Skip Navigation LinksHome > September 1, 2003 - Volume 34 - Issue 1 > Domestic Cats Infected with Lion or Puma Lentivirus Develop...
JAIDS Journal of Acquired Immune Deficiency Syndromes:
Basic Science

Domestic Cats Infected with Lion or Puma Lentivirus Develop Anti-Feline Immunodeficiency Virus Immune Responses

VandeWoude, Sue DVM; Hageman, Catherine L. DVM; Hoover, Edward A. DVM, PhD

Free Access
Article Outline
Collapse Box

Author Information

From the Department of Microbiology, Immunology, and Pathology, College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort Collins, Colorado, U.S.A.

Received for publication April 3, 2003; accepted June 17, 2003.

Supported by Colorado State University College Research Council and by grant R29-AI41871 from DAIDS, NIAID, NIH, DHHS.

Reprints: Sue VandeWoude, Department of Microbiology, Immunology, and Pathology, College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort Collins, CO 80523–1619 (e-mail: suev@lamar.colostate.edu).

Collapse Box

Abstract

Attenuated live viral strains have afforded significant protection against virus challenge in HIV vaccine models. Although both cellular and humoral immunity are assumed to be vital for protection, specific parameters consistently associated with control of infection have been elusive. Our previous studies have shown that lentiviruses from 2 nondomestic feline species—lion (Pathera leo) and puma (Felis concolor)—persistently but nonpathogenetically infect domestic cats (Felis domestica). Moreover, infection with either the puma lentivirus (PLV) or lion lentivirus (LLV) conferred partial protection against superinfection with virulent feline immunodeficiency virus (FIV), the feline equivalent of HIV. To determine whether domestic cats infected by the lentiviruses of pumas or lions generate cross-reactive immune responses, we infected groups of 5 domestic cats with PLV, LLV, or a sham control and then monitored virus load, hematologic parameters, antibody protection, proliferative responses, and the ability of blood mononuclear cells to inhibit LLV, PLV, and FIV replication in vitro. All cats inoculated with LLV or PLV developed persistent infection, and low-level cell-associated viremia has been previously described. Infected cats also generated robust antibody titers and lymphocytes that proliferated in response to viral antigens and downregulated PLV, LLV, and FIV replication in vitro. This latter activity was CD8 cell associated for PLV and LLV inhibition but not for FIV inhibition. Thus, cats infected with the phylogenetically more ancient and less pathogenic feline lentiviruses generated humoral and cell-mediated immune responses reactive against both the homologous viruses and the heterologous FIV of domestic cats, which correlated with decreased viral load. These results are analogous to protection studies with attenuated primate immunodeficiency viruses and provide a system by which to examine adaptation, interference, and cross protection among lentiviruses.

Since its isolation from cats with opportunistic infections in 1987, feline immunodeficiency virus (FIV) has been shown to cause a slowly progressive immunologic deterioration in cats similar to that caused by HIV in human beings. 1–3 Five FIV subtypes have been identified, some of which cause more rapid immunologic deterioration and are associated with higher plasma virus loads. 4–8 Cats infected with FIV exhibit humoral and cell-mediated immune responses similar to those in human AIDS. 2 Because of the ability of lentiviruses to evade cellular and humoral immune control, traditional vaccine strategies have not produced protective immunity. 9–13 FIV provides a practical animal model for the study of lentiviral vaccine efficacy. 3,14 As with other lentiviruses, vaccination of cats with whole inactivated FIV has protected against challenge with low-dose homologous viruses; however, protection against high-dose challenge or heterologous strains has not been consistently observed, 15–18 although, recently, a killed whole-virus vaccine with cross-clade specificity has been described and licensed. 19 Subunit vaccines for FIV have been disappointing in providing protection against challenge and may enhance infection in some instances. 20–24

Serologic surveys of 27 nondomestic feline species have revealed a minimum of 17 species that contain antibodies cross-reactive with FIV antigens. 25–32 Genetic characterization of puma (Felis concolor), lion (Panthera leo), pallas cat (Felis manul), and bobcat (Lynx rufus) isolates has revealed that these viruses are distinct from each other and related to domestic cat FIV. 25,26,33–35 Substantial sequence divergence, broad geographic dispersal, and nearly complete species monophyly among the FIV-related lentiviruses of Felidae suggest that these viruses have been endemic within cat families for a long time and that cross-species transmission has been rare. 25,26,35 Puma lentivirus (PLV) and lion lentivirus (LLV) demonstrate substantial genetic divergence from FIV of domestic cats, which is greater than the divergence between the simian immunodeficiency viruses (SIVs) indigenous to African primates and HIV-1 and HIV-2. 26 The clinical effects of the FIVs indigenous to wild and captive nondomestic cat populations have not been well studied; however, it does not appear that these infections cause widespread disease in free-ranging populations. 25,26,36 Although frequent cross-species transmission of feline lentiviruses appears unlikely in nature, we have shown that FIV-like viruses from lions and pumas can infect domestic cat origin cells in vitro and in vivo. 37,38 Unlike the course of infection with FIV, domestic cats infected with either LLV or PLV developed no evidence of immunologic deterioration or clinical signs of illness during 6 months of monitoring. 37 Additionally, cats experiencing LLV or PLV infection were able to partially control virologic and immunopathologic effects of subsequent FIV challenge. 39

Similar to FIVs of nondomestic cats, African primates infected with indigenous SIVs do not experience immune deficiency, even though viral replication is not consistently downregulated in these animals. 40,41 Humoral and cellular immune response against SIVs in natural hosts varies and is not always correlated with either viral load or pathogenicity. 14,42–44 To characterize feline lentiviral host/virus adaptation further and to elucidate the relationship between host immune response and disease expression, we challenged cats with either LLV or PLV and examined viral and immunologic kinetics over a 4-month period as described below. Because divergence among LLV, PLV, and FIV is greater than that among the primate viruses, the demonstration of antiviral immune responses with broad lentiviral-neutralizing capabilities is accentuated in this model, lending insight into lentiviral immunity and vaccine strategies.

Back to Top | Article Outline

METHODS

Cats and Viruses

Fifteen weanling cats (16 weeks old) from the Colorado State University specific-pathogen-free cat colony were housed by inoculation group in an AAALAC International Accredited animal facility, and all procedures were approved by the Colorado State University Animal Care and Use Committee prior to initiation of the study. Animals were weighed, and blood was collected at 0, 1, 2, 4, 6, 8, 9, 12, 16, and 17 weeks postinoculation (PI). Physical examinations were performed at these times and on days 1 through 6 and day 10. Complete blood cells counts (CBCs) and lymphocyte subset analyses (described below in more detail) were performed on all animals at all blood collection time points, except week 17.

LLV (strain Ple 458) is an expanded stock of reverse transcription (RT)-positive supernatant obtained from a seropositive Serengeti lion 25 and expanded in cat peripheral blood mononuclear cells (PBMCs). PLV-1695 stock virus was obtained by cocultivating PBMCs from a British Columbia cougar with domestic cat PBMCs. Viral RNA was isolated from RT-positive supernatants and amplified by RT polymerase chain reaction (PCR; using primers as described below); resultant fragments were sequenced to determine virus fidelity. Cats were inoculated with 1.5 (PLV) or 2.0 (LLV) mL of supernatant from stock supernatant from naive domestic cat PBMC cultures. All inoculations were performed intravenously while cats were anesthetized with ketamine hydrochloride.

Blood was collected from 5 age-matched FIV-infected control cats at a single time point for immunologic analysis. These animals had been intravenously infected with a plasma pool containing FIV-B-2542 for 16 weeks as part of a different study. Cells were processed as described below.

Back to Top | Article Outline
Viral Culture/Reverse Transcription Assay

Previous studies indicated that both LLV and PLV readily infected 3201 cells, and cell-free virus could be detected by RT assay. 38 Whole blood was collected from inoculated cats at the time points indicated previously. Plasma and PBMCs were isolated by standard methods. 45 Plasma (0.25 mL) and 106 PBMCs were cocultivated with 106 naive 3201 cells at weeks 0, 1, 2, 4, 6, 8, and 12. Supernatant was collected biweekly for 4 weeks. The final collection was analyzed for magnesium-dependent RT activity using a modified 32 P detection assay. 46,47 Results were recorded using autoradiography and β emissions of samples bound to DEAE-81 paper. On week 12, dilutions of PBMCs from 1 to 106 cells were cultured with 3201 cells to titrate viral load. Positive cells per 106 PBMCs were determined by RT positive signal at day 28 of culture.

Back to Top | Article Outline
Reverse Transcription Polymerase Chain Reaction

RNA was isolated from 200 μL of RT-positive supernatant using QIAmp Blood Kit reagents (Qiagen) per product directions and was eluted into RNAse-free water. RNA samples were split in half and annealed with either LLV- or PLV-specific primers as described below at 65°C for 10 minutes. A 2-step DNA synthesis/PCR reaction was performed in 1.5 mM of MgCl2, 150 μM of dNTPs, 8 U of AmpliTaq DNA polymerase (Perkin-Elmer), 5 U of AMV RT (Promega), and each primer at 1 μM. The RT-PCR synthesis/PCR conditions were 45°C for 30 minutes and 94°C for 4 minutes, followed by 40 cycles of 94°C for 10 minutes, 45°C for 15 minutes, and 72°C for 20 minutes in a Perkin-Elmer 9600 Gene Amp PCR system. Primers were designed from the PLV env region (R: 5′CGGATTGTCCAGAGGAGAC3′, F: 5′GGCTTTTCTTCTTTCCCAAAC3′) and LLV pol region (L5-285R: 5′TTATCTCTAAAGGTTCAAAT3′, L5-55F: 5′AGAAGTACAGCTTGGATTGC3′) and amplified ∼250– and ∼230–base pair fragments, respectively. Previous studies indicated that these primers did not amplify the domestic cat lentivirus at these reaction conditions and that sequences obtained were consistent with published sequences for these viruses (data not shown). Amplification products were visualized on a 1.5% agarose gel containing ethidium bromide.

Back to Top | Article Outline
Flow Cytometry

Feline T-lymphocyte immunophenotype labeling was performed with monoclonal antibodies to feline CD4+ and CD8+ as previously described. 48–49 Total CD4+ or CD8+ cell numbers were calculated from subset percentages of total leukocytes. When CD8+ mean intensive fluorescence changes were noted in some infected animals, a commercial antibody (Southern Biotech) against the feline CD8+β subunit 50 was used to confirm correlation with CD8α+βlo phenotype expression.

Back to Top | Article Outline
Western Blot Analysis

Crude LLV or PLV viral protein preparations were electrophoresed on 12% polyacrylamide and transferred to nitrocellulose similar to previously described methods. 6,38 Dilutions of serum (1:100) from each cat were incubated with the appropriate immunoblot strips. FIV-infected and naive cat sera were used as positive and negative controls. At week 16, sera were serially diluted from 1:100 to 1:6400 and tested for seropositivity at each concentration.

Back to Top | Article Outline
Proliferation Assay

Crude antigen preparations were concentrated as described 37 from LLV-, PLV-, or FIV-containing supernatant. Antigen concentration was determined by the Biorad protein assay quantitation system. Antigen was diluted in tissue culture medium and subjected to 120 mJ of ultraviolet (UV) irradiation (UV Stratalinker, Stratagene). PBMCs were collected from whole blood at week 9 PI and plated in triplicate at 2 × 105 cells per well in a 96-well plate and exposed to 2, 10, or 25 μg/mL of either LLV, PLV, or FIV antigen. Media alone and with 5 μg/mL of Concanavalin A (Con A) served as negative and positive media controls, respectively. Five days after plating, cells were pulsed with 1.0 μCi of 3H-thymidine for 18 hours, harvested, and counted on a Wallac 1450 Microbeta Plus scintillation counter. Naive control cat PBMCs were exposed to FIV, LLV, and PLV antigens and served to measure nonspecific proliferation. LLV- or PLV-infected cat PBMCs were only exposed to the homologous virus and FIV antigens. Significant proliferation was noted using 10-μg/mL antigen concentrations; thus, for subsequent proliferation experiments (weeks 12 and 17), this was the only concentration used. In addition to controls listed previously, 4 age-matched FIV-B-2542–infected cat PBMCs (16 weeks PI) were exposed to LLV-, PLV-, and FIV-specific antigens as well as to Con A and media alone at the week 17 time point.

Back to Top | Article Outline
Cell Sorting and In Vitro Suppression Assay

On weeks 9, 12, and 16, PBMCs were harvested as described. 45

Back to Top | Article Outline
Cell Sorting

Cells (107) were washed 3 times, incubated for 30 minutes at 4°C with 1 μg of rat and mouse immunoglobulin (Pierce), washed 3 times, and then incubated with anticat CD8+ fluorescein isothiocyanate (FITC) monoclonal antibodies for 30 minutes at 4°C. After washing, cells were incubated with 20 μL of anti-FITC magnetic beads, washed, and passed over a magnetic column (Miltenyi Biotech). Both CD8+-depleted and -enriched fractions were collected, washed, and used in experiments as outlined below. Fractions were labeled and analyzed by flow cytometry as described previously; in general, CD8+ cells were 80% to 90% pure, and depleted fractions contained less than 5% CD8+ cells. Typically, 5 to 8 × 106 cells were recovered, and a subset of 2 cats per group was used for sorting.

Back to Top | Article Outline
Feline Immunodeficiency Virus Suppression

Twenty-four hours prior to PBMC harvest, Crandell feline kidney (CrFK) cells were exposed to 2 TCID100 of FIV-B 2542. On the day of the assay, cells were washed, split, and plated in 96-well plates to achieve an E/T ratio of 1:1. Cells were left undisturbed for 4 hours to allow adherence, and PBMC effector cells (whole, depleted, or enriched) were then added in triplicate to both naive and FIV-exposed CrFK. Supernatants were collected for analysis, and cultures were replenished with fresh media every 3 to 4 days for 2 to 4 weeks; samples were subjected to FIV p24 antigen capture enzyme-linked immunosorbent assay (ELISA), 51 which has been shown to recognize FIV but not LLV or PLV. 37

Back to Top | Article Outline
Lion Lentivirus/Puma Lentivirus Suppression

Naive 3201 cells were inoculated with 2 TCID100 of either LLV-458 or PLV-1695 supernatant 24 hours prior to suppression assay. On the day of the assay, cells were washed, resuspended, and plated in 96-well plates to achieve an E/T ratio of 1:1. PBMC effector cells (unfractionated, CD8+-depleted, or CD8+-enriched) were added in triplicate to either naive or LLV/PLV-exposed 3201. Supernatants were collected for analysis, and cultures were replenished every 3 to 4 days for 2 to 4 weeks. Samples were analyzed by RT microassay as described previously. 46,47

Back to Top | Article Outline

RESULTS

Clinical Parameters

Clinical signs of LLV and PLV infection were mild to nonexistent. Growth rates of naive, LLV-infected, and PLV-infected animals were virtually identical (data not shown). Four of 5 cats in both the LLV-infected and PLV-infected groups experienced mild transient peripheral lymphadenopathy. One LLV-infected cat was febrile for 3 days 2 weeks PI. One control cat died of unrelated causes at week 4 and was replaced with an age- and sex-matched animal for the duration of the study. These findings were consistent with previous nondomestic cat lentivirus infection studies 38 and reaffirm the hypothesis that the more ancient and attenuated lion and puma viruses are less virulent pathogens than their domestic cat counterpart.

Back to Top | Article Outline
Cell-Associated and Plasma Viremia

Virus was cultured from the plasma of 2 LLV-infected cats and 1 PLV-infected cat at week 1 PI; all other plasma cultures were negative (Table 1). RT activity was detected in cocultures of 106 PBMCs from LLV- and PLV-inoculated cats at week 1, although some signals were weak (2–3 × negative control). All cocultures from LLV- and PLV-inoculated cats were strongly positive (generally >10 × negative control) by week 2 through week 8, at which time, LLV coculture RT values were again low (2–3 × negative control). At week 12, between 105 and 106 PBMCs were required to produce a positive RT signal in coculture (see Table 1). LLV- or PLV-specific RT-PCR amplified fragments from the coculture supernatants as expected (Fig. 1). These data demonstrate that despite the absence of significant clinical disease, LLV and PLV were able to infect domestic cats. Again, as shown in a previous study, 38 a sustained cell-associated viremia was documented, although plasma viremia was rarely detected by cocultivation. Additionally, the proviral load diminished over the 4-month observation period.

Table 1
Table 1
Image Tools
Figure 1
Figure 1
Image Tools
Back to Top | Article Outline
Hematology/Lymphocyte Subset Analysis

Lymphopenia and neutropenia were observed in LLV-infected cats from weeks 2 to 6. During this time CD4+ and CD8+ numbers were significantly lower than control values (Fig. 2). The CD4/CD8 ratio in LLV-infected cats was significantly lower than in controls between weeks 4 and 12, primarily because of expansion of CD8+ cells and the CD8α+βlo cell subset, which was observed at each time point in 60% to 80% (3of 5 cats or 4 of 5 cats, dependent on time point) of LLV-infected cats and in 20% to 40% (1of 5 cats or 2 of 5 cats, dependent on time point) of PLV-infected cats (data not shown). This change was greatest at week 6; by week 16, all cell subsets had returned to control levels. In PLV-infected cats, transient lymphopenia was only detected at week 2. Therefore, LLV and, to a lesser extent, PLV did alter lymphocyte subset kinetics similar to findings noted in domestic cat FIV infection, suggesting that these viruses are lymphotrophic in the domestic cat. An expansion of CD8+ T cells correlated with the appearance of CD8α+βlo cells has also been noted in FIV infection of domestic cats and has been correlated with T-cell suppression of viral infection. 52

Figure 2
Figure 2
Image Tools
Back to Top | Article Outline
Seroconversion

PLV/LLV-specific antibodies detecting p26 Gag and Env glycoprotein were detected by Western blot analysis in all LLV- or PLV-inoculated cats by week 4. At week 16, titers were >1:6400 (Fig. 3).

Figure 3
Figure 3
Image Tools
Back to Top | Article Outline
Proliferation

Both LLV- and PLV-infected cats demonstrated lymphocyte proliferative responses to the homologous virus antigens at 9, 12, and 17 weeks PI; responses were significant (P < 0.05) at week 9 for LLV and PLV and at week 12 for PLV, and probability values for all time points were 0.12 or less. PBMCs from LLV-infected cats also demonstrated significant proliferative responses against FIV antigens at weeks 12 and 17; PLV-infected cats had significant proliferation at week 12. In contrast, cats infected with FIV did not demonstrate a significant proliferative response against FIV, PLV, or LLV antigens (Fig. 4). T helper –cell proliferative responses have been closely correlated with protection against HIV or SIV in vaccine studies and have been suggested to be important in FIV vaccine protection. 19,53 As observed here, cats infected with FIV do not consistently demonstrate proliferative responses against whole FIV or fractionated FIV antigens (Fig. 5C). In contrast, cats infected with LLV or PLV proliferated in response to either homologous whole-virus antigens or FIV (Fig. 5A, 5B). These responses were significant when compared with proliferative responses of PBMCs from control uninfected cats exposed to the same antigens, demonstrating that the results observed were specific and related to viral infection.

Figure 4
Figure 4
Image Tools
Figure 5
Figure 5
Image Tools
Back to Top | Article Outline
In Vitro Virus Suppression
Peripheral Blood Mononuclear Cells

Unfractionated PBMCs from LLV- or PLV-infected cats harvested at 12 weeks PI significantly inhibited FIV production in culture compared with PBMCs from naive cats (Fig. 5A). CrFK FIV production was inhibited by naive PBMCs relative to no cell control, suggesting that uninfected effector cells were able to suppress FIV nonspecifically; however, PBMC effectors from LLV- or PLV-infected cats exhibited significantly greater suppression activity than that of naive cats. This observation suggests that LLV or PLV infection served to either enhance the innate immune suppression present in naive cat PBMCs or to prime a specific immune response with enough heterogeneity to effectively downregulate FIV.

Back to Top | Article Outline
CD8+ Suppression of Feline Immunodeficiency Virus

Unexpectedly, enrichment of CD8+ PBMC fractions from cats infected with PLV or LLV enhanced rather than further inhibited FIV infection in the CrFK FIV suppression system. Depletion of CD8+ cells produced either no effect or enhanced FIV production (see Fig. 5B, C). Similar results were obtained at 16 weeks PI, and contrast with results demonstrating suppression of FIV infection in vitro is associated with CD8+ cells. 52,54,55 Therefore, our results suggest that the whole PBMC suppression of nonhomologous FIV observed is not CD8+ dependent and may represent a noncytolytic innate mechanism for viral suppression.

Back to Top | Article Outline
CD8+ Suppression of Homologous Virus (Lion Lentivirus or Puma Lentivirus)

Unfractionated PBMCs from cats infected with LLV or PLV did not cause significant downregulation of viral infection in homologous virus-infected 3201 target cells (data not shown). Interpretation of these data was complicated by the fact that LLV- or PLV-infected effector cells produced virus during cocultivation that was indistinguishable from the virus expressed by preinfected target cells. When CD8+-depleted or -enriched PBMCs from LLV- or PLV-infected cats were used in homologous virus suppression studies, however, effector cell CD8+-enriched fractions did downmodulate production of LLV or PLV growth in 3201 target cells. Conversely, effector cell CD8+-depleted fractions were associated with enhanced viral expression from 3201 target cells (Fig. 6). Therefore, in contrast to the heterologous FIV viral suppression assays described previously (but as predicted by other lentiviral systems), viral suppression of LLV or PLV of the homologous virus was associated with CD8+ effector cell phenotype.

Figure 6
Figure 6
Image Tools
Back to Top | Article Outline

DISCUSSION

LLV and PLV were able to persistently and apathogenically infect domestic cats. In contrast to a previous study, all cats challenged with PLV became infected. The PLV isolate used in the present study (PLV-1695) was amplified by cocultivation of domestic cat PBMCs with infected puma PBMCs and therefore may have been better adapted to domestic cats than previous 3201-adapted PLV isolates used for challenge (PLV-14 and PcLV). 37 These results confirm that even though LLV and PLV are substantially divergent from FIV, 25,26,33–35 these more ancient viruses can nevertheless still replicate in the nonadapted domestic cat host. This is reminiscent of the ability of primate lentiviruses adapted in a specific host species to infect another; for example, SIVs derived from African primates are able to infect Asian macaques, and HIV-1 and HIV-2 are thought to have originated from different strains of SIV. 40,53,56,57

Many of the clinical and virologic parameters of LLV/PLV infection in domestic cats observed previously (eg, mild transient lymphadenopathy, persistent cell-associated and acute transient plasma viremia) were also noted in this study. In contrast to previous observations, 1 cat experienced a transient febrile episode early in infection, and cats infected with LLV had temporary leukocyte alterations (neutropenia, lymphopenia,CD4/CD8 inversion). 37 Clinical signs in domestic cats acutely infected with FIV include fever, lymphadenopathy, oral ulcerations, and lethargy. 2,3

CD8+ phenotype alterations from CD8α+β+ to CD8α+βlo were detected in LLV-infected animals. Domestic cats infected with FIV experience similar hematologic variations. 2,3 Gebhard et al 58 demonstrated that the CD8α+βloCD62L cell subset expanded after FIV infection and represents the cell population responsible for suppression of FIV replication. In contrast to the transient nature of the hematologic and CD8+ subset changes observed in LLV infection, in cats with virulent FIV infection, CD8 subset alterations persist for the duration of the asymptomatic phase of the disease. 54,55

The present study also demonstrated that a significant lymphocyte proliferative response developed in LLV- and PLV-infected versus FIV-infected domestic cats. Although this effect was more pronounced against homologous viral antigens (ie, LLV and PLV), LLV- and PLV-infected cats also demonstrated cross-reactive proliferative activity against domestic cat FIV. All LLV- and PLV-infected cats developed extremely high antibody titers against homologous viral antigens (>1:6400), consistent with previously reported findings. 37 These findings indicate that cats infected with LLV and PLV are able to mount a robust T helper–cell immune response during the acute and subacute stages of infection, a finding that has not been consistently demonstrated in FIV infection. 2

PBMCs from LLV- and PLV-infected animals suppressed FIV production in vitro, although this response did not appear to be mediated primarily by CD8+ cells as might be expected based on observations in HIV, SIV, and FIV systems. 14,52,54,55,58 Although naive cat PBMCs did restrict FIV growth in vitro, PBMCs from cats infected with LLV and PLV were significantly more inhibitory than naive PBMCs, suggesting enhanced capacity for viral suppression of these infected cells. In standard PBMC/CD8+ lentiviral suppression assays, effector cells produce the same virus as target cells, complicating interpretation of assay results. In the assays described in this study, target cell FIV was differentiated from effector cell LLV and PLV by the specificity of the capture ELISA for FIV. The suppressor mechanism observed in the heterologous virus suppression assay appears to result from a CD8+-independent mechanism and may represent an enhancement of innate immunity noted with naive PBMC effector cell activity. Alternatively, this phenomenon may represent a lentiviral-specific immune response with broad-based activity, which is also reactive against FIV. Although it is also possible that CD8+ effector cells obtained from LLV- or PLV-infected animals may have been efficient target cells for FIV production, thus augmenting the FIV load during cocultivation, this seems unlikely due to the E/T ratio used and the CrFK-adapted FIV strain used in this assay.

In contrast to non-CD8+ cell-dependent viral suppression detected in a heterologous FIV assay, downregulation of homologous LLV or PLV production in a T-cell line was correlated with the CD8+ cell fraction over multiple time points. This finding is consistent with other studies reporting FIV CD8+ suppression in individual animals. 55 Such observations are consistent with the production of soluble immune modulators secreted by CD8+ cells as associated with viral control of HIV. PBMCs from individuals with HIV infection can downregulate infection with macrophage or T-cell tropic strains in vitro. 59 In particular, PBMCs from HIV-2–infected individuals are more readily infected with T-cell tropic versus macrophage tropic CCR-5–utilizing strains of HIV-1 in vitro, 60 likely due to production of β-chemokines by CD8+ and other immune cells. 59,60 Other soluble factors that inhibit viral infection by targeting intracellular gene transcription have been detected. 61 Recent work has associated CD8+ soluble factor suppression with the production of α-defensins, although this work remains controversial. 62 Other possible nonimmune mechanisms that may contribute to prevention of superinfection include fewer numbers of target cells in animals with prior infection or inhibition of receptor-virus binding. 63–65 Although the readouts for virus suppression differed between heterologous FIV suppression (ELISA) and homologous LLV/PLV suppression (RT assay), both assays would be considered quantitative. Results were expressed as percentage of control values for either assay so as to enable relative comparison of viral production.

Our data suggest that at least 2 independent pathways exist for suppression of lentiviral-infected cells by PBMCs from infected animals: a virus-specific CD8+ response and a non-CD8+ restricted pathway with potentially broader antiviral capabilities. Vigorous humoral immunity, heterologous and homologous proliferative responses, and reversion of the CD8+βlo phenotype suggest that cats infected with a nonnative lentivirus respond with a more robust and effective immune response than cats infected with domestic cat FIV. It is possible that the more ancient nondomestic cat viruses have evolved to become more symbiotic with their host. We cannot, however, exclude the possibility that nonimmune mechanisms (eg, receptor affinity, host-virus protein interactions) may restrict viral replication of these viruses within the nonadapted domestic cat. This feline lentivirus system affords a unique opportunity to examine host and viral interactions mediating pathogenicity and resistance to virulent lentiviral infection.

Back to Top | Article Outline

ACKNOWLEDGMENTS

The authors deeply appreciate technical assistance provided by Mary Jo Burkhard and Mary Tompkins at North Carolina State University in design of suppression assays. The authors thank Paul Avery and Kerry Sondgeroth for assistance with flow cytometric assays, Candace Mathiason for multifold technical and laboratory assistance, and Julie Terwee for manuscript review. They are grateful to Stephen J. O'Brien and Kenneth Langelier for providing lion and puma virus samples.

Back to Top | Article Outline

REFERENCES

1. Sparger EE. Current thoughts on feline immunodeficiency virus infection. Vet Clin North Am Small Anim Pract. 1993; 23:173–191.

2. Elder JH, Dean GA, Hoover EA, et al. Lessons from the cat: feline immunodeficiency virus as a tool to develop intervention strategies against human immunodeficiency virus type 1. AIDS Res Hum Retroviruses. 1998; 14:797–801.

3. Bendinelli M, Pistello M, Lombardi S, et al. Feline immunodeficiency virus: an interesting model for AIDS studies and an important cat pathogen. Clin Microbiol Rev. 1995; 8:87–112.

4. Sodora DL, Shpaer EG, Kitchell BE, et al. Identification of three feline immunodeficiency virus (FIV) env gene subtypes and comparison of the FIV and human immunodeficiency virus type 1 evolutionary patterns. J Virol. 1994; 68:2230–2238.

5. Diehl LJ, Mathiason-DuBard CK, O'Neil LL, et al. Accelerated Disease Progression Produced by Feline Immunodeficiency Virus Infection. Keystone Symposia; 1995, Keystone, CO.

6. Diehl LJ, Mathiason-DuBard CK, O'Neil LL, et al. Plasma viral RNA load predicts disease progression in an accelerated feline immunodeficiency virus model. J Virol. 1996; 70:2503–2507.

7. Yamada H, Miyazawa T, Tomonaga K, et al. Phylogenetic analysis of the long terminal repeat of feline immunodeficiency viruses from Japan, Argentina and Australia. Arch Virol. 1995; 140:41–52.

8. Kakinuma S, Motokawa K, Hohdatsu T, et al. Nucleotide sequence of feline immunodeficiency virus: classification of Japanese isolates into two subtypes which are distinct from non-Japanese subtypes. J Virol. 1995; 69:3639–3646.

9. Cease KB, Berzofsky JA. Toward a vaccine for AIDS: the emergence of immunobiology-based vaccine development. Annu Rev Immunol. 1994; 12:923–989.

10. Johnston MI. Progress in AIDS vaccine development. Int Arch Allergy Immunol. 1995; 108:313–317.

11. Wagner R, Shao Y, Wolf H. Correlates of protection, antigen delivery and molecular epidemiology: basics for designing an HIV vaccine. Vaccine. 1999; 17:1706–1710.

12. Brander C, Walker BD. T lymphocyte responses in HIV-1 infection: implications for vaccine development. Curr Opin Immunol. 1999; 11:451–459.

13. Klein M. AIDS and HIV vaccines. Vaccine. 1999; 17(Suppl 2):S65–S70.

14. Levy JA. The value of primate models for studying human immunodeficiency virus pathogenesis. J Med Primatol. 1996; 25:163–174.

15. Yamamoto JK, Okuda T, Ackley CD, et al. Experimental vaccine protection against feline immunodeficiency virus. AIDS Res Hum Retroviruses. 1991; 7:911–922.

16. Yamamoto JK, Hohdatsu T, Olmsted RA, et al. Experimental vaccine protection against homologous and heterologous strains of feline immunodeficiency virus. J Virol. 1993; 67:601–605.

17. Hosie MJ, Osborne R, Yamamoto JK, et al. Protection against homologous but not heterologous challenge induced by inactivated feline immunodeficiency virus vaccines. J Virol. 1995; 69:1253–1255.

18. Matteucci D, Pistello M, Mazzetti P, et al. Vaccination protects against in vivo-grown feline immunodeficiency virus even in the absence of detectable neutralizing antibodies. J Virol. 1996; 70:617–622.

19. Pu R, Coleman J, Omori M, et al. Dual-subtype FIV vaccine protects cats against in vivo swarms of both homologous and heterologous subtype FIV isolates. AIDS. 2001; 15:1225–1237.

20. Siebelink K, Tijhaar E, Huisman R, et al. Enhancement of feline immunodeficiency virus infection after immunization with envelope glycoprotein subunit vaccines. J Virol. 1995; 69:3704–3711.

21. Gonin P, Fournier A, Qualikene W, et al. Immunization trial of cats with a replication-defective adenovirus type 5 expressing the ENV gene of feline immunodeficiency virus. Vet Microbiol. 1995; 45:393–401.

22. Lutz H, Hofmann-Lehmann R, Bauer-Pham K, et al. FIV vaccine studies. I. Immune response to recombinant FIV env gene products and outcome after challenge infection. Vet Immunol Immunopathol. 1995; 46:103–113.

23. Verschoor EJ, Willemse MJ, Stam JG, et al. Evaluation of subunit vaccines against feline immunodeficiency virus infection. Vaccine. 1996; 14:285–289.

24. Lombardi S, Garzelli C, Pistello M, et al. A neutralizing antibody-inducing peptide of the V3 domain of feline immunodeficiency virus envelope glycoprotein does not induce protective immunity. J Virol. 1994; 68:8374–8379.

25. Brown EW, Yuhki N, Packer C, et al. A lion lentivirus related to feline immunodeficiency virus: epidemiologic and phylogenetic aspects. J Virol. 1994; 68:5953–5968.

26. Olmsted RA, Langley R, Roelke ME, et al. Worldwide prevalence of lentivirus infection in wild feline species: epidemiologic and phylogenetic aspects. J Virol. 1992; 66:6008–6018.

27. Brown EW, Olmsted RA, Martenson JS. Exposure to FIV and FIPV in wild and captive cheetahs. Zoo Biology. 1993; 12:135–142.

28. Lutz H, Isenbugel E, Lehmann R, et al. Retrovirus infections in non-domestic felids: serological studies and attempts to isolate a lentivirus. Vet Immunol Immunopathol. 1992; 35:215–224.

29. Brown EW, Miththapala S, O'Brien SJ. Prevalence of exposure to feline immunodeficiency virus in exotic felid species. J Zoo Wildl Med. 1993; 24:357–364.

30. Barr MC, Calle PP, Roelke ME, et al. Feline immunodeficiency virus infection in nondomestic felids. J Zoo Wildl Med. 1989; 20:265–272.

31. Letcher J, O'Conner T. Incidence of antibodies reacting to feline immunodeficiency virus in a population of Asian lions. J Zoo Wildl Med. 1991; 22:324–329.

32. Spencer JA, Van Dijk AA, Horzinek MC, et al. Incidence of feline immunodeficiency virus reactive antibodies in free-ranging lions of the Kruger National Park and the Etosha National Park in Southern Africa detected by recombinant FIV p24 antigen. Onderstepoort J Vet Res. 1992; 59:315–322.

33. Barr MC, Zou L, Holzschu DL, et al. Isolation of a highly cytopathic lentivirus from a nondomestic cat. J Virol. 1995; 69:7371–7374.

34. Langley R. Nucleotide sequence analysis of lentiviral DNA from bobcat (Lynx rufus) peripheral blood mononuclear cells (PBMC). Presented at the Third International Feline Retrovirus Research Symposium, March, 1995, Fort Collins, CO.

35. Carpenter MBE, Culver M, Johnson W, et al. Genetic and phylogenetic divergence of feline immunodeficiency virus in the puma (Puma concolor). J Virol. 1996; 70:6682–6693.

36. Roelke ME, Forrester DJ, Jacobson ER, et al. Seroprevalence of infectious disease agents in free-ranging Florida panthers (Felis concolor coryi). J Wildl Dis. 1993; 29:36–49.

37. VandeWoude S, O'Brien SJ, Langelier K, et al. Growth of lion and puma lentiviruses in domestic cat cells and comparisons with FIV. Virology. 1997; 233:185–192.

38. VandeWoude S, O'Brien SJ, Hoover EA. Infectivity of lion and puma lentiviruses for domestic cats. J Gen Virol. 1997; 78(Part 4):795–800.

39. VandeWoude S, Hageman CL, O'Brien SJ, et al. Non-pathogenic lion and puma lentiviruses impart resistance to superinfection by virulent feline immunodeficiency virus. J Acquir Immune Defic Syndr. 2002; 29:1–10.

40. Hirsch VM, Dapolito G, Johnson PR, et al. Induction of AIDS by simian immunodeficiency virus from an African Green Monkey: species-specific variation in pathogenicity correlates with the extent of in vivo replication. J Virol. 1995; 69:955–967.

41. Lowenstine L, Pedersen N, Higgins J, et al. Seroepidemiological survey of captive Old-World primates for antibodies to human and simian retroviruses and isolation of a lentivirus from sootey mangabeys (Cercocebus atys). Int J Cancer. 1986; 38:563–574.

42. Broussard SR, Staprans SI, White R, et al. Simian immunodeficiency virus replicates to high levels in naturally infected African Green Monkeys without inducing immunologic or neurologic disease. J Virol. 2001; 75:2262–2275.

43. Rey-Cuille MA, Berthier JL, Bomsel-Demontoy MC, et al. Simian immunodeficiency virus replicates to high levels in sooty mangabeys without inducing disease. J Virol. 1998; 72:3872–3886.

44. Kaur A, Yang J, Hempel D, et al. Identification of multiple simian immunodeficiency virus (SIV)-specific CTL epitopes in sooty mangabeys with natural and experimentally acquired SIV infection. J Immunol. 2000; 164:934–943.

45. Quackenbush SL, Donahue PR, Dean GA, et al. Lymphocyte subset alterations and viral determinants of immunodeficiency disease induction by the feline leukemia virus FeLV-FAIDS. J Virol. 1990; 64:5465–5474.

46. Goldstein S, Engle R, Olmsted RA, et al. Detection of SIV antigens by HIV-1 antigen capture immunoassays. J Acquir Immune Defic Syndr Hum Retrovirol. 1990; 3:98–102.

47. Willey DL, Smith DH, Lasky LA, et al. In vitro mutagenesis identifies a region within the envelope gene of the human immunodeficiency virus that is critical for infectivity. J Virol. 1988; 62:139–147.

48. O'Reilly K, Lah EA. Characterization of a panel of monoclonal antibodies specific for subsets of feline leukocytes. Presented at the Second International Feline Retrovirus Symposium, Raleigh, October 1993.

49. Dean GA, Quackenbush SL, Ackley CD, et al. Flow cytometric analysis of T-lymphocyte subsets in cats. Vet Immunol Immunopathol. 1991; 28:327–335.

50. Shimojima M, Miyazawa T, Kohmoto M, et al. Expansion of CD8alpha+beta-cells in cats infected with feline immunodeficiency virus. J Gen Virol. 1998; 79(Part 1):91–94.

51. Dreitz MJ, Dow SW, Fiscus SA, et al. Developmental of monoclonal antibodies and capture immunoassays for feline immunodeficiency virus. Am J Vet Res. 1995; 56:764–768.

52. Bucci JG, Gebhard DH, Childers TA, et al. The CD8+ cell phenotype mediating antiviral activity in feline immunodeficiency virus-infected cats is characterized by reduced surface expression of the CD8 beta chain. J Infect Dis. 1998; 178:968–977.

53. Levy JA. HIV and the Pathogenesis of AIDS. 2nd ed. Washington, DC: ASM Press; 1998.

54. Bucci JG, English RV, Jordan HL, et al. Mucosally transmitted feline immunodeficiency virus induces a CD8+ antiviral response that correlates with reduction of cell-associated virus. J Infect Dis. 1998; 177:18–25.

55. Choi IS, Hokanson R, Collisson EW. Anti-feline immunodeficiency virus (FIV) soluble factor(s) produced from antigen-stimulated feline CD8(+) T lymphocytes suppresses FIV replication. J Virol. 2000; 74:676–683.

56. Hirsch VM, Dapolito G, Goeken R, et al. Phylogeny and natural history of the primate lentiviruses, SIV and HIV. Curr Opin Genet Dev. 1995; 5:798–806.

57. Desrosiers RC. The simian immunodeficiency viruses. Annu Rev Immunol. 1990; 8:557–578.

58. Gebhard DH, Dow JL, Childers TA, et al. Progressive expansion of an L-selectin-negative CD8 cell with anti-feline immunodeficiency virus (FIV) suppressor function in the circulation of FIV-infected cats. J Infect Dis. 1999; 180:1503–1513.

59. Castillo RC, Arango-Jaramillo S, John R, et al. Resistance to human immunodeficiency virus type 1 in vitro as a surrogate of vaccine-induced protective immunity. J Infect Dis. 2000; 181:897–903.

60. Kokkotou EG, Sankale JL, Mani I, et al. In vitro correlates of HIV-2-mediated HIV-1 protection. Proc Natl Acad Sci USA. 2000; 97:6797–6802.

61. Tomaras GD, Lacey SF, McDanal CB, et al. CD8+ T cell-mediated suppressive activity inhibits HIV-1 after virus entry with kinetics indicating effects on virus gene expression. Proc Natl Acad Sci USA. 2000; 97:3503–3508.

62. Zhang L, Yu W, He T, et al. Contribution of human alpha-defensin 1, 2, and 3 to the anti-HIV-1 activity of CD8 antiviral factor. Science. 2002; 298:995–1000.

63. Martin RA, Nayak DP. Receptor interference mediated by the envelope glycoproteins of various HIV-1 and HIV-2 isolates. Virus Res. 1996; 45:135–145.

64. Sommerfelt MA, Weiss RA. Receptor interference groups of 20 retroviruses plating on human cells. Virology. 1990; 176:58–69.

65. Takeuchi Y, Vile RG, Simpson G, et al. Feline leukemia virus subgroup B uses the same cell surface receptor as gibbon ape leukemia virus. J Virol. 1992; 66:1219–1222.

Cited By:

This article has been cited 12 time(s).

Clinical Microbiology Reviews
Going wild: Lessons from naturally occurring T-lymphotropic lentiviruses
VandeWoude, S; Apetrei, C
Clinical Microbiology Reviews, 19(4): 728-+.
10.1128/CMR.00009-06
CrossRef
Journal of Wildlife Diseases
T-lymphocyte profiles in FIV-infected wild lions and pumas reveal CD4 depletion
Roelke, ME; Pecon-Slattery, J; Taylor, S; Citino, S; Brown, E; Packer, C; VandeWoude, S; O'Brien, SJ
Journal of Wildlife Diseases, 42(2): 234-248.

Virology
Feline lentiviruses demonstrate differences in receptor repertoire and envelope structural elements
Smirnova, N; Troyer, JL; Schissler, J; Terwee, J; Poss, M; VandeWoude, S
Virology, 342(1): 60-76.
10.1016/j.virol.2005.07.024
CrossRef
Journal of Wildlife Diseases
Variability in assays used for detection of lentiviral infection in bobcats (Lynx rufus), pumas (Puma concolor) and ocelots (Leopardus pardalis)
Franklin, SP; Troyer, JL; TerWee, JA; Lyren, LM; Kays, RW; Riley, SPD; Boyce, WM; Crooks, KR; Vandewoude, S
Journal of Wildlife Diseases, 43(4): 700-710.

Virology
Evaluation of feline immunodeficiency virus ORF-A mutants as candidate attenuated vaccine
Pistello, M; Bonci, F; Isola, P; Mazzetti, P; Merico, A; Zaccaro, L; Matteucci, D; Bendinelli, M
Virology, 332(2): 676-690.
10.1016/j.virol.2004.12.004
CrossRef
Journal of Virology
Puma lentivirus is controlled in domestic cats after mucosal exposure in the absence of conventional indicators of immunity
TerWee, JA; Yactor, JK; Sondgeroth, KS; VandeWoude, S
Journal of Virology, 79(5): 2797-2806.
10.1128/JVI.79.5.2797-2806.2005
CrossRef
Veterinary Immunology and Immunopathology
Development and validation of puma (Felis concolor) cytokine and lentivirus real-time PCR detection systems
Sondgeroth, K; Leutenegger, C; VandeWoude, S
Veterinary Immunology and Immunopathology, 104(): 205-213.
10.1016/j.vetimm.2004.11.009
CrossRef
Comparative Medicine
Animal models for HIV AIDS: A comparative review
Stump, DS; VandeWoude, S
Comparative Medicine, 57(1): 33-43.

Veterinary Immunology and Immunopathology
Restrictions to cross-species transmission of lentiviral infection gleaned from studies of FIV
VandeWoude, S; Troyer, J; Poss, M
Veterinary Immunology and Immunopathology, 134(): 25-32.
10.1016/j.vetimm.2009.10.005
CrossRef
Veterinary Immunology and Immunopathology
FIV cross-species transmission: An evolutionary prospective
Troyer, JL; VandeWoude, S; Pecon-Slattery, J; McIntosh, C; Franklin, S; Antunes, A; Johnson, W; O'Brien, SJ
Veterinary Immunology and Immunopathology, 123(): 159-166.
10.1016/j.vetimm.2008.01.023
CrossRef
Journal of Wildlife Diseases
Assessing flavivirus, lentivirus, and herpesvirus exposure in free-ranging ring-tailed lemurs in southwestern Madagascar
Sondgeroth, K; Blitvich, B; Blair, C; Terwee, J; Junge, R; Sauther, M; VandeWoude, S
Journal of Wildlife Diseases, 43(1): 40-47.

Virology
Prior bovine immunodeficiency virus infection does not inhibit subsequent superinfection by the acutely pathogenic Jembrana disease virus
Mcnab, T; Desport, M; Dobson, R; Tenaya, IWM; Hartaningsih, N; Wilcox, GE
Virology, 404(2): 261-268.
10.1016/j.virol.2010.05.001
CrossRef
Back to Top | Article Outline
Keywords:

feline immunodeficiency virus (FIV); animal model; protective immunity; viral suppression

© 2003 by Lippincott Williams & Wilkins

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.