Skip Navigation LinksHome > April 15, 2004 - Volume 35 - Issue 5 > Human α Defensin in HIV-Exposed But Uninfected Individuals
JAIDS Journal of Acquired Immune Deficiency Syndromes:
Basic Science

Human α Defensin in HIV-Exposed But Uninfected Individuals

Trabattoni, Daria BS*; Caputo, Sergio Lo MD†; Maffeis, Giada BS*; Vichi, Francesca MD†; Biasin, Mara BS*; Pierotti, Piera BS†; Fasano, Francesca BS*; Saresella, Marina BS‡; Franchini, Mario MD§; Ferrante, Pasquale MD‡; Mazzotta, Francesco MD†; Clerici, Mario MD*

Free Access
Article Outline
Collapse Box

Author Information

From *Cattedra di Immunologia, Università di Milano; †Unità Operativa Malattie Infettive, and §Ostetricia e Ginecologia, Ospedale S.M. Annunziata, Firenze; and ‡Don Gnocchi Foundation, IRCCS, Milano, Italy.

Received for publication October 7, 2003; accepted December 15, 2003.

This paper was supported by grants from Istituto Superiore di Sanita’ “Programma Nazionale di Ricerca sull’ AIDS,” by Centro di Eccellenza CISI, and by the Japan Health Science Foundation.

Reprints: Mario Clerici, Cattedra di Immunologia, Università di Milano, DISP LITA Vialba, Via GB Grassi, 74, 20157 Milano, Italy (e-mail: mario.clerici@unimi.it).

Collapse Box

Abstract

Abstract: Human α defensins 1, 2, and 3 are produced by CD8+ T cells of HIV-infected long-term nonprogressors and have an antiviral activity. α Defensins were examined in peripheral blood mononuclear cells (PBMCs), cervical-vaginal mononuclear cells (CVMCs), and cervical biopsies of 9 HIV-1-exposed but uninfected women (ESNs), 10 HIV-infected patients (HIV), and 13 low-risk healthy controls (HCs). Results showed that, whereas α defensin production and α defensin-expressing CD8 lymphocytes were comparable in ESNs and HIV patients, constitutive α defensin production by peripheral CD8 and CVMCs was augmented in ESNs compared with HCs (P = 0.001 and P = 0.058, respectively); α defensin mRNA was increased in PBMCs of ESNs; unstimulated, α defensin-expressing peripheral and mucosal CD8 lymphocytes were 10-fold higher in ESNs compared with HCs (P = 0.003 and P = 0.01, respectively); and α defensin mRNA and α defensin-expressing cells were augmented in cervical biopsies of ESN compared with HCs (mRNA:P = 0.03). The differences were reduced upon in vitro mitogen stimulation. A robust constitutive production of α defensin is seen in HIV-exposed uninfected individuals; these peptides could have a role in the potentially protective immune response that characterizes ESNs.

Repeated exposure to HIV results in infection. Nevertheless a number of studies have shown that some individuals can be identified in whom HIV infection is not detected despite continuous exposure to the virus. 1,2 Actual exposure to HIV in these exposed seronegative (exposed uninfected) individuals (ESNs) is suggested by the detection of HIV-specific systemic and mucosal T-helper and cytotoxic T cells. 1,2 Mucosal HIV-specific IgAs have also been observed in cervical secretions of heterosexual Italian women, 3 of African 4,5 and Thai 6 commercial sex workers, and in ejaculates of HIV-uninfected male partners of HIV-infected women. 7 Absence of HIV infection following exposure to HIV is also associated, in a minority of ESNs, with mutations in the CCR5 co-receptor 8–11 or with genetic factors, 12 including the presence of particular HLA supertypes. 13,14 Finally, innate immunity could be involved in the generation of ESN status; thus natural killer lytic activity, as well as interferon-γ and tumor necrosis factor-α production, were shown to be significantly elevated in Vietnamese HIV-exposed but uninfected IV drug users. 15

Within the scenario of resistance to HIV infection, CD8+ T cells play multiple roles as, beside their HIV-specific cytolytic activity, these lymphocytes are known to produce an array of antiviral factors, including cell antiviral factor (CAF), 16,17 β chemokines, 18 and allogenerated proteins, 19 that could contribute to the suppression of HIV infectivity. α Defensins are cationic, argininerich peptides that are secreted by a number of cells and have a broad antimicrobial spectrum. 20 CD8+ T lymphocytes of long-term nonprogressing (LTNP) HIV-infected individuals were recently shown to produce relatively high quantities of α defensins 1, 2, and 3 21; CD8+ T-cell-produced defensins were observed to have a strong antiviral activity in vitro distinct from that of CAF. 22 To verify whether the production of α defensin would be increased in ESNs, we investigated systemically and mucosally the expression of α defensin-producing lymphocytes, mitogen-stimulated α defensin generation, and α defensin mRNA in repeatedly and recently HIV-exposed seronegative heterosexual female partners of HIV-infected individuals and compared the results to those obtained in HIV-infected patients and in low-risk healthy controls (HCs) without known exposure to HIV.

Back to Top | Article Outline

MATERIALS AND METHODS

Study Population

Nine heterosexual couples discordant for HIV serostatus were enrolled in the study. In each couple the male partner was HIV infected, whereas the female partner was HIV seronegative despite a prolonged history of penetrative sexual intercourse without condom (and no other known risk factors). Inclusion criterion for the ESN was a history of multiple unprotected sexual episodes for at least 3 years with at least an episode of at-risk intercourse within 7 months prior to the study period. HIV plasma viremia was undetectable in 4 of 9 HIV-infected male partners (Table 1). It is noteworthy to underline that, because in all 4 cases the diagnosis of HIV infection was done during the chronic phase of disease, unprotected penetrative sexual intercourse was initiated at least 2 years before HAART. Ten age-matched HIV-infected women were also enrolled in the study (4 CDC class A1; 4 A2; and 2 C3). Eight of 10 HIV patients had been undergoing antiretroviral therapy for at least 1 year at the time of the study; CD4 cell counts were in the 250–750/μL range and HIV plasma viremia was > 400 copies/mL in 6 of 10 cases (Table 2). CD8 counts were comparable in ESNs, HIV-seropositive, and HC women. Thirteen age-matched healthy female volunteers undergoing a routine Papanicolaou test and without any known risk factor for HIV infection were studied as well.

Table 1
Table 1
Image Tools
Table 2
Table 2
Image Tools

All women underwent careful gynecologic and laboratory evaluation; results of the evaluation did not reveal concomitant infectious or gynecologic problems in any of the individuals enrolled in the study. All ESN, HIV-seropositive, and HC women had been longitudinally followed for at least 3 years (prior to the study period) by the Department of Obstetrics and Gynecology of Santa Maria Annunziata Hospital in Florence. This allowed us to exclude from the study ESNs and HCs in whom sexually transmitted diseases or any other tumoral or gynecologic pathology had been reported in that period.

The ESNs were characterized on the basis of the presence of CCR5-Δ32 alleles; a heterozygous deletion was detected in 1 individual. All ESNs, HIV patients, and low-risk uninfected women agreed to donate peripheral blood mononuclear cells (PBMCs) and to undergo multiple cervical biopsies. Three different bioptic mucosal specimens were collected in all the women who participated in the study: 1 specimen was from the anterior fornex, 1 from the posterior fornex, and 1 from the cervix. Bioptic tissues were placed in a nalgene vial containing 1 mL of RPMI (Roswell Park Memorial Institute) (Organon Teknika Corp., Durham, NC) or embedded in OCT and immediately deep-frozen in a liquid nitrogen tank.

Back to Top | Article Outline
Sample Collection and Processing

Whole blood was collected by venopuncture in EDTA-containing vacutainer tubes (Becton Dickinson & Co., Rutherford, NJ). PBMCs were separated on lymphocyte separation medium (Organon Teknika Corp.) and washed twice in phosphate-buffered saline (PBS), and the number of viable leukocytes was determined by trypan blue exclusion. Cervical samples were obtained, as described elsewhere, 3 by using a cytobrush (Histobrush; Spectrum Labs, Dallas, TX), which was inserted in the cervical os and rotated 360°, and the sample thus obtained was transferred immediately into 2 mL of RPMI. The cytobrush specimen was not collected from menstruating women and was not used if it contained visible blood. The cytobrush was agitated and discarded, and the remaining cell suspension was once more agitated to loosen clumps of mucosa. Cervicovaginal mononuclear cells (CVMCs) were then isolated according to the protocol used for PBMCs and were resuspended in RPMI. The mean (median) (± SD) number of CVMC cells obtained was 200,769 (131,000) (± 56,678).

Back to Top | Article Outline
CD8+ T-Lymphocyte Purification

PBMCs were incubated for 1 hour in RPMI + 20% AB serum in plastic flask to remove monocytes and dendritic cells. Monocyte-depleted cells were incubated with 20 μL of MACS CD8 Microbeads (Miltenyi Biotec, Auburn, CA) for 15 minutes at 4°C. Magnetic separation with positive selection columns was performed using a miniMACS separator. The purity of the cells obtained was >99% as judged by flow cytometry.

Back to Top | Article Outline
Production of α Defensin

1 × 106 purified CD8+ T cells or 5 × 105 CVMCs were incubated in the presence/absence of α CD3 (0.1 μg/m) (Serotec, Oxford, UK) and α CD28 (5 μg/mL) (R&D Systems, Minneapolis, MN) antibodies, together with an equal number of allogenic irradiated PBMCs and 20 U/mL of recombinant interleukin-2 (IL-2). After 3 days of incubation at 37°C in a humidified CO2 incubator, supernatants were collected by centrifugation and cells were analyzed for α defensin production by enzyme-linked immunosorbent assay (ELISA) (Hbt Human HNP 1–3, HyCult Biotechnology; Uden, The Netherlands) (the antibodies used in the ELISA assay recognize human α defensins 1, 2, 3), following the procedures suggested by the manufacturer.

Back to Top | Article Outline
Flow Cytometric Analysis for α Defensin

Peripheral CD8+ cells and CVMCs were washed in PBS and stained with a CD8-specific monoclonal antibody coupled to R-phycoerythrin-Cyanine 5 Tandem (TC) (mouse IgG2a isotype, Caltag Laboratories, Inc., Burlingame, CA) for 30 minutes at 4°C in the dark. Cells were then washed and fixed in Reagent A solution (FIX & PERM cell permabilization kits; Caltag Laboratories) for 10 minutes at room temperature in the dark. The cells were washed once again in PBS and re-suspended in Reagent B (FIX & PERM cell permabilization kits) with an α defensin-specific monoclonal antibody (D21; HyCult Biotechnology) (this antibody recognizes human α defensin 1, 2, and 3) followed by fluorescence labeling with streptavidin-FITC (Caltag Laboratories). The cells were then fixed in 1% paraformaldehyde in PBS. Cytometric analyses were performed using an EPICS XL flow cytometer (Beckman-Coulter, Inc., Miami, FL) equipped with a single 15-mW argon ion laser operating at 488 nm interfaced with 486 DX2 IBM computer (IBM, Cambridge, UK). For each analysis, 20,000 events were acquired and gated on CD8 expression, and side scatter properties. For CVMC samples, only 2000 events were acquired due to the low number of cells. Green fluorescence from FITC (FL1) was collected through 525-nm bandpass filter and deep-red fluorescence from TC (FL4) was collected through 670-nm bandpass filter. Data were collected using linear amplifiers for forward and side scatter and logarithmic amplifiers for FL1 and FL4. Samples were first run using isotype control or single fluorochrome-stained preparations for color compensation. Representative data obtained with the isotype control antibody are shown in Figure 1.

Figure 1
Figure 1
Image Tools
Back to Top | Article Outline
RNA Extraction

RNA was extracted from PBMCs or from cervical biopsies with the acid guanidium thiocyanate-phenol-chloroform method. Purity was determined by spectrophotometry. RNA was finally treated with RNase-free DNase (RQ1 DNase, Promega, Madison, WI) to remove the contamination of genomic DNA.

Back to Top | Article Outline
Reverse Transcription

One microgram of total RNA from cervical biopsies was reverse transcribed into first-strand cDNA in a 20-μL final volume containing 1 μM of random hexanucleotide primers, 1 μM of oligo dT, and 200 U of Molony murine leukemia virus reverse transcriptase (Promega).

Back to Top | Article Outline
Normalization of Sample GAPDH cDNA Content by Competitive PCR

To compare α defensin mRNA expression, clinical samples were normalized for GAPDH cDNA content by competitive polymerase chain reaction (PCR) (TaKaRa, Otsu, Japan). Briefly, 1 set of primers amplified both target GAPDH cDNA and competitor cDNA in each sample. The following primers were used (these primers are specific for human α defensin 1): forward:GCAAGAGCTGATGAGGTTGC reverse: GTTCCATAGCGACGTTCTCC. The PCR products of both target and competitor were subjected to acrylamide gel electrophoresis. The competitor cDNA generated a longer PCR product (241 bp) than the target cDNA (199 bp). Densitometry was used to quantify the density of the bands of target and competitor PCR products. The amount of substrate GAPDH cDNA in each sample was calculated plotting the ratio of sample density to competitor PCR product against the known amount of competitor substrate cDNA. All samples were diluted to the same concentration as the sample with the lowest GAPDH cDNA concentration. α Defensin mRNA expression was quantified using a Quantitative Competitive PCR Kit (TaKaRa). The results were analyzed as previously described for GAPDH quantification and expressed as α defensin/GAPDH ratio.

Back to Top | Article Outline
Immunochemistry for α Defensin Detection

Tissue samples from ESN, HIV-positive, and HC individuals were embedded in OCT, frozen in dry ice, and stored at −80°C. Using a cryostat maintained at −25°C, 6-mm sections were serially cut and transferred to poly-l-lysine-coated slides. These were air-dried, fixed in 2% paraformaldehyde (pH 7.4, Sigma-Aldrich) for 15 minutes, washed in PBS 1×, air-dried, and stored at −20°C until use. At least 30 sections were cut from each bioptic specimen.

Back to Top | Article Outline
In situ α Defensin Detection

Cryosections were air-dried and then incubated with 2% fetal calf serum (FCS) in balanced salt solution (BSS) (Gibco, Ltd., Paistey, OK) -saponin for 30 minutes at room temperature. The endogenous peroxidases were blocked by 1% H2O2/0.02 NaN3 in BSS, supplemented with 0.1% saponin for 30 minutes. Thereafter the avidin and the biotin in the tissue were blocked with the avidin for 15 minutes and with the biotin for 15 minutes, respectively. The sections were washed with BSS-saponin and then incubated overnight at room temperature with monoclonal biotinylated antibody specific for α defensin (D21) (1:500). This step was followed by incubation with horseradish streptavidin-biotin-coupled peroxidase followed by incubation with vectastain (Vector Laboratories, Burlingame, CA) for 30 minutes and by diaminobenzidine (DAB substrate KIT, Vector) and counterstained with hematoxylin and eosin to show morphology. All antibody reagents were appropriately diluted in 0.1% saponin containing BSS and the incubations were followed by rinses in 0.1% saponin containing BSS, except the steps following horseradish peroxidase-conjugated streptavidin, from which saponin is omitted. To test the specificity of the staining, immunohistochemistry was performed as previously described after the exclusion of the defensin monoclonal antibodies. The immunohistochemically stained cells were examined (5 different fields for each section) with a Leica (Wetzlar, Germany) DMR-X microscope (magnification 100×) and the quantification of individual α defensin-producing cells was performed by automated computerized image analysis. The experiments were conducted in a blinded fashion.

Back to Top | Article Outline
Statistical Analysis

The statistical analysis was based on a nonparametric Jonckheere-Terpstra test for trends. All data were also analyzed by a nonparametric Kruskal-Wallis test. Comparisons between the different groups were made using a 2-tailed t-test. Possible relationships were evaluated using a Pearson correlation test. Statistical analysis was performed using the SPSS statistical package (SPSS, Inc. Chicago, IL).

Back to Top | Article Outline

RESULTS

α Defensin Production by CD8+ T Lymphocytes and Cervicovaginal Cells

Production of α defensin by peripheral blood CD8+ T lymphocytes and by CVMCs was examined in unstimulated cells and in cells stimulated with a combination of monoclonal antibodies (αCD3 and αCD28), cytokines (IL-2), and allogeneic cells, as previously described (because of limitations in the number of available cells, unstimulated production of α defensin could not be measured in CVMCs). Cells of 9 ESNs, 10 HIV-infected patients, and 13 low-risk HCs were analyzed. Table 1 summarizes the clinical and epidemiologic characterization of the 9 ESN women recruited in the study. In basal conditions (unstimulated cells), the highest production of α defensin was detected in peripheral blood CD8+ T lymphocytes of ESNs (median: ESN = 462.9 pg/mL; HIV = 308.7 pg/mL; low-risk controls = 45.6 pg/mL). Thus, a 10-fold difference was observed when α defensin production by ESNs was compared with that of low-risk controls; the amount of α defensin produced by lymphocytes of ESN and HIV patients was similar (ESN vs. low-risk HCs, P = 0. 001; HIV vs. low-risk HCs, P = 0. 02; ESN vs. HIV, P = NS). To exclude the possibility that positive bead selection could per se stimulate the production of α defensin, we measured the generation of these peptides by purified CD8 (3 HC and 3 HIV patients) that were positively or negatively selected. α Defensin production was comparable in both conditions (data not shown). Upon stimulation, α defensin production by peripheral blood CD8+ T lymphocytes of ESN and HIV patients augmented <3-fold; in contrast, a >10-fold increase was observed in lymphocytes of low-risk HCs (median: ESN = 1198.1 pg/mL; HIV = 1159.6 pg/mL; low-risk controls = 492.2 pg/mL). Statistical significance was nevertheless maintained (ESN vs. low-risk HCs, P = 0. 001; HIV vs. low-risk HCs, P = 0. 044; ESN vs. HIV, P = NS) (Fig. 2A). Stimulated production of α defensin by CVMCs was higher, albeit not significantly in ESNs compared with either HIV patients or low-risk HCs (Fig. 2B).

Figure 2
Figure 2
Image Tools
Back to Top | Article Outline
α Defensin-Producing CD8+ T Lymphocytes in Peripheral Blood and Cervicovaginal Lavages

α Defensin-producing CD8+ T lymphocytes were investigated using FACS analyses in peripheral blood and in cervicovaginal lavages of all ESN, HIV patients, and low-risk healthy women. Results showed a 10-fold increase of unstimulated peripheral blood CD8+, α defensin-producing lymphocytes in ESN compared with low-risk HCs; these cells were not significantly different in ESN and HIV patients (ESN vs. low-risk HCs, P = 0. 003; HIV vs. low-risk HCs, P = 0. 01; ESN vs. HIV, P = NS) (Fig. 3). In αCD3+αCD28+IL-2+allogeneic cell–stimulated cultures, CD8+ α defensin-producing lymphocytes were increased only marginally in ESNs, were slightly decreased in HIV patients, but, once again, showed a >10-fold increase in low-risk HCs (ESN vs. low-risk HCs, P = NS; HIV vs. low-risk HCs, P = 0. 006; ESN vs. HIV, P = 0. 01).

Figure 3
Figure 3
Image Tools

The highest percentage of α defensin-producing CD8+ T lymphocytes was seen in cervicovaginal lavages of ESNs; the differences between HIV patients and low-risk HCs were not statistically significant whereas the number of these lymphocytes was significantly increased in ESNs compared with low-risk HCs (P = 0. 01). Representative results are shown in Figure 3; the data are summarized in Table 3.

Table 3
Table 3
Image Tools
Back to Top | Article Outline
α Defensin mRNA in Peripheral Blood Mononuclear Cells and in Cervicovaginal Biopsies

α Defensin mRNA was analyzed in PBMCs and in the genital mucosal biopsies of CD8+ T lymphocytes of all ESNs, of HIV patients, and low-risk HCs. Results stemming from analysis performed in (unstimulated) PBMCs indicated that α defensin-specific mRNA is augmented in cells of ESNs compared with HIV patients and low-risk HCs (median α defensin/GAPDH ratio: ESN = 21.95; HIV = 8.70: HC = 12.72). These differences did not reach statistical significance; representative results are presented in Figure 4 (upper panels). Results obtained upon analysis of mRNA for α defensin in genital mucosal biopsies showed that α defensin-specific mRNA is augmented in ESNs compared with HIV patients and low-risk HCs (median α defensin/GAPDH ratio: ESN = 35.45; HIV = 17.98: HC = 3.37) (ESN vs. low-risk HCs, P = 0.03; HIV vs. low-risk HCs, P = 0.02; ESN vs. HIV, P = NS). Representative results are shown in Figure 4 (lower panels).

Figure 4
Figure 4
Image Tools
Back to Top | Article Outline
In Situ α Defensin Detection

α Defensins were analyzed immunohistochemically in bioptic samples from all ESNs, HIV patients, and low-risk healthy women. Results showed a higher signal in ESNs, intermediate in HIV-positive patients, and no signal in HCs. This pattern was detected in bioptic samples of all ESNs, 8/10 HIV patients (the remaining 2 patients had a pattern similar to that seen in ESNs), and all 13 low-risk healthy women. A positive staining was observed at the level of cervical epithelium and stroma, in particular in neutrophils and lymphocytes. In this first stage of analysis, only qualitative information was obtained. Representative results are presented in Figure 5.

Figure 5
Figure 5
Image Tools
Back to Top | Article Outline
Correlations Between α Defensin in the ESN and Viroimmunologic Data of the HIV-Seropositive Partners

α Defensin production by αCD3+αCD28+IL-2+allogeneic cell–stimulated peripheral CD8+ T lymphocytes of ESNs was negatively correlated with the absolute CD4 counts (r = −0.824; P = 0.012) and with the CD4% (r = 0.856; P = 0.007) seen in the HIV-infected sexual partner. Analogously, α defensin production by stimulated CVMC CD8+ T lymphocytes of ESNs was negatively correlated with the absolute CD4 counts (r = −0.721; P = 0.042) and with CD4% (r = −0.928; P = 0.001) of the HIV-infected sexual partner. A correlation (r = 0.606; P = 0.071) was also observed between the unstimulated production of α defensin by peripheral CD8+ T lymphocytes and HIV plasma viremia in the infected sexual partner. Finally, α defensin production by peripheral CD8+ T lymphocytes and by CVMCs of ESNs was strongly correlated both in unstimulated (r = 0.935; P < 0.001) and stimulated (r = 0.919; P < 0.001) cell cultures.

Back to Top | Article Outline

DISCUSSION

Defensins are a family of cationic peptides contained in a number of different immune cells, strictly conserved throughout phylogeny, and characterized by a potent antimicrobial activity. 23–26 A recent report showed that α defensins are also capable of inhibiting the infection of host cells by HIV and that the production of these peptides is higher in CD8+ T lymphocytes of HIV-infected LTNPs. 21

LTNPs are HIV-infected patients in whom disease progression is not observed; LTNPs have been extensively examined in the attempt to clarify the immune mechanisms associated with this condition. 27–29 Another important group of people that has been the subject of many investigations, and may be naturally resistant to HIV infection, is individuals who, despite multiple, continuous exposures to HIV, do not sero-convert or show any sign of disease (ESNs). 1,2 Immune surrogate markers of resistance to HIV infection in ESNs mainly include cells belonging to adaptive immunity: HIV-specific T 30–34 and B 3–7 lymphocytes. To verify whether the concentration of α defensin is increased in ESNs we analyzed, using an array of methods, mucosal and systemic α defensin in 9 HIV-uninfected sexual partners of HIV-infected individuals. Results demonstrate that the number of α defensin-producing CD8+ T lymphocytes is augmented both in the genital mucosa and in the peripheral blood of ESNs, and that α defensin mRNA is also increased in PBMCs and in cervical biopsies of ESNs. These results are the first to show that α defensins are augmented in these individuals. Because α defensins inhibit in vitro the infection of host cells by HIV, it is tempting to speculate that the increased concentration of these molecules seen in exposed seronegative individuals could contribute to their apparent resistance to HIV infection.

One of the most striking findings reported herein is that the production of α defensin, as well as the number of α defensin-producing cells, was 10-fold higher in ESNs than in low-risk HIV-unexposed controls, in cells that were not stimulated in vitro. This finding may be due to the fact that ESNs are repeatedly exposed to HIV and may therefore be an index of immune activation, or it could be genetically predetermined (i.e., a genetically determined potent production of α defensin is associated with the ESN status). The observations that no correlation was seen between α defensin and the date of the last at-risk sexual exposure to HIV (1 day–7 months prior to the study period), and that α defensins were increased both in ESNs and in HIV- patients, seem to offer support to the hypothesis that the increased α defensin production described herewith is a reflection of the chronic immune stimulation detected in ESNs and in HIV-infected patients. 35 Conversely, the fact that a higher production of α defensin was detected in the sexual partners of the HIV patients with lower CD4 counts, and thus more likely to transmit HIV infection, 36,37 might indicate that such production is modulated in response to the immunologic status of the contact case.

The maintenance of a high production of α defensin independently of antigenic stimulation (in this case, exposure to HIV) is a characteristic of mechanisms belonging to innate immunity 38,39 and is in contrast with a number of observations showing that such exposure is necessary to maintain HIV-specific T and B lymphocyte in ESNs. Thus HIV-specific T-helper and cytotoxic T-lymphocyte responses disappear within months after cessation of exposure to the virus in uninfected newborns of HIV-seropositive women 31 and in health care workers reporting a single professional exposure to HIV-seropositive body fluids 30; and the concentration of HIV-specific plasma IgA is significantly diminished in ESN women who adopt safe sex procedures. 3 It will also be interesting to verify why the percentage of a defensin-producing CD8+ T cells is lower, upon stimulation, in HIV patients compared with the other groups of individuals. Longitudinal studies, or the analysis of patients in different phases of disease, could explain whether this phenomenon is secondary to exhaustion or rather is associated with other yet unknown factors. Finally, it is important to underline that the observation of a robust production of α defensin by in vitro unstimulated cells argues against the possible identity between these peptides and CAF. Thus, CAF, the CD8 produced antiviral factor that, although still elusive, has originated all the research performed on soluble antiviral factors in HIV infection, is only produced by CD8+ T lymphocytes that have been stimulated in vitro, in antiviral treated patients 40 as well as in LTNPs and in ESNs. 16,17,41 In this light, recent data have definitively clarified that the biologic action of CAF is distinct from the one of α defensin. Thus, CAF inhibits HIV RNA transcription at the level of the long terminal repeat–driven gene expression, a process that is not influenced by α defensin. 22,42 One unresolved question is whether CD8 T lymphocytes are capable of supporting a robust production of α defensin. Data reported by Zhang et al. 21 and D’Agostino et al., 43 and the results presented herewith, favor such possibility, which is denied in an elegant report by Mackewicz et al. 42; more analysis will be needed to clarify this issue.

The fact that both the unstimulated and the stimulated production of α defensin and the numbers of α defensin-producing cells were similar in ESNs and in HIV-infected patients suggests that high α defensin production alone is not sufficient to confer resistance to HIV infection. Such resistance may stem from a still unqualified interaction between innate and adaptive immunity, genetic factors, and possibly other mechanisms that are still unresolved.

Back to Top | Article Outline

REFERENCES

1. Rowland-Jones SL, McMichael A. Immune responses in HIV-exposed seronegatives: have they repelled the virus?Curr Opin Immunol. 1995;7:448–453.

2. Shearer GM, Clerici M. Protective immunity against HIV infection: has nature done the experiment for us?Immunol Today. 1996;17:21–26.

3. Mazzoli S, Trabattoni D, Lo Caputo S, et al. HIV-specific mucosal and cellular immunity in HIV-seronegative partners of HIV-seropositive individuals. Nat Med. 1997;3:1250–1257.

4. Belec L, Ghys PD, Hocini H, et al. Cervicovaginal secretory antibodies to HIV type 1 that block viral transcytosis through epithelial barriers in highly exposed HIV-1- seronegative African women. J Infect Dis. 2001;184:1412–1422.

5. Kaul R, Trabattoni D, Bwayo JJ, et al. HIV-1 specific mucosal IgA in a cohort of HIV-1 resistant Kenyan sex workers. AIDS. 1999;13:23–29.

6. Beyrer C, Artenstein AW, Rugpao S, et al. Epidemiologic and biologic characterization of a cohort of human immunodeficiency virus type 1 highly exposed, persistently seronegative female sex workers in northern Thailand. J Infect Dis. 1999;179:59–68.

7. Lo Caputo S, Trabattoni D, Vichi F, et al. Mucosal and systemic HIV-1-specific immunity in HIV-1-exposed but uninfected heterosexual males. AIDS. 2003;17:531–539.

8. Kostrikis L, Huang Y, Moore JP, et al. A chemokine receptor CCR2 allele delays HIV-1 disease progression and is associated with promoter mutation. Nat Med. 1998;4:350–357.

9. Liu R, Paxton WA, Choe S, et al. Homozygous defect in HIV-1 co-receptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell. 1996;86:1–11.

10. Paxton WA, Martin SR, Tse D, et al. Relative resistance to HIV-1 infection of CD4 lymphocytes from persons who remain uninfected despite multiple high-risk sexual exposures. Nat Med. 1995;2:412–419.

11. Quillent C, Oberlin E, Braun J, et al. HIV-1 resistance phenotype conferred by combination of two separate inherited mutations of CCR5 gene. Lancet. 1998;351:14–19.

12. Buchacz KA, Wilkinson DA, Krowka JF, et al. Genetic and immunological host factors associated with susceptibility to HIV-1 infection. AIDS. 1998;12:S87–S94.

13. MacDonald KS, Fowke KR, Kimani J, et al. Influence of HLA supertypes on susceptibility and resistance to human immunodeficiency virus type 1 infection. J Infect Dis. 2000;181:1581–1589.

14. Luscher MA, MacDonald KS, Bwayo JJ, et al. Barber BH. Sequence and peptide-binding motif for a variant of HLA-A*0214 (A*02142) in an HIV-1-resistant individual from the Nairobi Sex Worker Cohort. Immunogen. 2001;53:10–18.

15. Truong LX, Scott-Algara D. Luong T T, et al. CD4 cell and CD8 cell-mediated resistance to HIV-1 infection in exposed uninfected intravascular drug users in Vietnam. AIDS. 2003;17:1425–1434.3

16. Levy J, Mackewicz CE, Barker E. Controlling HIV pathogenesis: the role of the noncytotoxic anti-HIV response of CD8+ T cells. Immunol Today. 1996;17:217–224.

17. Stranford SA, Skurnick J, Louria J, et al. Lack of infection in HIV-exposed individuals is associated with a strong CD8(+) cell noncytotoxic anti-HIV response. Proc Natl Acad Sci U S A. 1999;96:1030–1035.

18. Garzino-Demo A, DeVico AL, Conant KE, et al. The role of chemokines in human immunodeficiency virus infection. Immunol Rev. 2000;177:79–87.

19. Grene E, Pinto LA, Cohen SS, et al. Generation of alloantigen-stimulated anti-human immunodeficiency virus activity is associated with HLA-A*02 expression. J Infect Dis. 2001;183:409–416.

20. Fellerman K, Stange EF. Defensin-innate immunity at the epithelial frontier. Eur J Gastroenterol Hepatol. 2001;13:771–776.

21. Zhang L, Yu W, He T, et al. Contribution of human alpha-defensin 1, 2, and 3 to the anti-HIV-1 activity of CD8 antiviral factor. Science. 2002;298:995–1000.

22. Chang TL, Francois F, Mosoian A, et al. CAF-mediated human immuno-deficiency virus (HIV) type 1 transcriptional inhibition is distinct from alpha-defensin-1 HIV inhibition. J Virol. 2003;77:6777–6784.

23. Daher KA, Lehrer RI, Ganz T, et al. Isolation and characterization of human defensin cDNA clones. Proc Natl Acad Sci U S A. 1988;85:7327–7332.

24. Ganz T, Selsted ME, Szklarek D, et al. Defensin: natural peptide antibiotics of human neutrophils . J Clin Invest. 1985;76:1427–1433.

25. Van Wetering S, Sterk PJ, Rabe KF, et al. Defensin: key players or bystanders in infection, injury, and repair in the lung. J Allergy Clin Immunol. 1999;104:1131–1138.

26. Lehrer RI, Ganz T. Defensin of vertebrate animals. Curr Opin Immunol. 2002;14:96–102.

27. Boaz MJ, Waters A, Murad S, et al. Presence of HIV-1 Gag-specific IFN-gamma+IL-2+ and CD28+IL-2+ CD4 T cell responses is associated with nonprogression in HIV-1 infection. J Immunol. 2002;169:6376–6385.

28. Migueles SA, Laborico AC, Shupert WL, et al. HIV-specific CD8+ T cell proliferation is coupled to perforin expression and is maintained in non-progressors. Nat Immunol. 2002;11:1061–1068.

29. Imami Pires NA, Hardy G, Wilson J, et al. A balanced type 1/type 2 response is associated with long-term nonprogressive human immunodeficiency virus type 1 infection. J Virol. 2002;76:9011–9017.

30. Clerici M, Sison AV, Berzofsky JA. et al. Cellular immune factors associated with mother-to-infant transmission of HIV. AIDS. 1993;7:1427–1435.

31. Clerici M, Levin JM, Kessler HA, et al. HIV-specific T helper activity in seronegative health care workers exposed to contaminated blood. JAMA. 1994;271:42–50.

32. De Maria A, Cirillo C, Moretta L. Occurrence of HIV-1 specific cytolytic T cell activity in apparently uninfected children born to HIV-1 infected mothers. J Infect Dis. 1994;170:1296–1303.

33. Langlade-Demoyen P, Ngo-Giang-Huong F, Ferchal F, et al. HIV-nef-specific cytotoxic T lymphocytes in noninfected heterosexual contact of HIV infected patients . J Clin Invest. 1994;93:1297–1307.

34. Pinto L, Sullivan J, Berzofsky JA, et al. Env-specific cytotoxic T lymphocyte responses in HIV seronegative health care workers occupationally exposed to HIV-contaminated body fluids. J Clin Invest. 1995;96:867–875.

35. Biasin M, Lo Caputo S, Speciale L, et al. Mucosal and systemic immune activation is present in HIV-exposed seronegative individuals. J Infect Dis. 2000;182:1365–1374.

36. Medzhitov R, Janeway CA Jr. Innate immunity: the virtues of a nonclonal system of recognition. Cell. 1997;91:295–298.

37. Bloom B, Zinkernagel R. Immunity to infection. Curr Opin Immunol. 1996;8:465–470.

38. Vernazza PL, Eron JJ, Fiscus SA, et al. Sexual transmission of HIV-1, infectiousness and prevention. AIDS. 1999;13:155–166.

39. Gray RH, Waver MJ, Brookmeyer R, et al. Probability of HIV-1 transmission per coital act in monogamous, heterosexual, HIV-1 discordant couples in Rakai, Uganda. Lancet. 2001;357:1149–1153.

40. Wilkinson J, Zaunders JJ, Carr A, et al. CD8+ anti-human immunodeficiency virus suppressor activity (CASA) in response to antiretroviral therapy: loss of CASA is associated with loss of viremia. J Infect Dis. 1999;180:68–75.

41. Castelli JC, Deeks SG, Shiboski S, et al. Relationship of CD8(+) T cell noncytotoxic anti-HIV response to CD4(+) T cell number in untreated asymptomatic HIV-infected individuals. Blood. 2002;99:4225–4227.

42. Mackewicz CE, Yuan J, Tran P, et al. Alpha defensin can have antiviral activity but are not CD8 cell anti-HIV factors. AIDS. 2003;17:F23–F32.

43. D’Agostino C, Lichtner M, Ceccarelli A, et al. α Defensin as anti-HIV factors: the role of CD8+ lymphocytes. Paper presented at: XVII Convegno nazionale AIDS e Sindromi Correlate; November 28–30, 2003; Rome, Italy. Abstract 43.

Cited By:

This article has been cited 31 time(s).

Nature Reviews Microbiology
Primate defensins
Lehrer, RI
Nature Reviews Microbiology, 2(9): 727-738.
10.1038/nrmicro976
CrossRef
American Journal of Reproductive Immunology
Effect of toll-like receptor (TLR) agonists on TLR and microbicide expression in uterine and vaginal tissues of the mouse
Soboll, G; Schaefer, TM; Wira, CR
American Journal of Reproductive Immunology, 55(6): 434-446.
10.1111/j.1600-0897.2006.00381.x
CrossRef
AIDS Research and Human Retroviruses
Human Immunodeficiency Virus (HIV) Antigens and RNA in HIV-Seronegative Women with Cervical Intraepithelial Neoplasia
Basu, J; Romney, SL; Angeletti, RH; Vermund, SH; Nieves, E; Kadish, AS; Mikhail, MS; Orr, GA
AIDS Research and Human Retroviruses, 25(3): 249-259.
10.1089/aid.2008.0096
CrossRef
Infection and Immunity
Susceptibility to Infectious Diseases Based on Antimicrobial Peptide Production
Rivas-Santiago, B; Serrano, CJ; Enciso-Moreno, JA
Infection and Immunity, 77(): 4690-4695.
10.1128/IAI.01515-08
CrossRef
American Journal of Reproductive Immunology
Mucosal innate immunity as a determinant of HIV susceptibility
Iqbal, SM; Kaul, R
American Journal of Reproductive Immunology, 59(1): 44-54.

Plos One
Cyclic and Acyclic Defensins Inhibit Human Immunodeficiency Virus Type-1 Replication by Different Mechanisms
Seidel, A; Ye, Y; de Armas, LR; Soto, M; Yarosh, W; Marcsisin, RA; Tran, D; Selsted, ME; Camerini, D
Plos One, 5(3): -.
ARTN e9737
CrossRef
AIDS
Might male circumcision be more protective against HIV in the highly exposed? An immunological hypothesis
Wawer, MJ; Reynolds, SJ; Serwadda, D; Kigozi, G; Kiwanuka, N; Gray, RH
AIDS, 19(): 2181-2182.

Nature Reviews Immunology
Defensins in innate antiviral immunity
Klotman, ME; Chang, TL
Nature Reviews Immunology, 6(6): 447-456.
10.1038/nri1860
CrossRef
Critical Reviews in Immunology
Genital and Oral Mucosal Immune Response Against HIV-1 in Exposed Uninfected Individuals
Hasselrot, K
Critical Reviews in Immunology, 29(5): 369-377.

Current Hiv Research
HIV-1 neutralizing activity is correlated with increased levels of chemokines in saliva of HIV-1-exposed uninfected individuals
Hirbod, T; Reichard, C; Hasselrot, K; Soderlund, J; Kimani, J; Bwayo, JJ; Plummer, F; Kaul, R; Broliden, K
Current Hiv Research, 6(1): 28-33.

Current Hiv Research
In Vivo Release of Alpha-Defensins in Plasma, Neutrophils and CD8 T-Lymphocytes of Patients with HIV Infection
D'Agostino, C; Lichtner, M; Mastroianni, CM; Ceccarelli, G; Iannetta, M; Antonucci, S; Vullo, V; Massetti, AP
Current Hiv Research, 7(6): 650-655.

Clinical Immunology
Increased IFN-gamma production by NK and CD3+/CD56+ cells in sexually HIV-1-exposed but uninfected individuals
Montoya, CJ; Velilla, PA; Chougnet, C; Landay, AL; Rugeles, MT
Clinical Immunology, 120(2): 138-146.
10.1016/j.clim.2006.02.008
CrossRef
Plos One
Increased alpha-Defensins 1-3 Production by Dendritic Cells in HIV-Infected Individuals Is Associated with Slower Disease Progression
Rodriguez-Garcia, M; Climent, N; Oliva, H; Casanova, V; Franco, R; Leon, A; Gatell, JM; Garcia, F; Gallart, T
Plos One, 5(2): -.
ARTN e9436
CrossRef
AIDS Research and Human Retroviruses
Plasma and mucosal fluid from HIV type 1-infected patients but not from HIV type 1-exposed uninfected subjects prevent HIV type 1-exposed DC from infecting other target cells
Soderlund, J; Hirbod, T; Smed-Sorensen, A; Johansson, U; Kimani, J; Plummer, F; Spetz, AL; Andersson, J; Kaul, R; Broliden, K
AIDS Research and Human Retroviruses, 23(1): 101-106.
10.1089/aid.2005.0104
CrossRef
Proceedings of the National Academy of Sciences of the United States of America
Human alpha-defensins block papillomavirus infection
Buck, CB; Day, PM; Thompson, CD; Lubkowski, J; Lu, WY; Lowy, DR; Schiller, JT
Proceedings of the National Academy of Sciences of the United States of America, 103(5): 1516-1521.
10.1073/pnas.0508033103
CrossRef
Current Hiv Research
HIV-1-discordant couples in sub-Saharan Africa: Explanations and implications for high rates of discordancy
Guthrie, BL; de Bruyn, G; Farquhar, C
Current Hiv Research, 5(4): 416-429.

Journal of Internal Medicine
Mucosal immune responses in the genital tract of HIV-1-exposed uninfected women
Hirbod, T; Broliden, K
Journal of Internal Medicine, 262(1): 44-58.
10.1111/j.1365-2796.2007.01822.x
CrossRef
Journal of Immunology
IL-22 participates in an innate Anti-HIV-1 host-resistance network through acute-phase protein induction
Misse, D; Yssel, H; Trabattoni, D; Oblet, C; Lo Caputo, S; Mazzotta, F; Pene, J; Gonzalez, JP; Clerici, M; Veas, F
Journal of Immunology, 178(1): 407-415.

Retrovirology
Host factors influencing susceptibility to HIV infection and AIDS progression
Lama, J; Planelles, V
Retrovirology, 4(): -.
ARTN 52
CrossRef
Virology
Biological and physical characterization of the X4 HIV-1 suppressive factor secreted by LPS-stimulated human macrophages
Mikulak, J; Gianolini, M; Versmisse, P; Pancino, G; Lusso, P; Verani, A
Virology, 390(1): 37-44.
10.1016/j.virol.2009.04.005
CrossRef
Journal of Innate Immunity
Defensins in Viral Infections
Ding, J; Chou, YY; Chang, TL
Journal of Innate Immunity, 1(5): 413-420.
10.1159/000226256
CrossRef
Molecular Immunology
Mass spectrometry-based relative quantification of human neutrophil peptides 1, 2, and 3 from biological samples
Thompson, L; Turko, I; Murad, F
Molecular Immunology, 43(9): 1485-1489.
10.1016/j.molimm.2005.08.001
CrossRef
Small Wonders: Peptides for Disease Control
Defensins in Viral Infection
Shah, R; Chang, TL
Small Wonders: Peptides for Disease Control, 1095(): 137-171.

AIDS
Levels of innate immune factors in genital fluids: association of alpha defensins and LL-37 with genital infections and increased HIV acquisition
Levinson, P; Kaul, R; Kimani, J; Ngugi, E; Moses, S; MacDonald, KS; Broliden, K; Hirbod, T; the Kibera HIV Study Group,
AIDS, 23(3): 309-317.
10.1097/QAD.0b013e328321809c
PDF (257) | CrossRef
Current Opinion in Hematology
Multispecific myeloid defensins
Lehrer, RI
Current Opinion in Hematology, 14(1): 16-21.

PDF (122)
JAIDS Journal of Acquired Immune Deficiency Syndromes
CC Chemokines Induce Neutrophils to Chemotaxis, Degranulation, and α-Defensin Release
Jan, M; Huang, Y; Shieh, B; Teng, R; Yan, Y; Lee, Y; Liao, K; Li, C
JAIDS Journal of Acquired Immune Deficiency Syndromes, 41(1): 6-16.

PDF (728)
JAIDS Journal of Acquired Immune Deficiency Syndromes
Proinflammatory and Type 1 Cytokine Expression in Cervical Mucosa During HIV-1 and Human Papillomavirus Infection
Behbahani, H; Walther-Jallow, L; Klareskog, E; Baum, L; French, AL; Patterson, BK; Garcia, P; Spetz, A; Landay, A; Andersson, J
JAIDS Journal of Acquired Immune Deficiency Syndromes, 45(1): 9-19.
10.1097/QAI.0b013e3180415da7
PDF (938) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
α-Defensins in the Prevention of HIV Transmission Among Breastfed Infants
Kuhn, L; Trabattoni, D; Kankasa, C; Semrau, K; Kasonde, P; Lissoni, F; Sinkala, M; Ghosh, M; Vwalika, C; Aldrovandi, GM; Thea, DM; Clerici, M
JAIDS Journal of Acquired Immune Deficiency Syndromes, 39(2): 138-142.

PDF (87)
JAIDS Journal of Acquired Immune Deficiency Syndromes
HIV-Specific Antibodies But Not T-Cell Responses Are Associated With Protection in Seronegative Partners of HIV-1-Infected Individuals in Cambodia
Nguyen, M; Pean, P; Lopalco, L; Nouhin, J; Phoung, V; Ly, N; Vermisse, P; Henin, Y; Barré-Sinoussi, F; Burastero, SE; Reynes, J; Carcelain, G; Pancino, G
JAIDS Journal of Acquired Immune Deficiency Syndromes, 42(4): 412-419.
10.1097/01.qai.0000222289.97825.35
PDF (252) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
α-Defensins 1, 2, and 3 Are Expressed by Granulocytes in Lymphoid Tissues of HIV-1-Seropositive and -Seronegative Individuals
Folkvord, JM; McCarter, MD; Ryder, J; Meditz, AL; Forster, JE; Connick, E
JAIDS Journal of Acquired Immune Deficiency Syndromes, 42(5): 529-536.
10.1097/01.qai.0000225010.68815.1b
PDF (1689) | CrossRef
JAIDS Journal of Acquired Immune Deficiency Syndromes
Upregulation of Interferon-α and RANTES in the Cervix of HIV-1-Seronegative Women With High-Risk Behavior
Hirbod, T; Nilsson, J; Andersson, S; Uberti-Foppa, C; Ferrari, D; Manghi, M; Andersson, J; Lopalco, L; Broliden, K
JAIDS Journal of Acquired Immune Deficiency Syndromes, 43(2): 137-143.
10.1097/01.qai.0000229016.85192.60
PDF (2201) | CrossRef
Back to Top | Article Outline
Keywords:

α defensin; T lymphocytes; HIV; immunology; exposed-uninfected individuals

© 2004 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.