Skip Navigation LinksHome > May 2010 - Volume 20 - Issue 4 > Quantitative Analysis of Methylation Status of the PAX1 Gene...
International Journal of Gynecological Cancer:
doi: 10.1111/IGC.0b013e3181c7fe6e
Original Article

Quantitative Analysis of Methylation Status of the PAX1 Gene for Detection of Cervical Cancer

Huang, Tien-Hung MS*†; Lai, Hung-Chen MD, PhD‡§; Liu, Hwan-Wun MD, PhD∥¶; Lin, Cuei Jyuan MS*†; Wang, Kai-Hung MS*†; Ding, Dah-Ching MD, PhD¶#; Chu, Tang-Yuan MD, PhD*¶#

Free Access
Article Outline
Collapse Box

Author Information

*Department of Research, Center for Cervical Cancer Prevention, Buddhist Tzu Chi General Hospital, and †School of Medicine, Graduate Institute of Medical Science, Tzu Chi University, Hualien; ‡Department of Obstetrics and Gynecology, Tri-Service General Hospital; §Laboratory of Epigenetics, National Defense Medical Center, Taipei; and ∥Department of Occupational Medicine, Buddhist Tzu Chi General Hospital, ¶Graduate Institute of Clinical Medicine, and #Department of Obstetrics and Gynecology, Buddhist Tzu Chi General Hospital, Tzu Chi University, Hualien, Taiwan, Republic of China.

Received September 4, 2009, and in revised form October 26, 2009.

Accepted for publication October 27, 2009.

Address correspondence and reprint requests to Tang-Yuan Chu, MD, PhD, Department of Obstetrics and Gynecology, Buddhist Tzu Chi General Hospital, 707, Section 3, Chung-Yang Rd, Hualien 970, Taiwan, Republic of China. E-mail:

Collapse Box


Objective: Although aided by high-risk human papillomavirus (HPV) DNA test, early detection of cervical cancer is still a challenge. Hypermethylation of the paired boxed gene 1 (PAX1) was recently reported as a characteristic of cervical cancer. This study designed a quantitative measure of PAX1 methylation and compared its efficacy to the currently available Hybrid Capture 2 (HC2) HPV test in detection of cervical cancer.

Methods: Using real-time quantitative methylation-specific polymerase chain reaction, we measured the percentage of PAX1 methylation in cervical scrapings obtained from a hospital-based cohort of women with cervical neoplasia of different severities and compared the efficacy of diagnosis of cervical cancer to that of the HC2 HPV test.

Results: From 73 cervical scrapings, with diagnoses of normal (n = 17), cervical intraepithelial neoplasm 1 (CIN1; n = 10), CIN2 (n = 18), CIN3 (n = 14), and invasive cancer (n = 14), the percentage of PAX1 methylation was determined. The percent of methylated reference of invasive cancer (mean [SE], 56.7 [7.1]) was significantly higher than CIN3 (6.5 [2.3]) and the other milder lesions (1.0 [0.3]; P < 0.0001). At a cutoff percent of methylated reference value of 4.5, PAX1 methylation was found in 100% of invasive cancer tissue as compared with 0% of normal tissue, 10% of CIN1, 11% of CIN2, and 43% of CIN3 (P < 0.0001). As a comparison, the HC2 HPV test result was positive in 5.9% of normal tissue, 70% of CIN1, 55.6% of CIN2, 71.4% of CIN3, and 100% of invasive cancer. In addition to cancer tissue, methylation of PAX1 was also found in normal tissue adjacent to the cancer lesion (9/11, 82%) but much less in the remote normal tissues (2/5, 40%), indicating a field methylation.

Conclusions: In this hospital-based study, quantitative measurement of PAX1 hypermethylation in cervical scrapings is highly sensitive and is more specific than HC2 in detection of cervical cancer.

Infection of high-risk human papillomavirus (HPV) is a necessary cause of cervical carcinogensis.1 Early infection of HPV usually induces transient cervical intraepithelial neoplasia (CIN1), whereas persistent infection may result in premalignant cervical intraepithelial neoplasia (CIN2 or CIN3). Testing for HPV DNA in cervical scrapings is performed as a triage for unequivocal Papanicolaou test results2 and for primary screening for cervical cancer, typically with high negative predictive value.3,4 However, because most infections are subclinical, transient, and without cancerous or precancerous lesions. Human papillomavirus testing has been used to facilitate the screening of cervical cancer but is insufficient in the diagnosis of cervical cancer.

Recently, transcriptional silencing of tumor suppressor genes by hypermethylation of CpG sites of promoters was reported as an early and crucial event in cancer development.5,6 In cervical carcinogenesis, a variety of tumor suppressor genes including tumor suppressor in lung cancer 1 (TSLC1), zinc finger, MYND-type containing 10 (BLU), and Ras association domain family member 1 (RASSF1A) were shown methylation silenced.7-10 We have recently reported the paired boxed gene 1 (PAX1) as a novel methylation-silenced gene in cervical cancer development, and methylation was specifically present in the carcinoma in situ (CIS) to invasive cancer stages.11 The PAX1 gene belongs to a highly conserved family of developmentally controlled genes that encode transcription factors and play a role in pattern formation during embryogenesis in vertebrates.12 Specifically, PAX1 is expressed during the development of the skeleton, thymus, and parathyroid glands13,14 and is frequently methylation silenced in cervical and ovarian cancers.11,15 Other than the role of frequent methylation silencing of the tumor suppressor PAX1 in cervical cancer cells, the functional role of PAX1 in carcinogenesis remains unknown.

The methylation-specific polymerase chain reaction (PCR; MSP) test16 for DNA methylation uses visual detection of ethidium bromide-stained PCR products in agarose gel, which is subjective in result reading and insufficient to assess the wide range of methylation percentage in cervical scrapings. In the present study, we performed quantitative measurement of PAX1 gene methylation in cervical scrapings obtained from the full spectrum of cervical neoplastic diseases from normal tissue, CIN1, CIN2, and CIN3 to invasive cancer and compared the results with HPV DNA testing on the same scrapings.

Back to Top | Article Outline


Study Subjects and Diagnosis

During the period between January 2006 and April 2009, women referred for colposcopic examination or surgical interventions because of abnormal Papanicolaou test results or known cervical cancer at the Buddhist Tzu-Chi General Hospital, Hualien, Taiwan, were enrolled for this study. Pelvic examination and colposcopy were performed by the same colposcopist (C.T.Y.). Healthy women who visited the hospital for routine Papanicolaou test during the same period were randomly invited as healthy controls. A standard guideline issued by the National Health Research Institute, Taiwan, for screening, diagnosis, and management of cervical neoplasia ( was followed in all subjects. The exclusion criteria included previous diagnosis of HPV-related genital lesions or neoplasia, current pregnancy, absence of the uterine cervix, history of cancer at other sites, and history of immune compromise diseases. A total of 73 women, including 17 healthy controls (normal tissue), 10 with CIN1, 18 with CIN2, 14 with CIN3 (including 7 CISs), and 14 with invasive cancers were engaged in this study. All the CINs and invasive cancers were confirmed by histologic examination. The age range of the 73 women at enrollment were approximately 22 to 85 years (mean [SD], 48.5 [1.7] years; Table 1). For the characterization of the field methylation in cancer lesions and normal tissues, cervical cancer patients underwent radical hysterectomy, noncancer women underwent total hysterectomy on account of benign uterine tumors, and patients with gynecologic cancers of a noncervical origin were recruited for tissue procurement. The study was approved by the institutional review board of the Tzu Chi General Hospital, and informed consent was obtained from each subject before the study.

Table 1
Table 1
Image Tools
Back to Top | Article Outline
Clinical Specimens

Cervical scrapings were collected by a cytobrush before colposcopy, cervical biopsy, or other cervical procedures. The swabs were transferred into a universal tube containing 3 mL of phosphate-buffered saline. After thorough agitation, they were then dispensed, snap frozen, and stored at −80°C. For the procurement of tissues from topologically different sites, surgical tissues were carefully procured in respect to their anatomic locations and nature of the tumor lesions. Primary and metastatic cancers, as well as normal cervix adjacent to a cancer lesion (NNC), and normal tissues remote to the cervical cancer lesion (NCx), such as those from the vagina and the endometrium, were procured during the radical hysterectomy. Tissue specimens were collected in multiple tubes and snap frozen in liquid nitrogen. This procedure was typically completed within 20 minutes after tissue resection. Overall, the studied tissues included 23 invasive cancers, 4 metastatic lesions, 11 normal tissues from noncancer patients, 11 NNCs, and 5 NCx's. All specimens were procured under an institutional review board-approved project of the tissue banking system of Tzu-Chi General Hospital.

Back to Top | Article Outline
Human Papillomavirus Test

Infection of high-risk HPV in the specimens was detected by the Hybrid Capture 2 (HC2) test (Digene, Silver Spring, Md). In brief, the DNA in a specimen was denatured and hybridized with a cocktail of RNA probes directed against a panel of 13 high-risk HPVs. The RNA-DNA hybrids were then captured by hybrid-specific antibodies and detected by alkaline phosphatase-linked second antibody and chemiluminescence. The coefficients of variation of the triplicate tests of both the positive and negative controls were approximately 3% to 7%, and the ratio of the positive to negative mean was approximately 3.2:4.9.

Back to Top | Article Outline
DNA Preparation, MSP, and Quantitative MSP Assay

DNA of cervical scrapings was extracted using the QIAmp tissue kit (Qiagen, Hilden, Germany). For detection of DNA methylation, we used the EZ DNA Methylation-Gold Kit (Zymo Research, California) to convert cytocines to uracils, whereas methylated cytosines remained unmodified. For gel-based MSP of the PAX1 gene, bisulfite-converted DNA was PCR-amplified with methylation-specific primers (forward, 5′TATTTTGGGTTTGGGGTCGC3′; reverse, 5′CCCGAAAACCGAAAACCG3′) and non-methylation-specific primers (forward: 5′GTTTATTTTGGGTTTGGGGTTGTG3′; reverse: 5′CACCCAAAAACCAAAAACCAC3′) in a PCR master mix reagent Kit (Roche Diagnostic, Mannheim, Germany). The PCR program included an initiation at 94°C for 10 minutes, 40 cycles of annealing at 64°C for 30 seconds, extension at 72°C for 30 seconds, denaturing at 94°C for 30 seconds, and a final extension at 72°C for 7 minutes. The MSP products were resolved in 2.0% agarose gel containing ethidium bromide and visualized under UV light. For quantitative PCR of PAX1 methylation, primers and Taqman probe (TIB MOLBIOL, Berlin, Germany) specific to previously defined methylated CpG sites in cervical cancer11 were designed. The forward primer (5′CGGTTAGACGAATTTTTTTTAATCGGATGA3′) recognized 3 methylated CpG sites, the reverse primer (5′CCCGCGACCCCAAAC3′) recognized 2 methylated CpG sites, and the Taqman probe (FAM-5′CGCCCGCTCCAAAACCTA3′-TAMARA) recognized 2 methylated CpG sites. The beta-actin gene (ACTB) was used as internal reference, with the sequences of forward primer, reverse primer, and Taqman probe as 5′TGGTGATGGAGGAGGTTTAGTAAGT3′, 5′ACCACCACCCAACACACAATAACAAACACA3′, and FAM-5′ ACCAATAAAACCTACTCCTCCCTTAA3′-TAMARA, respectively.

Quantitative MSP (QMSP) analyses of PAX1 and ACTB were each performed by using the Roche LightCycler (Roche Diagnostics, Mannheim, Germany) and the Taqman kit (Roche Diagnostics) with the primers and the Taqman probes described previously. They were carried out with the same protocol consisting of a denaturing at 95°C for 10 minutes, followed by 50 cycles of denaturing at 95°C for 10 seconds and annealing/elongation at 60°C for 30 seconds. Genomic DNA of human peripheral blood leukocytes (white blood corpuscles [WBC]) treated with Sss-I methyltransferase (sWBC) served as the fully methylated control and was used for calibration of PCR efficiency in serial dilutions. The efficiencies of QMSP for methylated PAX1 (EPAX1) and ACTB (EACTB) were 1.977 and 2.053, respectively, indicating a high efficiency and good lineality of DNA amplification. Differences of quantities of methylated PAX1 and ACTB were measured in both test samples and Sss-1-treated WBC by the difference of the PCR cycle number needed to reach the crossing point or ΔCP. The percentage of methylated reference (PMR)17 of the PAX1 gene was calculated by the equation proposed by Pfaffl18: PMR = (EPAX1)ΔCP (sWBC−Sample)PAX1/(EACTB)ΔCP (sWBC−Sample)ACTB × 100.

Back to Top | Article Outline
Statistical Analysis

GraphPad Prism (version 5.0a) software was used for statistical analyses and data plotting. The PMR values obtained by QMSP were transformed as a function of ln(PMR + 1) and plotted according to clinical status to get the cutoff point that could best discriminate disease versus nondisease. The Mann-Whitney U test was used to analyze the distribution of age of the study subjects and the PMR values of the PAX1 gene. The Fisher exact and χ2 tests for trend were used to analyze the status of PAX1 methylation or HPV infection in the different groups.

Back to Top | Article Outline


Cervical Scrapings of Cancer and CIN3 Patients Had High PMR Values of PAX1

The proportion of methylation of the PAX1 gene was determined by QMSP in cervical scrapings obtained from the patients with various degrees of cervical neoplasia and from the healthy controls. The PMR value of PAX1 varied widely, depending on the extent of cervical dysplasia, and displayed a tendency closely related to the progression of cervical carcinogenesis (Table 1). Specifically, invasive cervical cancers and CIN3 had significant higher PMR values than the groups with less severe disease (P < 0.0001).

Back to Top | Article Outline
A Cutoff Value of RMR Readily Distinguish Malignant From Nonmalignant Cervical Neoplasia

Based on the pooled data of PAX1 methylation rates in the subjects with different severities of cervical neoplasia, the cutoff value that best distinguishes cancerous (CIS and invasive cancer) from noncancerous (CIN and normal tissue) conditions of the uterine cervix was determined. At a PMR cutoff value of 4.5, 100% of the invasive cancer and 43% of the CIN3 (including CIS) specimens were positive for PAX1 methylation compared with 0% for the normal, 10% for CIN1, and 11% for CIN2 specimens (Fig. 1, Table 2). At this cutoff value, specimens positive for invasive cancer were more significant than the noncancerous specimens (P < 0.0001). As a comparison, the HC2 HPV test result was positive in 100% of the invasive cancer and 47.5% of noncancerous specimens. Noteworthily, HPV was present in 70% and 5.9% of the benign conditions of CIN1 and the normal tissues, respectively, but PAX1 methylation was present in only 10% and 0%, respectively (Table 2).

Figure 1
Figure 1
Image Tools
Table 2
Table 2
Image Tools
Back to Top | Article Outline
PAX1 Methylation Test Was as Sensitive and Much More Specific Than the HC2 HPV Test in Detection of Cancer in the Studied Cohort

We compared the performance of QMSP for PAX1 to the HC2 HPV test on the cervical scraping of the same cohort of cervical neoplasia. In the detection of invasive cervical cancer, both tests had 100% sensitivity and negative predictive value, but PAX1 methylation was more specific (84.7% vs 52.5%) and had a higher positive predictive value (60.9% vs 33.3%) than the HC2 test. In the detection of CIN3 and invasive cervical cancer, the sensitivity, the specificity, and the positive and negative predictive values of PAX1 methylation and HPV tests were respectively 71.4% vs 85.7%, 93.3% vs 60.0%, 87.0% vs 57.1%, and 84.0% vs 87.1% (Table 3).

Table 3
Table 3
Image Tools
Back to Top | Article Outline
A Field Effect of PAX1 Methylation in Cervical Cancer and Adjacent Normal Tissues may Facilitate the Detection of Cancer-Associated Methylation From Cervical Scrapings

Primary and metastatic cancer tissues and normal tissues adjacent to or remote from the primary cancer lesion were procured from patients who underwent radical hysterectomy for invasive cervical carcinoma and tested for PAX1 methylation by MSP (Table 4). As shown in Table 5, methylation of PAX1 was found in 1 of 11 normal cervical tissues from noncancer patients (normal next to tumor), 2 of 5 normal tissues remote to cervical cancer (NCx), 9 of 11 normal cervical tissues adjacent to cervical cancer (NNC), 21 of 23 primary cervical cancer tissues, and 4 of 4 metastatic cervical cancer tissues.

Table 4
Table 4
Image Tools
Table 5
Table 5
Image Tools
Back to Top | Article Outline


In the development of cervical cancer, the PAX1 gene is silenced by hypermethylation.11 Using a methylation-specific PCR test of cervical scrapings, we have previously shown that PAX1 methylation was specifically found in most invasive cervical cancer specimens, in half of CIN2 or CIN3, and rarely in CIN1 and normal specimens in a hospital-based cohort in North Taiwan.11 In this study, QMSP was conducted to examine the extent of methylation in another cohort in East Taiwan. We found a progressive increase in the level of PAX1 methylation in cervical scrapings in the spectrum of cervical neoplasia and a marked increase of methylation levels in CIN3 and invasive cancer.

The methylation silencing of the PAX1 gene during cervical cancinogenesis suggests a tumor suppressor role of this paired boxed (PAX) gene. The PAX gene family has been classified into 4 classes.19-21 Members of the class 1 and 3 PAX genes are proposed to play an essential role in maintaining tissue-specific stem cells and have been found to be overexpressed in the development of several cancers.19-21 Members of classes 1 and 4, where PAX1, PAX4, PAX6, and PAX9 belong to, are much less overexpressed in cancer.22 In fact, PAX6 and PAX9 have been reported to be associated with favorable clinical outcomes,23,24 and PAX6 has a tumor-suppressive function in glioblastoma cells.25 Although the structural differences between these 2 groups of PAX genes may explain the contradictory functions in tumorigenesis,22 we hypothesize that members of classes 1 and 4 of the PAX gene family function as tumor suppressors in organs in which they do not normally have a developmental role. Recently, PAX4, known to be important in the development of gastrointestinal system, was reported to function as a tumor suppressor in human melanoma.26 Our study suggested a potential tumor suppressor role for PAX1 in cervical carcinogenesis, given its normal function in the development of the skeleton, thymus, and parathyroid glands.

The quantitative measurement of methylated gene in reference with a fully methylated standard by using real-time PCR is merited by its high sensitivity and consistency.17,27 The specificity of the CpG site detection can be further assured by the Taqman probe. In our design, the forward and reverse primers recognized 3 and 2 methylated CpG sites, respectively, and 2 additional sites were recognized by the Taqman probe. Furthermore, measurement of fluorescence-labeled amplicons allows for accurate, sensitive, and quantitative measurement of the amplicons. In this studied hospital-based cases and controls, at a selected cutoff value for the QMSP test, all the normal and most of the CIN1 and CIN2 specimens were negative for PAX1 gene methylation, whereas all the invasive cervical cancer specimens were positive.

Cervical scraping has long been a target for testing for cervical neoplasia and has been used here to detect cancer-specific gene methylation. The low representation of cancer cells in the cervical scrapings may not be of concern because the epigenetic change in cancer may act in a field.28,29 Indeed, as we have shown here and previously,27 methylation of PCDH10 and PAX1 genes acted in a field in cervical cancer and in the grossly normal-appearing adjacent tissues but not in the remote tissues. The field methylation may be a reflection of carcinogenic environment such as inflammation or hormone exposure or the stromal reaction that precedes the invasion of cancer.30 The field methylation of genes related to cancer invasion helps to a sensitive detection of it in cervical scrapings. It also provides a possibility of testing of cervicovaginal secretions self-sampled by women, as that has been done for HPV test. The feasibility of this deserves further investigation.

In current practice, the Papanicolaou test is used to screen for cervical cancer and the HPV test can facilitate the diagnosis when performed on the scrapings remaining after the Papanicolaou test. With the aid of the HPV test, which is highly sensitive and has a high negative predictive rate, screening with Papanicolaou test can be more sensitive and greatly increase its screening interval.31 Testing for HPV is also helpful in prediction and guiding the management of equivocal or low-grade Papanicolaou test results. However, owing to its low specificity and high false positive rate, the HPV test cannot be used alone as a screening or diagnostic tool. As shown in this study, the methylation test of the PAX1 gene was both sensitive and specific in detecting cervical cancer from cervical scrapings and thus can be a good candidate for in vitro testing of cervical cancer.

In summary, in this hospital-based study, the PAX1 QMSP test can be as sensitive as but much more specific than the HPV test in detecting cervical cancer. Further studies in larger cohorts and in screening/postscreening populations are warranted to prove its efficacy in diagnosis and screening.

Back to Top | Article Outline


1. Parkin DM. The global health burden of infection-associated cancers in the year 2002. Int J Cancer. 2006;118:3030-3044.

2. Levi AW, Kelly DP, Rosenthal DL, et al. Atypical squamous cells of undetermined significance in liquid-based cytologic specimens: results of reflex human papillomavirus testing and histologic follow-up in routine practice with comparison of interpretive and probabilistic reporting methods. Cancer. 2003;99:191-197.

3. Huang YK, You SL, Yuan CC, et al. Long-term outcomes of high-risk human papillomavirus infection support a long interval of cervical cancer screening. Br J Cancer. 2008;98:863-869.

4. Dillner J, Rebolj M, Birembaut P, et al. Long term predictive values of cytology and human papillomavirus testing in cervical cancer screening: joint European cohort study. BMJ. 2008;337:a1754.

5. Jones P, Laird P. Cancer epigenetics comes of age. Nat Genet. 1999;21:163-167.

6. Jones PA, Baylin SB. The epigenomics of cancer. Cell. 2007;128:683-692.

7. Steenbergen RD, Kramer D, Braakhuis BJ, et al. TSLC1 gene silencing in cervical cancer cell lines and cervical neoplasia. J Natl Cancer Inst. 2004;96:294-305.

8. Feng Q, Balasubramanian A, Hawes SE, et al. Detection of hypermethylated genes in women with and without cervical neoplasia. J Natl Cancer Inst. 2005;97:273-282.

9. Lai HC, Lin YW, Chang CC, et al. Hypermethylation of two consecutive tumor suppressor genes, BLU and RASSF1A, located at 3p21.3 in cervical neoplasias. Gynecol Oncol. 2007;104:629-635.

10. Kahn SL, Ronnett BM, Gravitt PE, et al. Quantitative methylation-specific PCR for the detection of aberrant DNA methylation in liquid-based Pap tests. Cancer. 2008;114:57-64.

11. Lai H, Lin Y, Huang T, et al. Identification of novel DNA methylation markers in cervical cancer. Int J Cancer. 2008;123:161-167.

12. McGaughran JM, Oates A, Donnai D, et al. Mutations in PAX1 may be associated with Klippel-Feil syndrome. Eur J Hum Genet. 2003;11:468-474.

13. Wallin J, Eibel H, Neubuser A, et al. Pax1 is expressed during development of the thymus epithelium and is required for normal T-cell maturation. Development. 1996;122:23-30.

14. Schnittger S, Rao V, Deutsch U, et al. Pax1, a member of the paired box-containing class of developmental control genes, is mapped to human chromosome 20p11.2 by in situ hybridization (ISH and FISH). Genomics. 1992;14:740-744.

15. Su HY, Lai HC, Lin YW, et al. An epigenetic marker panel for screening and prognostic prediction of ovarian cancer. Int J Cancer. 2009;124:387-393.

16. Eads C, Danenberg K, Kawakami K, et al. MethyLight: a high-throughput assay to measure DNA methylation. Nucleic Acids Res. 2000;28:E32.

17. Ogino S, Kawasaki T, Brahmandam M, et al. Precision and performance characteristics of bisulfite conversion and real-time PCR (MethyLight) for quantitative DNA methylation analysis. J Mol Diagn. 2006;8:209-217.

18. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45.

19. Lang D, Powell SK, Plummer RS, et al. PAX genes: roles in development, pathophysiology, and cancer. Biochem Pharmacol. 2007;73:1-14.

20. Galindo RL, Allport JA, Olson EN. A Drosophila model of the rhabdomyosarcoma initiator PAX7-FKHR. Proc Natl Acad Sci U S A. 2006;103:13439-13444.

21. Souabni A, Jochum W, Busslinger M. Oncogenic role of Pax5 in the T-lymphoid lineage upon ectopic expression from the immunoglobulin heavy-chain locus. Blood. 2007;109:281-289.

22. Robson EJ, He SJ, Eccles MR. A PANorama of PAX genes in cancer and development. Nat Rev Cancer. 2006;6:52-62.

23. Zhou YH, Tan F, Hess KR, et al. The expression of PAX6, PTEN, vascular endothelial growth factor, and epidermal growth factor receptor in gliomas: relationship to tumor grade and survival. Clin Cancer Res. 2003;9:3369-3375.

24. Gerber JK, Richter T, Kremmer E, et al. Progressive loss of PAX9 expression correlates with increasing malignancy of dysplastic and cancerous epithelium of the human oesophagus. J Pathol. 2002;197:293-297.

25. Zhou YH, Wu X, Tan F, et al. PAX6 suppresses growth of human glioblastoma cells. J Neurooncol. 2005;71:223-229.

26. Hata S, Hamada J, Maeda K, et al. PAX4 has the potential to function as a tumor suppressor in human melanoma. Int J Oncol. 2008;33:1065-1071.

27. Coleman WB, Rivenbark AG. Quantitative DNA methylation analysis: the promise of high-throughput epigenomic diagnostic testing in human neoplastic disease. J Mol Diagn. 2006;8:152-156.

28. Wang KH, Liu HW, Lin SR, et al. Field methylation silencing of the protocadherin 10 gene in cervical carcinogenesis as a potential specific diagnostic test from cervical scrapings. Cancer Sci. 2009;100:2175-2180.

29. Hanson JA, Gillespie JW, Grover A, et al. Gene promoter methylation in prostate tumor-associated stromal cells. J Natl Cancer Inst. 2006;98:255-261.

30. Jones PA, Baylin SB. The epigenomics of cancer. Cell. 2007;128:683-692.

31. Huang Y, You S, Yuan C, et al. Long-term outcomes of high-risk human papillomavirus infection support a long interval of cervical cancer screening. Br J Cancer. 2008;98:863-869.

Cited By:

This article has been cited 2 time(s).

Oncology Reports
Identification of DNA methylation of SOX9 in cervical cancer using methylated-CpG island recovery assay
Wu, JH; Liang, XA; Wu, YM; Li, FS; Dai, YM
Oncology Reports, 29(1): 125-132.
Diagnostic Cytopathology
Triage of cervical cytological diagnoses of atypical squamous cells by DNA methylation of paired boxed gene 1 (PAX1)
Chao, TK; Ke, FY; Liao, YP; Wang, HC; Yu, CP; Lai, HC
Diagnostic Cytopathology, 41(1): 41-46.
Back to Top | Article Outline

PAX1; DNA methylation; Cervical cancer; HPV test; Field methylation

Copyright © 2010 by IGCS and ESGO


Article Tools



Article Level Metrics

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.

Connect With Us


For additional oncology content, visit LWW Oncology Journals on Facebook.