Skip Navigation LinksHome > August 1, 2005 - Volume 39 - Issue 4 > FOXP3 mRNA Levels are Decreased in Peripheral Blood CD4+ Lym...
Text sizing:
A
A
A
JAIDS Journal of Acquired Immune Deficiency Syndromes:
Basic Science

FOXP3 mRNA Levels are Decreased in Peripheral Blood CD4+ Lymphocytes From HIV-Positive Patients

Apoil, Pol André MD, PhD*; Puissant, Bénédicte PhD*; Roubinet, Francis MD, PhD†; Abbal, Michel MD*; Massip, Patrice MD‡; Blancher, Antoine MD, PhD*

Free Access
Article Outline
Collapse Box

Author Information

From the *Laboratoire d'Immunogénétique Moléculaire, Faculté de Médecine de Rangueil, Toulouse, France; †Etablissement Français du Sang Pyrénées Méditerranée, France; and ‡Maladies Infectieuses et Tropicales Hôpital Purpan, Toulouse, France.

Received for publication January 14, 2005; accepted April 29, 2005.

Funded by the French Agency for AIDS Research.

Reprints: Pol André Apoil, Laboratoire d'Immunologie, Hôpital Rangueil-Centre Hospitalier Universitaire de Toulouse, 1 Avenue Jean Poulhes, TSA 50032, Toulouse, 31059 Cedex 9, France (e-mail: polapoil@wanadoo.fr).

Collapse Box

Abstract

The impact of HIV infection on regulatory CD4+CD25high (Treg) lymphocyte subpopulations was evaluated by FOXP3 quantitative reverse transcriptase polymerase chain reaction and by flow cytometry. FOXP3 mRNA was quantified in peripheral blood mononuclear cells or purified CD4+ lymphocytes from HIV+ lymphopenic patients. Patients were distributed among clinical stages A, B, and C and received highly active antiretroviral therapy. The frequency of CD4+CD25high lymphocytes, measured by flow cytometry, was decreased in HIV+ patients (n = 38) compared with the group of uninfected subjects (n = 39). FOXP3 mRNA levels were found decreased in HIV+ patients (n = 25) compared with controls (n = 17) when expression of CD3γ or β-actin but not that of TATA box binding protein 1 was used for data normalization. Our results are compatible with a decrease of the Treg lymphocytes during HIV infection. The consequences of a Treg decrease are discussed in the context of immunologic anomalies observed during HIV infection.

Lymphocytes with regulatory or suppressive properties are now a proven component of immune tolerance to self-antigens1 and possibly to foreign antigens.2 Experimental data have demonstrated in vitro and/or in vivo suppressive capabilities associated with subpopulations of CD4+CD8, CD4CD8+, or CD4CD8 lymphocytes. The gene FOXP3, which belongs to the Forkhead box transcription factor family and is located on chromosome X, is active only in T lymphocytes with regulatory or suppressive properties. In human beings, FOXP3 mRNA and protein were detected in small subpopulations of CD4+ and CD8+ cells: CD4+CD25high regulatory (Treg), and CD8+CD28 suppressor T lymphocytes.3 The size of the FOXP3+ lymphocyte population in human peripheral blood and lymphoid organs is unknown but probably includes a low percentage of T lymphocytes. This is suggested by a FOXP3/GFP mouse model in which approximately 2% of lymph node TcRαβ CD3+ lymphocytes contain the FOXP3 protein.4 Of these lymph node lymphocytes, less than 3% are not CD4+CD25high cells, and they are distributed equally over CD4CD8+ (T lymphocytes), double-negative, and double-positive subpopulations. Despite their low frequency, the physiologic importance of FOXP3+ lymphocytes is unambiguously demonstrated by the presence of severe autoimmune disorders and lymphoid hyperplasia in FOXP3-deficient human beings (eg, immune dysregulation, polyendocrinopathy, and enteropathy X-linked [IPEX] syndrome)5 and mice (scurfy mouse).6

Although it was demonstrated that in vitro, like all CD4+ cells, CD4+CD25high Treg lymphocytes are targeted by HIV,7 the fate of Treg cells in HIV+ patients is largely unexplored. The impact of HIV infection on CD4+FOXP3+ Treg lymphocytes could be of significant pathophysiologic importance. One tempting hypothesis is that a higher rate of destruction for CD4+ T-effector cells versus CD4+ Treg cells in the thymus or the periphery could result in a relative excess of Treg cells, favoring the onset of opportunistic infections in AIDS patients.8 Alternatively, other recent reports suggest that an expansion of the HIV-specific Treg compartment is beneficial for HIV+ patients and delays disease progression.7,9 This suggests that higher sensitivity of Treg to HIV-induced destruction could lead to decreased control of CD4+ T helper cells, inducing uncontrolled activation and ultimately contributing to lymphopenia by activation-induced apoptosis.

Because FOXP3 is expressed at a low level in the nucleus of lymphocytes, it is not possible to show its presence by immunostaining or flow cytometry. Identification of Treg cells by flow cytometry remains ambiguous, because most markers proposed until now are also expressed by activated CD4+ T lymphocytes1: CD25 (interleukin [IL]2-Rα), CTLA-4, GITR (TNFRSF18), and CD103 (αEβ7 integrin). Other markers were more recently proposed, such as CD62, neuropilin-1,10 or low expression of CD45RB/RC isoforms. Again, these markers are not specific for the Treg subpopulation. The value of such markers in case of abnormal immune stimulation, as is frequently observed in AIDS, is questionable. Therefore, we decided to explore FOXP3+ Treg cells in the peripheral blood of HIV-infected subjects with CD4+ lymphopenia by quantitative polymerase chain reaction (PCR) to appreciate the impact of HIV infection on the CD4+FOXP3+ Treg population.

Back to Top | Article Outline

METHODS

Study Subjects and Samples

All experimental data were obtained from blood samples used for regular clinical tests for the patients or blood counts for blood donors. Samples were processed anonymously in accordance with French regulations. The control group included samples from 39 healthy blood donors obtained from the Etablissement Français du Sang Pyrénées-Méditerranée, Toulouse, France (mean absolute CD4+ lymphocyte counts: 964 ± 373 cells/mm3, sex ratio: 1.9, and age range: 42 ± 8 years). Peripheral blood mononuclear cells (PBMCs) were prepared by sucrose gradient centrifugation for all 39 blood samples, and CD4+ lymphocytes could be purified subsequently by magnetic flow sorting from 25 of these 39 PBMC samples (mean CD4+ count: 999 ± 353 cells/mm3, sex ratio: 1.8, and age range: 45 ± 11 years). Samples from 38 HIV-infected patients were from the Service des Maladies Infectieuses et Tropicales, Toulouse, France (mean CD4+ count: 211 ± 73 cells/mm3, sex ratio: 2.0, and age range: 44 ± 8 years). Of these, CD4+ lymphocytes were sorted from 17 PBMC samples (mean CD4+ count: 173 ± 65 cells/mm3, sex ratio: 2.0, and age range: 43 ± 11 years). Patients were distributed equally between clinical stages A, B, and C. All patients were receiving antiretroviral treatment at time of the study and had variable retroviral loads, ranging from <20 to 400,000 copies/mL of plasma.

Back to Top | Article Outline
Flow Cytometry

Absolute numbers of CD4+ lymphocytes were determined in peripheral blood samples from HIV-infected patients or control subjects by flow cytometry (CD3/CD4/CD8/CD45; Becton Dickinson, San Jose, CA). Frequencies of CD4+ lymphocyte subpopulations were determined by 3-color surface immunostaining with a combination of anti-CD25 phycoerythrin (PE; Immunotech, Marseille, France), anti-CD3 peridinin chlorophyll protein (PerCP) Cy5.5 (Becton Dickinson), and anti-CD4 antigen-presenting cell (APC) monoclonal antibodies (Becton Dickinson). Labeled cells were analyzed on a FACSCalibur flow cytometer using CellQuest software (Becton Dickinson). Thresholds used to count the frequency of CD25highCD4+ T lymphocytes were kept unchanged between samples.

Back to Top | Article Outline
Reverse Transcriptase Quantitative Polymerase Chain Reaction

We measured FOXP3 expression by a 2-step quantitative reverse transcriptase (RT)-PCR (RT-qPCR) in PBMCs or purified CD4+ T cells. Total CD4+ lymphocytes were sorted from PBMCs by magnetic flow sorting (CD4+ T-cell purification kit; Miltenyi Biotech, Paris, France). Total RNA was extracted using the RNeasy minikit with DNase I treatment (Qiagen, Courtabœuf, France), and cDNA was synthesized from 50 ng of total RNA using the Sensiscript RT kit (Qiagen). For FOXP3 mRNA quantitation, we used a dual-labeled probe (6FAM-ATCTGTGGCATCATCCGACAAGGGC-BHQ1, where BHQ1 is a dark quencher), together with sense (CTGGGAAAATGGCACTGACC) and antisense (GCAGCTACGATGCAGCAGG) primers (Proligo, Paris, France). FOXP3 expression was normalized to CD3γ TATA box binding protein 1 (TBP1), or to β-actin mRNA/cDNA abundance. All primer and TaqMan probe sets were intron-spanning, did not generate PCR products from genomic DNA, and were designed by using the Primer-Express software (Applied Biosystems, Courtabœuf, France). For each sample, 2 RT procedures were performed and analyzed independently in qPCR duplicate reactions (Eurogentec, Liege, Belgium). Raw RT-qPCR results, expressed as threshold cycle numbers, were converted into absolute numbers of copies by using the standard curve method with serial dilutions in water of amplified PCR products from 107 to 102 copies. Variations between replicates were taken into account for statistical calculations. We assumed that the level of expression of FOXP3 in individual Treg cells is constant and thus that FOXP3 expression, as measured in CD4+ lymphocytes by RT-qPCR, mainly reflects the Treg CD4+/T helper CD4+ ratio.

Back to Top | Article Outline

RESULTS

Numeration of CD4+CD25high by Flow Cytometry

We analyzed the proportion of CD4+CD25high among total CD4+ lymphocytes in PBMC samples from 38 HIV+ patients and 39 controls and found that HIV+ patients did not differ significantly from controls (Table 1, right; P = 0.14). We found an influence of the clinical stage on CD25 expression, because patients with more advanced disease (C2/C3) had higher levels of CD4+CD25high (P = 0.02) compared with patients with mild symptoms (A2/A3). The latter patients (A2/A3) exhibited a significant decrease of CD4+CD25high cells compared with uninfected controls (P = 0.02), contrary to patients belonging to the C2/C3 group, who presented frequencies of CD4+CD25high cells similar to those found in the control group. We also calculated the percentage of CD4+CD25high of total CD3+ lymphocytes (see Table 1, left). Using this Treg/CD3 ratio, HIV+ patients possess approximately 4 times fewer CD4+CD25high cells than controls (see Table 1, left).

Table 1
Table 1
Image Tools
Back to Top | Article Outline
FOXP3 Quantitative Reverse Transcriptase Polymerase Chain Reaction

We quantified FOXP3 and CD3γ mRNA in PBMC samples (25 controls and 17 HIV patients) and FOXP3 expression was normalized to CD3γ expression. As shown in Figure 1, a significant difference (P < 0.001) is observed, because samples from the HIV+ group contain 4 times less FOXP3 mRNA compared with controls. Because FOXP3 is mainly expressed in CD4+ T cells (data not shown), whereas CD3γ is expressed in CD4+CD8 and CD4CD8+ lymphocytes, we applied a correction factor, taking into account the PBMC sample CD4+/CD8+ ratios measured by flow cytometry. Even after correction, the difference between HIV+ and control groups remained highly significant (P < 0.001) (see Fig. 1B).

Figure 1
Figure 1
Image Tools

To confirm the results obtained from PBMC samples, we measured FOXP3 expression in magnetically flow-sorted CD4+ lymphocytes obtained from the same PBMC samples studied previously. We normalized FOXP3 mRNA/cDNA copy numbers to CD3γ, TBP1, or β-actin mRNA/cDNA copies. For technical reasons (low numbers of CD4+ cells and/or low RNA yields), RT-qPCR results could not be obtained from all individuals (Fig. 2). When CD3γ or TBP1 was used for data normalization, no statistically significant difference in FOXP3 expression was found between CD4+ lymphocyte samples from HIV+ and control groups: P = 0.39 (TBP1) or P = 0.09 (CD3γ) (see Figs. 2A, B). It should be noted that 5 of the 17 analyzed samples from HIV+ patients contained low amounts of FOXP3/CD3γ mRNA, however, which was significantly less than that of control samples (P < 0.001; see Fig. 2B). Because of the discrepancies observed in FOXP3 expression when TBP1 or CD3γ genes were used for normalization, we decided to normalize FOXP3 expression to β-actin. The remaining RNA samples (9 HIV+ patients and 18 uninfected controls) were used to quantify β-actin mRNA. In these samples, FOXP3 expression was significantly lower in HIV+ patients when β-actin was used for normalization (see Fig. 2C). In the same samples, expression of CD3γ normalized to β-actin was lower (65%) in HIV+ patents than in controls.

Figure 2
Figure 2
Image Tools
Back to Top | Article Outline

DISCUSSION

We used 2 different methods, FOXP3 RT-qPCR and flow cytometry, to analyze the Treg population in HIV+ patients. Our results show clearly that there is no increase in FOXP3 mRNA levels or expansion of the CD4+CD25high population in lymphopenic HIV-infected individuals receiving highly active antiretroviral therapy (HAART).

We found a decrease in the percentage of CD4+CD25high cells in the group of HIV+ patients compared with controls. This decrease is evidenced by low percentages of CD4+CD25high lymphocytes of total CD3+ cells. Our results deviate from those of some other studies, where higher frequencies of CD4+CD25+ lymphocytes in HIV+ patients compared with uninfected controls were reported.11,12 In accordance with most observations, however, we found that patients with advanced disease (C2/C3) had higher CD4+CD25high frequencies compared with patients at earlier stages (A2/A3). This is probably attributable to frequent opportunistic infections in advanced AIDS patients. This could also be attributable to severe CD4+ lymphopenia in our patients (mean CD4+ count = 211/cells mm3). Indeed, in a recent report, Kinter et al9 found that the lower the absolute number of CD4+ lymphocytes, the lower is the frequency of CD4+CD25high cells in peripheral blood of HIV+ patients. Moreover, according to that study, lymphopenic HIV+ patients (n = 10, mean CD4+ count = 361 cells/mm3) have similar frequencies of CD4+CD25high cells compared with controls.

We hypothesize that in HIV+ patients, CD4+CD25high cells encompass 2 types of lymphocytes: one corresponding to FOXP3+ Treg and the other corresponding to activate T helper cells. According to our results and those of Kinter et al,9 at all stages, FOXP3+ Treg cells are decreased, whereas at later stages (C2/C3), activated T helper cells compensate for that decrease, leading to a frequency of CD4+CD25high lymphocytes similar to that of controls. To test that hypothesis, we analyzed FOXP3 expression by quantitative RT-PCR. As a matter of fact, FOXP3 expression normalized to CD3γ in PBMC samples is 4 times less in HIV+ patients (all stages) than in controls. Compatible with our hypothesis, there is no significant difference between patients at early and late stages (10 patients in stage A2/A3 vs. 5 patients in stage C2/C3; P = 0.42). Moreover, Oswald-Richter et al7 recently demonstrated lower FOXP3 mRNA levels in enriched CD4+CD25high cells from HIV+ patients (n = 24) compared with uninfected controls (n = 11), again supporting our hypothesis.

Choosing the adequate gene to normalize FOXP3 expression is complex. PBMC samples contain variable percentages of several cell types (eg, T and B lymphocytes, monocytes, natural killer [NK] cells, contaminating polymorphonuclear cells). In the case of FOXP3, genes commonly used to normalize quantitative RT-PCR expression data, such as hypoxanthine guanine phosphoribosyl transferase (HPRT) or β-actin, cannot be used for RNA samples purified from heterogeneous cell mixtures, because FOXP3 mRNA is mostly found in CD4+ lymphocytes and HPRT and β-actin mRNA is present in all cell types but at various levels depending on cell size and type. For that reason, we have chosen to use CD3γ as a reference because, first, its expression is limited to T lymphocytes and, second, the CD4+/CD8+ ratio allows one to calculate FOXP3 relative expression in CD4+CD8 lymphocytes. It was shown that expression of CD3γ (like that of CD4) is decreased in CD4+ lymphocytes infected by HIV,13,14 however, which could inaccurately raise FOXP3/CD3γ ratios in HIV+ patients. Even if it was previously established that the frequency of peripheral CD4+ lymphocytes harboring HIV-1 proviral DNA never exceeds 0.1% in patients treated by HAART,15 a bystander effect exerted by HIV-infected cells on uninfected CD4+ lymphocytes remains possible. Indeed, in patients with severe lymphopenia caused by HIV, the proliferative capacity of peripheral lymphocytes is diminished.16 Ideally, the reference gene has to be expressed only in the cell population to be studied (ie, in CD4+CD8 lymphocytes). To our knowledge, no gene corresponds to such a restricted pattern of transcription. We have tried to use CD4 mRNA as a reference to quantify FOXP3 expression in CD4+ cells, but we found that monocytes contain 10 times more CD4 mRNA per cell than CD4+ lymphocytes do (data not shown). This renders CD4 unsuitable as a reference for FOXP3 expression in PBMCs.

For all the reasons detailed here, we had no alternative for measuring FOXP3 expression in CD4+CD8 cells but to work on purified CD4+ lymphocytes. We first measured FOXP3 mRNA by reference to TBP1 or CD3γ expression. No significant difference was found between HIV+ patients and controls, which challenged the low amount of FOXP3/CD3γ mRNA and the diminished proportion of CD4+CD25high lymphocytes evidenced in PBMCs from patients. Only 5 HIV+ patients of 17 studied had low FOXP3/CD3γ mRNA levels in sorted CD4+ lymphocytes compared with controls (see Fig. 2B). Despite the split of HIV+ patients into 2 groups on the basis of their FOXP3/CD3γ mRNA ratios in CD4+ purified lymphocytes, the 5 patients with low ratios did not differ from the remaining 12 patients by their clinical stages, their viral loads, or their lymphopenia severity. Because we suspected a possible alteration of TBP117 or a decrease of CD3γ14 gene expression in HIV+ patients' CD4+ lymphocytes, we decided to use β-actin as the reference gene to quantify FOXP3 expression in mRNA samples obtained from purified CD4+ lymphocytes. In accordance with our hypothesis, the FOXP3/β-actin ratio was 5 times lower in HIV+ patients compared with controls, confirming that the FOXP3 mRNA level is dramatically decreased in lymphopenic HIV-infected patients, whatever their clinical stage.

In conclusion, our results show a decrease of FOXP3 expression in CD4+ lymphocytes that could correspond to a decrease of Treg CD4+CD25high lymphocytes in the peripheral blood of lymphopenic HIV+ patients or to a reduced transcription rate of FOXP3 in HIV+ patients. Although the second possibility cannot be excluded, our results, at least in patients in A2/A3 stages, demonstrate clearly a decrease of C4+CD25high lymphocytes compared with controls. The dramatic disappearance of Treg from HIV patient blood is probably not a consequence of the higher sensitivity of these cells compared with that of other CD4+ lymphocytes.7 Whatever the mechanisms involved in the disappearance of Treg in HIV patients, the decrease of FOXP3+ Treg lymphocytes could participate in AIDS pathogenesis by favoring the intense T-lymphocyte proliferation followed by apoptosis. It can also be proposed that the efficiency of Treg function in HIV+ patients participates in the induction of autoimmune pathologic findings. The 2 constant targets of the IPEX syndrome (insulin-secreting pancreatic islets and thyroid) are not frequently involved in autoimmune pathologic findings described in HIV+ patients, however.18

Back to Top | Article Outline

ACKNOWLEDGMENTS

The authors thank S. Despiau and M. Dutaur for their excellent technical assistance with RT-qPCR and T. Toreau and C. Bousquet for their excellent technical help with lymphocyte subpopulation sorting. The authors also thank anonymous reviewers for the quality of their scientific advice.

Back to Top | Article Outline

REFERENCES

1. Bach JF. Regulatory T cells under scrutiny. Nat Rev Immunol. 2003;3:189-198.

2. Jiang S, Camara N, Lombardi G, et al. Induction of allopeptide-specific human CD4+CD25+ regulatory T cells ex vivo. Blood. 2003;102:2180-2186.

3. Chang CC, Ciubotariu R, Manavalan JS, et al. Tolerization of dendritic cells by T(S) cells: the crucial role of inhibitory receptors ILT3 and ILT4. Nat Immunol. 2002;3:237-243.

4. Fontenot JD, Rasmussen JP, Williams LM, et al. Regulatory T cell lineage specification by the forkhead transcription factor foxp3. Immunity. 2005;22:329-341.

5. Bennett CL, Christie J, Ramsdell F, et al. The immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome (IPEX) is caused by mutations of FOXP3. Nat Genet. 2001;27:20-21.

6. Brunkow ME, Jeffery EW, Hjerrild KA, et al. Disruption of a new forkhead/winged-helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy mouse. Nat Genet. 2001;27:68-73.

7. Oswald-Richter K, Grill SM, Shariat N, et al. HIV infection of naturally occurring and genetically reprogrammed human regulatory T-cells. Public Library of Science (PLoS Biology). 2004;2:E198.

8. Weiss L, Donkova-Petrini V, Caccavelli L, et al. Human immunodeficiency virus-driven expansion of CD4+CD25+ regulatory T cells, which suppress HIV-specific CD4 T-cell responses in HIV-infected patients. Blood. 2004;104:3249-3256.

9. Kinter AL, Hennessey M, Bell A, et al. CD25(+)CD4(+) regulatory T cells from the peripheral blood of asymptomatic HIV-infected individuals regulate CD4(+) and CD8(+) HIV-specific T cell immune responses in vitro and are associated with favorable clinical markers of disease status. J Exp Med. 2004;200:331-343.

10. Bruder D, Probst-Kepper M, Westendorf AM, et al. Neuropilin-1: a surface marker of regulatory T cells. Eur J Immunol. 2004;34:623-630.

11. Mahalingam M, Peakman M, Davies ET, et al. T cell activation and disease severity in HIV infection. Clin Exp Immunol. 1993;93:337-343.

12. David D, Bani L, Moreau JL, et al. Regulatory dysfunction of the interleukin-2 receptor during HIV infection and the impact of triple combination therapy. Proc Natl Acad Sci USA. 1998;95:11348-11353.

13. Hoxie JA, Alpers JD, Rackowski JL, et al. Alterations in T4 (CD4) protein and mRNA synthesis in cells infected with HIV. Science. 1986;234:1123-1127.

14. Willard-Gallo KE, Van de Keere F, Kettmann R. A specific defect in CD3 gamma-chain gene transcription results in loss of T-cell receptor/CD3 expression late after human immunodeficiency virus infection of a CD4+ T-cell line. Proc Natl Acad Sci USA. 1990;87:6713-6717.

15. Chun TW, Carruth L, Finzi D, et al. Quantification of latent tissue reservoirs and total body viral load in HIV-1 infection. Nature. 1997;387:183-188.

16. Pantaleo G, De Maria A, Koenig S, et al. CD8+ T lymphocytes of patients with AIDS maintain normal broad cytolytic function despite the loss of human immunodeficiency virus-specific cytotoxicity. Proc Natl Acad Sci USA. 1990;87:4818-4822.

17. Kashanchi F, Piras G, Radonovich MF, et al. Direct interaction of human TFIID with the HIV-1 transactivator tat. Nature. 1994;367:295-299.

18. Zandman-Goddard G, Shoenfeld Y. HIV and autoimmunity. Autoimmun Rev. 2002;1:329-337.

Cited By:

This article has been cited 37 time(s).

Plos One
Analysis of Suppressor and Non-Suppressor FOXP3+T Cells in HIV-1-Infected Patients
Arruvito, L; Sabatte, J; Pandolfi, J; Baz, P; Billordo, LA; Lasala, MB; Salomon, H; Geffner, J; Fainboim, L
Plos One, 7(): -.
ARTN e52580
CrossRef
Blood
The split personality of regulatory T cells in HIV infection
Chevalier, MF; Weiss, L
Blood, 121(1): 29-37.
10.1182/blood-2012-07-409755
CrossRef
European Journal of Immunology
Proliferation of weakly suppressive regulatory CD4(+) T cells is associated with over-active CD4(+) T-cell responses in HIV-positive patients with mycobacterial immune restoration disease
Seddiki, N; Sasson, SC; Santner-Nanan, B; Munier, M; van Bockel, D; Ip, S; Marriott, D; Pett, S; Nanan, R; Cooper, DA; Zaunders, JJ; Kelleher, AD
European Journal of Immunology, 39(2): 391-403.
10.1002/eji.200838630
CrossRef
AIDS
Foxp3+ regulatory T cells in antiretroviral-naive HIV patients
Montes, M; Lewis, DE; Sanchez, C; de Castilla, DL; Graviss, EA; Seas, C; Gotuzzo, E; White, AC
AIDS, 20(): 1669-1671.

Clinical Infectious Diseases
The role of regulatory T cells in chronic and acute viral infections
Keynan, Y; Card, CM; McLaren, PJ; Dawood, MR; Kasper, K; Fowke, KR
Clinical Infectious Diseases, 46(7): 1046-1052.
10.1086/529379
CrossRef
AIDS Research and Human Retroviruses
Regulatory T Cell Expansion and Immune Activation during Untreated HIV Type 1 Infection Are Associated with Disease Progression
Cao, W; Jamieson, BD; Hultin, LE; Hultin, PM; Detels, R
AIDS Research and Human Retroviruses, 25(2): 183-191.
10.1089/aid.2008.0140
CrossRef
Plos Pathogens
Foxp3 represses retroviral transcription by targeting both NF-kappa B and CREB pathways
Grant, C; Oh, U; Fugo, K; Takenouchi, N; Griffith, C; Yao, K; Newhook, TE; Ratner, L; Jacobson, S
Plos Pathogens, 2(4): 303-314.
ARTN e33
CrossRef
Immunology and Cell Biology
Cell surface markers of regulatory T cells are not associated with increased forkhead box p3 expression in blood CD4(+) T cells from HIV-infected patients responding to antiretroviral therapy
Lim, AYF; Price, P; Beilharz, MW; French, MA
Immunology and Cell Biology, 84(6): 530-536.
10.1111/j.1440-1711.2006.01467.x
CrossRef
Annual Review of Immunology
Regulatory T Cells in the Control of Host-Microorganism Interactions
Belkaid, Y; Tarbell, K
Annual Review of Immunology, 27(): 551-589.
10.1146/annurev.immunol.021908.132723
CrossRef
Viral Immunology
Increased Peripheral Blood Leukocyte Subsets with Regulatory Phenotype in Clinically Stable Long-Term HIV-Infected Hemophilia Patients on HAART May Be Beneficial and Contribute to a Decrease in Autoimmunity
Daniel, V; Naujokat, C; Sadeghi, M; Zimmermann, R; Huth-Kuhne, A; Opelz, G
Viral Immunology, 23(1): 87-97.
10.1089/vim.2009.0074
CrossRef
International Journal of Biological Markers
HIV-associated Hodgkin's lymphoma. Antiapoptotic pathways and mechanisms for immune escape by tumor cells in the setting of improved immunity
Carbone, A; Cabras, A; Gloghini, A
International Journal of Biological Markers, 22(2): 161-163.

Journal of Biological Chemistry
FoxP3 enhances HIV-1 gene expression by modulating NF kappa B occupancy at the long terminal repeat in human T cells
Holmes, D; Knudsen, G; Mackey-Cushman, S; Su, LS
Journal of Biological Chemistry, 282(): 15973-15980.
10.1074/jbc.M702051200
CrossRef
Virology
In vivo depletion of CD4(+)CD25(hi) regulatory T cells is associated with improved antiviral responses in cats chronically infected with feline immunodeficiency virus
Mikkelsen, SR; Reckling, SK; Egan, EA; Dean, GA
Virology, 403(2): 163-172.
10.1016/j.virol.2010.04.016
CrossRef
Journal of Virology
Simian immunodeficiency virus (SIV) infection influences the level and function of regulatory T cells in SIV-infected rhesus macaques but not SIV-infected sooty mangabeys
Pereira, LE; Villinger, F; Onlamoon, N; Bryan, P; Cardona, A; Pattanapanysat, K; Mori, K; Hagen, S; Picker, L; Ansari, AA
Journal of Virology, 81(9): 4445-4456.
10.1128/JVI.00026-07
CrossRef
Journal of Immunology
HIV envelope suppresses CD4(+) T cell activation independent of T regulatory cells
Hu, HT; Fernando, K; Ni, HP; Weissman, D
Journal of Immunology, 180(8): 5593-5600.

Journal of Internal Medicine
Dendritic cell-based human immunodeficiency virus vaccine
Rinaldo, CR
Journal of Internal Medicine, 265(1): 138-158.
10.1111/j.1365-2796.2008.02047.x
CrossRef
Immunology
The decrease of regulatory T cells correlates with excessive activation and apoptosis of CD8(+) T cells in HIV-1-infected typical progressors, but not in long-term non-progressors
Jiao, YM; Fu, JL; Xing, SJ; Fu, BY; Zhang, Z; Shi, M; Wang, XC; Zhang, JY; Jin, L; Kang, FB; Wu, H; Wang, FS
Immunology, 128(1): e366-e375.
10.1111/j.1365-2567.2008.02978.x
CrossRef
Journal of Virology
Preservation of FoxP3(+) regulatory T cells in the peripheral blood of human immunodeficiency virus type 1-infected elite suppressors correlates with low CD4(+) T-cell activation
Chase, AJ; Yang, HC; Zhang, H; Blankson, JN; Siliciano, RF
Journal of Virology, 82(): 8307-8315.
10.1128/JVI.00520-08
CrossRef
Journal of Infectious Diseases
Glucocorticoid-induced tumor necrosis factor receptor family-related protein triggering enhances HIV-specific CD4(+) T cell cytokine secretion and protects HIV-specific CD4(+) T cells from apoptosis
Lahey, TP; Loisel, SD; Wieland-Alter, W
Journal of Infectious Diseases, 196(1): 43-49.
10.1086/518613
CrossRef
Journal of Immunology
Immune activation driven by CTLA-4 blockade augments viral replication at mucosal sites in simian immunodeficiency virus infection
Cecchinato, V; Tryniszewska, E; Ma, ZM; Vaccari, M; Boasso, A; Tsai, WP; Petrovas, C; Fuchs, D; Heraud, JM; Venzon, D; Shearer, GM; Koup, RA; Lowy, I; Miller, CJ; Franchini, G
Journal of Immunology, 180(8): 5439-5447.

International Immunology
HIV-1 binding to CD4 on CD4(+)CD25(+) regulatory T cells enhances their suppressive function and induces them to home to, and accumulate in, peripheral and mucosal lymphoid tissues: an additional mechanism of immunosuppression
Ji, JX; Cloyd, MW
International Immunology, 21(3): 283-294.
10.1093/intimm/dxn146
CrossRef
Proceedings of the National Academy of Sciences of the United States of America
Suppression of HIV-specific T cell activity by lymph node CD25(+) regulatory T cells from HIV-infected individuals
Kinter, A; McNally, J; Riggin, L; Jackson, R; Roby, G; Fauci, AS
Proceedings of the National Academy of Sciences of the United States of America, 104(9): 3390-3395.
10.1073/pnas.06114234104
CrossRef
Blood
FoxP3(+)CD4(+) regulatory T cells play an important role in acute HIV-1 infection in humanized Rag2(-/-)gamma C-/- mice in vivo
Jiang, Q; Zhang, LG; Wang, R; Jeffrey, J; Washburn, ML; Brouwer, D; Barbour, S; Kovalev, GI; Unutmaz, D; Su, LS
Blood, 112(7): 2858-2868.
10.1182/blood-2008-03-145946
CrossRef
Journal of Immunology
Neuromodulatory Activities of CD4(+)CD25(+) Regulatory T Cells in a Murine Model of HIV-1-Associated Neurodegeneration
Liu, JU; Gong, N; Huang, XY; Reynolds, AD; Mosley, RL; Gendelman, HE
Journal of Immunology, 182(6): 3855-3865.

Clinical and Experimental Immunology
Peripheral CD4 loss of regulatory T cells is associated with persistent viraemia in chronic HIV infection
Baker, CAR; Clark, R; Ventura, F; Jones, NG; Guzman, D; Bangsberg, DR; Cao, H
Clinical and Experimental Immunology, 147(3): 533-539.
10.1111/j.1365-2249.2006.03319.x
CrossRef
Journal of Virology
FoxP3(+) CD25(+) CD8(+) T-Cell induction during primary simian immunodeficiency virus infection in cnomolgus macaques correlates with low CD4(+) T-Cell activation and high viral load
Karlsson, I; Malleret, B; Brochard, P; Delache, B; Calvo, J; Le Grand, R; Vaslin, B
Journal of Virology, 81(): 13444-13455.
10.1128/JVI.01466-07
CrossRef
Immunologic Research
Foxp3 and Treg cells in HIV-1 infection and immuno-pathogenesis
Holmes, D; Jiang, Q; Zhang, LG; Su, LS
Immunologic Research, 41(3): 248-266.
10.1007/s12026-008-8037-x
CrossRef
Transfusion Medicine and Hemotherapy
Mechanisms of central and peripheral T-cell tolerance: An update
Buer, J; Westendorf, AM; Zeng, AP; He, F; Hansen, W; Probst-Kepper, M
Transfusion Medicine and Hemotherapy, 32(6): 384-399.
10.1159/000089128
CrossRef
Retrovirology
Distinct expression profiles of TGF-beta I signaling mediators in pathogenic SIVmac and non-pathogenic SIVagm infections
Ploquin, MJY; Desoutter, JF; Santos, PR; Pandrea, I; Diop, OM; Hosmalin, A; Butor, C; Barre-Sinoussi, F; Muller-Trutwin, MC
Retrovirology, 3(): -.
ARTN 37
CrossRef
Blood
Mucosal but not peripheral FOYP3(+) regulatory T cells are highly increased in untreated HIV infection and nonnalize after suppressive HAART
Epple, HJ; Loddenkemper, C; Kunkel, D; Troger, H; Maul, J; Moos, V; Berg, E; Ullrich, R; Schulzke, JD; Stein, H; Duchmann, R; Zeitz, M; Schneider, T
Blood, 108(9): 3072-3078.
10.1182/blood-2006-04-016923
CrossRef
Journal of Leukocyte Biology
FOXP3 expressing CD127lo CD4+ T cells inversely correlate with CD38+CD8+ T cell activation levels in primary HIV-1 infection
Ndhlovu, LC; Loo, CP; Spotts, G; Nixon, DF; Hecht, FM
Journal of Leukocyte Biology, 83(2): 254-262.
10.1189/jlb.0507281
CrossRef
Plos One
Relationship between Regulatory T Cells and Immune Activation in Human Immunodeficiency Virus-Infected Patients Interrupting Antiretroviral Therapy
Weiss, L; Piketty, C; Assoumou, L; Didier, C; Caccavelli, L; Donkova-Petrini, V; Levys, Y; Girard, PM; Burgard, M; Viard, JP; Rouzioux, C; Costagliola, D
Plos One, 5(7): -.
ARTN e11659
CrossRef
Plos One
FOXP3 Expression Is Upregulated in CD4(+)T Cells in Progressive HIV-1 Infection and Is a Marker of Disease Severity
Suchard, MS; Mayne, E; Green, VA; Shalekoff, S; Donninger, SL; Stevens, WS; Gray, CM; Tiemessen, CT
Plos One, 5(7): -.
ARTN e11762
CrossRef
AIDS
HIV-1 infection is characterized by profound depletion of CD161+ Th17 cells and gradual decline in regulatory T cells
Prendergast, A; Prado, JG; Kang, Y; Chen, F; Riddell, LA; Luzzi, G; Goulder, P; Klenerman, P
AIDS, 24(4): 491-502.
10.1097/QAD.0b013e3283344895
PDF (745) | CrossRef
AIDS
Regulatory T cells in HIV infection: pathogenic or protective participants in the immune response?
de St Groth, BF; Landay, AL
AIDS, 22(6): 671-683.
10.1097/QAD.0b013e3282f466da
PDF (268) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
Normal or Even Increased Dendritic Cell and Peripheral Blood Lymphocyte Subsets With Regulatory Phenotype in Clinically Stable Long-Term HIV-Infected Patients With Hemophilia on Highly Active Antiretroviral Therapy
Daniel, V; Naujokat, C; Sadeghi, M; Zimmermann, R; Huth-Kühne, A; Opelz, G
JAIDS Journal of Acquired Immune Deficiency Syndromes, 47(1): 1-15.
10.1097/QAI.0b013e31815d105e
PDF (947) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
Redistribution of FOXP3-Positive Regulatory T Cells From Lymphoid Tissues to Peripheral Blood in HIV-Infected Patients
Mozos, A; Garrido, M; Carreras, J; Plana, M; Diaz, A; Alos, L; Campo, E; Garcia, F; Martinez, A
JAIDS Journal of Acquired Immune Deficiency Syndromes, 46(5): 529-537.
10.1097/QAI.0b013e31815b69ae
PDF (727) | CrossRef
Back to Top | Article Outline
Keywords:

HIV; CD4+ lymphocytes; FOXP3; quantitative reverse transcriptase polymerase chain reaction

© 2005 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.