef
Plos One
Drug Resistance Mutations for Surveillance of Transmitted HIV-1 Drug-Resistance: 2009 Update
Bennett, DE; Camacho, RJ; Otelea, D; Kuritzkes, DR; Fleury, H; Kiuchi, M; Heneine, W; Kantor, R; Jordan, MR; Schapiro, JM; Vandamme, AM; Sandstrom, P; Boucher, CAB; van de Vijver, D; Rhee, SY; Liu, TF; Pillay, D; Shafer, RW
Plos One, 4(3): -.
ARTN e4724
CrossRef
AIDS Research and Human Retroviruses
Presence of HIV-1 CRF35_AD in Iran
Soheilli, ZS; Ataiee, Z; Tootian, S; Zadsar, M; Amini, S; Abadi, K; Jauvin, V; Pinson, P; Fleury, HJ; Samiei, S
AIDS Research and Human Retroviruses, 25(1): 123-124.
10.1089/aid.2008.0199
CrossRef
AIDS Research and Human Retroviruses
Epidemiological Networks and Drug Resistance of HIV Type 1 in Krasnoyarsk Region, Russia
Rumyantseva, OA; Olkhovskiy, IA; Malysheva, MA; Ruzaeva, LA; Vasiliev, AV; Kazennova, EV; Bobkova, MR; Lukashov, VV
AIDS Research and Human Retroviruses, 25(9): 931-936.
10.1089/aid.2009.0075
CrossRef
AIDS Research and Human Retroviruses
Identification of a Possible Ancestor of the Subtype A1 HIV Type 1 Variant Circulating in the Former Soviet Union
Riva, C; Romano, L; Saladini, F; Lai, A; Carr, JK; Francisci, D; Balotta, C; Zazzi, M
AIDS Research and Human Retroviruses, 24(): 1319-1325.
10.1089/aid.2008.0119
CrossRef
AIDS Research and Human Retroviruses
Characterization of the Emerging HIV Type 1 and HCV Epidemics among Injecting Drug Users in Dushanbe, Tajikistan
Beyrer, C; Patel, Z; Stachowiak, JA; Tishkova, FK; Stibich, MA; Eyzaguirre, LM; Carr, JK; Mogilnii, V; Peryshkina, A; Latypov, A; Strathdee, SA
AIDS Research and Human Retroviruses, 25(9): 853-860.
10.1089/aid.2008.0206
CrossRef
AIDS
Sequence editing by Apolipoprotein B RNA-editing catalytic component-B and epidemiological surveillance of transmitted HIV-1 drug resistance
Gifford, RJ; Rhee, S; Eriksson, N; Liu, TF; Kiuchi, M; Das, AK; Shafer, RW
AIDS, 22(6): 717-725.
10.1097/QAD.0b013e3282f5e07a
PDF (268) | CrossRef
Current Opinion in Infectious Diseases
HIV-1 subtypes: epidemiology and significance for HIV management
Geretti, AM
Current Opinion in Infectious Diseases, 19(1): 1-7.

PDF (190)
JAIDS Journal of Acquired Immune Deficiency Syndromes
Molecular Epidemiology of HIV-1 in St Petersburg, Russia: Predominance of Subtype A, Former Soviet Union Variant, and Identification of Intrasubtype Subclusters
Thomson, MM; Vinogradova, A; Delgado, E; Rakhmanova, A; Yakovlev, A; Cuevas, MT; Muñoz, M; Pinilla, M; Vega, Y; Pérez-Álvarez, L; Osmanov, S; Nájera, R
JAIDS Journal of Acquired Immune Deficiency Syndromes, 51(3): 332-339.
10.1097/QAI.0b013e31819c1757
PDF (235) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
Genetic Characterization of HIV-1 Strains Circulating in Kazakhstan
Eyzaguirre, LM; Erasilova, IB; Nadai, Y; Saad, MD; Kovtunenko, NG; Gomatos, PJ; Zeman, VV; Botros, BA; Sanchez, JL; Birx, DL; Earhart, KC; Carr, JK
JAIDS Journal of Acquired Immune Deficiency Syndromes, 46(1): 19-23.
10.1097/QAI.0b013e318073c620
PDF (328) | CrossRef
Back to Top | Article Outline
Keywords:

HIV-1 molecular epidemiology; former Soviet Union; injecting drug user epidemic; genetic diversity

© 2005 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.