Skip Navigation LinksHome > May 2006 - Volume 47 - Issue 5 > Beneficial Effects of Combined Benazepril-Amlodipine on Card...
Journal of Cardiovascular Pharmacology:
doi: 10.1097/01.fjc.0000211750.01326.b3
Original Articles

Beneficial Effects of Combined Benazepril-Amlodipine on Cardiac Nitric Oxide, cGMP, and TNF-α Production After Cardiac Ischemia

Siragy, Helmy M. MD*; Xue, Chun MD*; Webb, Randy L. PhD

Free Access
Article Outline
Collapse Box

Author Information

*Department of Medicine, University of Virginia Health System, Charlottesville, VA

Novartis Institutes for Biomedical Research, East Hanover, NJ

Supported by Novartis Pharmaceuticals Corporation, East Hanover, NJ.

Reprints: Helmy M. Siragy, MD, Professor of Internal Medicine, Department of Internal Medicine, University of Virginia Health Science Center, 450 Ray C. Hunt Drive, Charlottesville, VA 22903 (e-mail: hms7a@virginia.edu).

Received for publication January 25, 2006; accepted March 17, 2006

Collapse Box

Abstract

The aim of this study was to determine if myocardial inflammation is increased after myocardial ischemia and whether angiotensin-converting enzyme inhibitors, calcium channel blockers, or diuretics decrease mediators of inflammation in rats with induced myocardial ischemia. Changes in cardiac interstitial fluid (CIF) levels of nitric oxide metabolites (NOX), cyclic guanosine 3′,5′-monophosphate (cGMP), angiotensin II (Ang II), and tumor necrosis factor-α (TNF-α) were monitored with/without oral administration of benazepril, amlodipine, combined benazepril-amlodipine, or hydrochlorothiazide. Using a microdialysis technique, levels of several mediators of inflammation were measured after sham operation or 30-minute occlusion of the left anterior descending coronary artery. Compared with sham animals, levels of CIF NOX and cGMP were decreased in animals with ischemia (P<0.001). Benazepril or amlodipine significantly increased NOX levels (P<0.05 vs. untreated ischemia), but only benazepril significantly increased cGMP (P<0.05). Combined benazepril-amlodipine further increased CIF NOX and cGMP (P<0.001), compared with either drug alone. CIF Ang II and TNF-α in sham animals did not change significantly. In animals with ischemia, CIF Ang II and TNF-α increased progressively. Amlodipine alone, benazepril alone, or combined benazepril-amlodipine significantly reduced TNF-α (P<0.01 for monotherapies and P<0.001 for combination therapy). Hydrochlorothiazide did not cause significant changes in NOX, cGMP, or TNF-α. Combination benazepril-amlodipine may be beneficial for managing cardiac ischemia.

Central to the pathogenesis of cardiovascular disease and its clinical sequelae in the current paradigm are oxidative stress and endothelial dysfunction with subsequent neurohormonal imbalances causing inflammation, remodeling, vasoconstriction, thrombosis, and plaque rupture.1,2 Among the important mediators whose balance is disrupted by endothelial dysfunction are nitric oxide (NO) and angiotensin II (Ang II). NO is anti-inflammatory and reduces circulating free radicals, fibrosis, and matrix deposition. Further, NO increases blood flow and cyclic guanosine 3′,5′-monophosphate (cGMP) production. The NO-cGMP pathway is antihypertrophic.3 The Ang II type 2 receptor is up-regulated in left ventricular hypertrophy and is coupled to NO-cGMP signaling. The NO-cGMP pathway may, therefore, be an important protective mechanism to prevent left ventricular hypertrophy, ventricular dilatation, and heart failure.

Ang II is a potent vasoconstrictor that magnifies endothelial dysfunction, decreases NO, and induces inflammatory states by enhancing release of interleukin (IL)-6 and other inflammatory markers. Nuclear factor-κB (NF-κB) is central to the inflammatory response, stimulating expression of tumor necrosis factor-α (TNF-α), IL-1, IL-6, and, via a feedback pathway, further NF-κB production.4,5 NF-κB is found in many cell types and is a target for anti-inflammatory treatments.

Several classes of drugs used to treat cardiovascular diseases have the potential to improve this pathologic neurohormonal imbalance. The angiotensin-converting enzyme (ACE) inhibitor benazepril reduces levels of Ang II, fibrosis, and collagen deposition.6 Treatment with an ACE inhibitor attenuates infarct expansion and decreases the rates of reinfarction and heart failure. ACE inhibitors are recognized as first-line therapy in patients with myocardial infarction on the basis of findings from several large clinical trials that demonstrated significant reductions in the risk of fatal and nonfatal cardiovascular events.7–9

The calcium channel blocker (CCB) amlodipine has demonstrated beneficial effects on NO and cGMP and also decreasing fibrosis in a rat model of hypertension.10,11 Results from the Anglo-Scandinavian Cardiac Outcomes Trial-Blood Pressure Lowering Arm (ASCOT-BPLA), which was designed as a comparison of combination treatment regimens, showed that amlodipine with or without an ACE inhibitor reduced cardiovascular and total mortality compared with a β-blocker with or without a diuretic.12

Diuretics have long been the mainstay of antihypertensive drug regimens. A meta-analysis demonstrated reductions in stroke, heart failure, coronary disease, and mortality with diuretics.13 More recently, results of the Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT) suggested that diuretics may have cardioprotective effects.14

The exact mechanisms by which these drugs confer cardiac protection are not known; nor is it known whether combination treatment with an ACE inhibitor and a CCB provides additive benefit in myocardial ischemia. In this study, we hypothesized that ACE inhibitors, CCBs, or diuretics may reduce some mediators of myocardial inflammation that may relate to cardiac remodeling. We evaluated changes in cardiac interstitial fluid (CIF) levels of nitrate/nitrite (NOX), cGMP, Ang II, and TNF-α during treatment with the ACE inhibitor benazepril, the CCB amlodipine, the combination, or hydrochlorothiazide (HCTZ) after induction of myocardial ischemia in a rat model.

Back to Top | Article Outline

METHODS

All study procedures were performed in accordance with National Institutes of Health guidelines for the care and use of laboratory animals, and the study was approved by the University of Virginia Animal Care and Use Committee.

Back to Top | Article Outline
Cardiac Microdialysis Technique

Using a microdialysis technique, CIF levels of NOX, cGMP, Ang II, and TNF-α were monitored 5 weeks after sham or left anterior descending coronary artery (LAD) occlusion. The methodology for the microdialysis probe procedure has been described previously.15–17 In brief, each end of a single hollow fiber dialysis tube (5.0 mm long, 0.1 mm internal diameter) with a molecular mass cutoff of 40,000 d (Hospal, Meyzieu, France) was inserted into a manually dilated end of 2 hollow polyethylene tubes 100 mm in length (inflow and outflow) with internal diameter of 0.12 mm and outer diameter of 0.65 mm. The respective in vitro recoveries by dialysis probes of cold and radiolabeled Ang II are 48% and 51%; for cGMP, the respective values are 59% and 70%. Recovery of these peptides in the perfusate is >99.8%, indicating that negligible amounts adhere to the polyethylene tube of the dialysis probes.15

Levels of CIF NOX, cGMP, Ang II, and TNF-α were measured in conscious animals on day 35 after myocardial ischemia or sham surgery. All CIF measurements were performed at the same time on collection days.

Back to Top | Article Outline
Animal Preparation

Sixty male Lewis inbred rats (Charles River Laboratories, Wilmington, MA) were housed in an air-conditioned room with a 12-hour light/dark cycle and were fed standard laboratory rat chow with free access to tap water. Three days after surgery, ischemic animals began treatment orally by gavage with benazepril 40 mg/kg/d, amlodipine 10 mg/kg/d, combined benazepril-amlodipine at those same dosages, HCTZ 3 mg/kg/d, or 5% dextrose in water vehicle; sham-operated animals also received 5% dextrose in water vehicle. There were 10 animals in each group, and treatment lasted for 5 weeks.

The animals were intubated and ventilated with room air using a positive-pressure respirator (680; Harvard Apparatus, Inc, South Natick, MA). A left thoracotomy was performed via the fourth intercostal space, and the lungs were retracted to expose the heart. With the pericardium open, the left ventricular wall was penetrated with a 31-gauge needle that was tunneled into the distribution area of the LAD approximately 1 mm from the outer surface for 5 mm before exiting the wall. The tip of the needle was inserted into one end of the dialysis probe and pulled until the dialysis fiber was situated in the wall of the left ventricle. Inflow and outflow tubes of the dialysis probe were tunneled subcutaneously through a bevel-tipped stainless-steel tube, emerging near the interscapular region. Coronary artery ligation was performed as described previously,18 and the LAD was ligated for 30 minutes near its origin by using a 7-0 silk suture. The lungs were inflated by increasing positive end-expiratory pressure, and the thoracotomy site was closed in layers. Animals undergoing sham ligation were subjected to a similar surgical procedure, except that the suture was not tightened around the coronary artery. Animals remained on a heating pad until they were awake. Cardiac examination at the study end confirmed the location of the dialysis catheter and presence of an infarction in the groups of animals with LAD ligation.

Back to Top | Article Outline
Hemodynamic Measurements

Blood pressure and heart rate were monitored using a Natsumi BP Pulse Monitor (Peninsula Laboratories, Belmont, CA).

Back to Top | Article Outline
Analytical Methods

NOX was monitored indirectly because the study was conducted in fully conscious animals at week 5. CIF NOX and cGMP levels in dialysate samples, measured by enzyme immunoassay kit (Cayman Chemical Co Inc, Ann Arbor, MI), had a sensitivity of 2.5 μmol/L for NOX and 0.11 pmol/mL for cGMP and a specificity of 100% for both assays. The intra-assay and interassay cross-reactivity of the assays with other cyclic nucleotides was <0.01%. Cardiac interstitial samples of Ang II were collected in tubes containing a mixed inhibitor solution of 5 mmol/L ethylenediaminetetraacetic acid, 10 nmol/L pepstatin, 20 nmol/L enalaprilat, and 0.125 mmol/L 1,10-phenanthroline and were kept on ice. Levels of Ang II, measured by enzyme-linked immunosorbent assay (SPI bio, F-78180 Montigny le Bretonneux, distributed by Cayman Chemical), had a sensitivity of 0.5 pg/mL for Ang II. Cardiac interstitial samples of TNF-α were measured by enzyme-linked immunosorbent assay using OptEIA Sets (sensitivity: <4 pg/mL with assay range: 15.6 to 1000 pg/mL; Pharmingen, San Diego, CA).

Back to Top | Article Outline
Quantitative Real-time Reverse Transcription-Polymerase Chain Reaction

Quantitative real-time reverse transcription-polymerase chain reaction was conducted for inflammatory markers IL-6 and NF-κB (n=8 in each group). After removal, cardiac tissue was weighed promptly and homogenized on ice, and total cardiac RNA was extracted using RNeasy Kit (Qiagen, GmbH, Hilden, Germany). RNA quality was confirmed by ethidium bromide staining in 2% agarose gel. Single-stranded cDNA was synthesized using iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). Exon-intron boundaries were determined using the University of California Santa Cruz Genome Bioinformatics Site (http://www.genome.ucsc.edu). Corresponding cDNA primers were selected from M26744, AF079314, and BC063166, the gene codes for rat IL-6 (forward sequence: gcccttcaggaacagctatg; reverse sequence: tgaagtagggaaggcagtgg; length 101 bp), NF-κB p65 (forward sequence: tctgggccatatgtggagat; reverse sequence: tgcttctctccccaggaata; length 106 bp), and β-actin (forward sequence: agccatgtacgtagccatcc; reverse sequence: accctcatagatgggcacag; length 115 bp) sequences. The specificity of the primers was verified by melting curves. Quantitative reverse transcription-polymerase chain reaction was performed using iCycler software (Bio-Rad, Hercules, CA). Nontemplate control was used as a negative control. Samples were calculated with normalization to β-actin. Fold downexpression or upexpression was calculated according to the formula 2(Rt−Et)/2(Rn−En), where Rt is the threshold cycle number for the reference gene observed in the test sample, Et is the threshold cycle number for the experimental gene observed in the test sample, Rn is the threshold cycle number for the reference gene observed in the control sample, and En is the threshold cycle number for the experimental gene observed in the control sample.

Back to Top | Article Outline
Histology Procedure

The animals were sacrificed at the end of the study, and the hearts were fixed with 4% paraformaldehyde in phosphate-buffered saline. Cardiac tissues were then embedded in paraffin, sectioned as 4 to 5 μm thick, and stained with eosin-hematoxylin. The histology evaluation was observed under light microscopy.

Back to Top | Article Outline
Statistical Methods

The CIF levels were expressed as mean±standard error. Comparisons between pharmacologic agents in LAD-ligated and sham-treated animals were made by 1-way analysis of variance. Comparisons between treatment groups were examined using the t test. Statistical significance was declared at P<0.05.

Back to Top | Article Outline

RESULTS

There was no change in blood pressure or heart rate in any of the treatment groups.

Back to Top | Article Outline
Cardiac NOX: Responses to Ischemia, Benazepril, Amlodipine, HCTZ, or Combined Benazepril-Amlodipine

Five weeks after surgery, mean CIF NOX levels in sham animals (Fig. 1) were 1.8±0.37 μmol/L. In contrast, mean CIF NOX levels were 0.44±0.14 μmol/L in untreated animals with LAD occlusion (P<0.001). In animals with ischemia, treatment with either amlodipine or benazepril alone caused a significant increase in mean CIF NOX levels to 1.29±0.28 and 1.78±0.37 μmol/L, respectively (P<0.05 vs. untreated ischemia). Coadministration of benazepril and amlodipine caused a further increase in mean CIF NOX levels, compared with either drug alone, to 2.42±0.25 μmol/L (P<0.001 vs. untreated ischemia). HCTZ caused no significant change in mean CIF NOX levels (0.44±0.07 μmol/L) in animals with ischemia.

Figure 1
Figure 1
Image Tools

The response of NOX to combination benazepril-amlodipine was greater than to either drug administered as monotherapy. In animals treated with benazepril or benazepril-amlodipine, NOX concentrations were similar to sham at week 5.

Back to Top | Article Outline
Cardiac cGMP: Responses to Ischemia, Benazepril, Amlodipine, HCTZ, or Combined Benazepril-Amlodipine

Five weeks after surgery, mean CIF cGMP levels in sham animals (Fig. 2) were 1.32±0.44 pmol/mL. In untreated animals with LAD occlusion, mean CIF cGMP levels were 0.68±0.08 pmol/mL (P<0.001). In animals with ischemia, treatment with benazepril alone, but not amlodipine alone (0.80±0.12 pmol/mL), caused a significant increase in mean CIF cGMP levels to 1.16±0.17 pmol/mL (P<0.05). Coadministration of benazepril and amlodipine caused a further increase in mean CIF cGMP levels to 1.36±0.34 pmol/mL (P<0.001) when compared with either drug alone. HCTZ caused no significant change in mean CIF cGMP levels (0.74±0.31 pmol/mL) in animals with ischemia.

Figure 2
Figure 2
Image Tools
Back to Top | Article Outline
Cardiac TNF-α: Responses to Ischemia, Benazepril, Amlodipine, HCTZ, or Combined Benazepril-Amlodipine

At week 5, the respective mean CIF Ang II and TNF-α levels were 8.44±1.36 fmol/mL and 26.3±2.1 pg/mL in sham animals. After LAD occlusion, Ang II reached a mean level of 36.54±4.28 fmol/mL and TNF-α a mean level of 130±22 pg/mL at week 5 (Fig. 3). Treatment with amlodipine, benazepril, or combined benazepril-amlodipine caused a significant reduction in CIF TNF-α in ischemic animals at week 5. The respective mean levels of CIF TNF-α for amlodipine, benazepril, and combined benazepril-amlodipine were 76±20 pg/mL (P<0.01), 53.7±32 pg/mL (P<0.01), and 39.5±8 pg/mL (P<0.001). The increase in CIF TNF-α levels observed after ischemia was not reduced by HCTZ (104±40 pg/mL).

Figure 3
Figure 3
Image Tools
Back to Top | Article Outline
Cardiac Inflammatory Markers: Responses to Ischemia, Benazepril, Amlodipine, HCTZ, or Combined Benazepril-Amlodipine

After LAD occlusion, mean CIF IL-6 (Fig. 4) and NF-κB (Fig. 5) levels were increased significantly (P<0.001) at week 5 as compared with levels in sham animals. Treatment with benazepril or amlodipine alone caused significant reductions in mean CIF IL-6 (P<0.001) and NF-κB (P<0.001 and P<0.05, respectively) levels in ischemic animals at week 5. Combination treatment with benazepril-amlodipine caused a further decrease in mean CIF IL-6 and NF-κB levels compared with either drug alone. The increases in CIF IL-6 and NF-κB levels observed after ischemia were not significantly reduced by HCTZ.

Figure 4
Figure 4
Image Tools
Figure 5
Figure 5
Image Tools
Back to Top | Article Outline
Qualitative Cardiac Structural Changes in Response to Ischemia, Benazepril, Amlodipine, HCTZ, or Combined Benazepril-Amlodipine

Compared with normal hearts, ligation of LAD caused cardiac wall necrosis and cell infiltration (Fig. 6). Neither amlodipine nor HCTZ treatment was beneficial in limiting infarct expansion. However, benazepril clearly attenuated infarct expansion. Combination treatment with benazepril-amlodipine attenuated infarct expansion and inflammatory cellular infiltration, and preserved cardiac structure to a greater extent than treatment with either drug alone or HCTZ.

Figure 6
Figure 6
Image Tools
Back to Top | Article Outline

DISCUSSION

The results of this study confirm that postmyocardial ischemia, there is a reduction in CIF levels of NOX and cGMP and increases in Ang II and the inflammatory mediator TNF-α. HCTZ had no effect on postischemia CIF levels for any of the parameters measured. Both benazepril and amlodipine significantly increased CIF levels of NOX after ischemia, with benazepril and combination of benazepril-amlodipine having more pronounced effects. Benazepril also increased cGMP significantly, as did combination of benazepril-amlodipine. In contrast, amlodipine did not increase cGMP postischemia. Combined benazepril-amlodipine caused a significant reduction in TNF-α levels when compared with either drug alone. Similar findings for other inflammatory mediators (IL-6 and NF-κB) reinforce the results for TNF-α. Histologic results showed that combined benazepril-amlodipine preserved cardiac structure in this model of myocardial ischemia.

In the present study, we used a unique microdialysis technique to monitor changes in cardiac interstitial levels of Ang II, NOX, cGMP, and TNF-α. This technique has several advantages over traditional methods conducted in blood or urine.17 It allows measurement of CIF in vivo at the site of ischemia, close to target receptors, and over time in conscious animals without causing undesirable hemodynamic changes that may occur with repeated blood sampling in small animals. Acute studies allow only a single measurement of tissue or circulating factors and may not reflect local tissue changes in the organ or concentrations in the interstitial space. In addition, plasma measurements of NOX and other autocoids may not accurately reflect target organ concentrations because they can be formed and degraded quickly. Finally, the molecular weight cutoff of the dialysis membrane functions as a barrier excluding undesirable substances such as carrier proteins and degrading enzymes. The isolation of unbound materials facilitates their bioanalytical measurement in a small volume without the need for additional extraction procedures.

The central role of the renin-angiotensin system in the pathogenesis of cardiovascular disease is well established. Elevated levels of Ang II, a potent vasoconstrictor, combined with a reduction in NO levels, enhances vasoconstriction, inflammation, and the atherogenic process.1,19,20 Blocking the formation of Ang II with an ACE inhibitor increases NO availability, improving flow-mediated vasodilation, blood flow, and cGMP production as well as reducing oxidant stress and inflammation in the endothelium.3,19,21–23 Ang II may activate phosphodiesterases, which degrade intracellular cGMP, and may be associated with the finding in the present study that monotherapy with amlodipine or benazepril increased NOX, whereas only benazepril increased cGMP.24 Results of the present study support the importance of ACE inhibition as a mechanism for restoring the balance in the NO-cGMP pathway to prevent inflammation, ischemia, and cardiac hypertrophy. Benazepril alone significantly improved CIF levels of NOX, cGMP, and inflammatory markers, and attenuated infarct expansion.

CCBs also have beneficial effects on the NO-cGMP pathway and fibrosis in cardiovascular disease.10,11 Improvements in blood flow and endothelial function with amlodipine are linked to antioxidant effects and improved kinin-mediated NO production, suggesting that CCBs may modulate myocardial oxygen consumption.21,22,25,26 Inhibition of proinflammatory cytokines by CCBs is also related to enhanced NO levels and reduction in superoxide production, independent of their calcium channel-blocking activity.27,28 Similar to the findings in the present study, ex vivo studies have shown reductions in the production of TNF-α, IL-6, and NF-κB with CCBs.5,29 Significant reductions in IL-6 have been reported in patients with heart failure treated for 26 weeks with amlodipine.30 Although the present study did not show that amlodipine attenuated infarct expansion, a study in dogs reported that nifedipine limited infarct size by an NO-dependent mechanism.31

Most patients with hypertension require combination therapy to achieve blood pressure goals. Greater blood pressure-lowering effects with benazepril-amlodipine have been demonstrated than with a number of monotherapies,32 and reductions in cardiovascular and total mortality were shown with amlodipine plus the ACE inhibitor perindopril in the hypertension arm of the ASCOT trial.12 The ACE inhibitor-CCB combination examined in the present study is being evaluated in the Avoiding Cardiovascular events through COMbination therapy in Patients Living with Systolic Hyperension (ACCOMPLISH) trial, an ongoing outcome trial comparing benazepril-amlodipine with benazepril-HCTZ.33,34

The rationale for combination therapy with an ACE inhibitor-CCB is based on their synergistic effect on endothelial function and also pathogenic mechanisms of cardiovascular disease, including modulating myocardial oxygen consumption.35–37 This regimen, however, has not been studied in postmyocardial infarction patients.

The present study provides insight into possible mechanisms of clinical benefit from combined ACE inhibitor-CCB treatment in patients with cardiac ischemia. Combined benazepril-amlodipine had a greater effect on all parameters measured than either drug alone. Moreover, attenuation of infarct expansion and preservation of cardiac structure was greater with combined benazepril-amlodipine than with benazepril alone.

In conclusion, the present study shows that combination therapy with benazepril-amlodipine may be beneficial for the management of patients with cardiac ischemia.

Back to Top | Article Outline

REFERENCES

1. Dzau VJ. Tissue angiotensin and pathobiology of vascular disease: a unifying hypothesis. Hypertension. 2001;37:1047–1052.

2. McMurray J, Pfeffer MA. New therapeutic options in congestive heart failure: part I. Circulation. 2002;105:2099–2106.

3. Booz GW. Putting the brakes on cardiac hypertrophy: exploiting the NO–cGMP counter-regulatory system. Hypertension. 2005;45:341–346.

4. Kopp EB, Ghose S. NF-κB and rel proteins in innate immunity. Adv Immunol. 1995;58:1–27.

5. Matsumori A, Nunokawa Y, Sasayama S. Nifedipine inhibits activation of transcription factor NF-κB. Life Sci. 2000;67:2655–2661.

6. Toblli JE, DeRosa G, Cao G, et al. ACE inhibitor and angiotensin type I receptor antagonist in combination reduce renal damage in obese Zucker rats. Kidney Int. 2004;65:2343–2359.

7. Pfeffer MA, Braunwald E, Moyé LA, et al. Effect of captopril on mortality and morbidity in patients with left ventricular dysfunction after myocardial infarction: results of the Survival and Ventricular Enlargement trial. N Engl J Med. 1992;327:669–677.

8. The Acute Infarction Ramipril Efficacy (AIRE) Study Investigators. Effect of ramipril on mortality and morbidity of survivors of acute myocardial infarction with clinical evidence of heart failure. Lancet. 1993;342:821–828.

9. Køber L, Torp-Pedersen C, Carlsen JE, et al. A clinical trial of the angiotensin-converting-enzyme inhibitor trandolapril in patients with left ventricular dysfunction after myocardial infarction. N Engl J Med. 1995;333:1670–1676.

10. Ganafa AA, Walton M, Eatman D, et al. Amlodipine attenuates oxidative stress-induced hypertension. Am J Hypertens. 2004;17:743–748.

11. Sevilla MA, Voces F, Carrón R, et al. Amlodipine decreases fibrosis and cardiac hypertrophy in spontaneously hypertensive rats: persistent effects after withdrawal. Life Sci. 2004;75:881–891.

12. Dahlöf B, Sever PS, Poulter NR, et al. Prevention of cardiovascular events with an antihypertensive regimen of amlodipine adding perindopril as required versus atenolol adding bendroflumethiazide as required, in the Anglo-Scandinavian Cardiac Outcomes Trial-Blood Pressure Lowering Arm (ASCOT-BPLA): a multicentre randomised controlled trial. Lancet. 2005;366:895–906.

13. Psaty BM, Smith NL, Siscovick DS, et al. Health outcomes associated with antihypertensive therapies used as first-line agents: a systematic review and meta-analysis. JAMA. 1997;277:739–745.

14. The ALLHAT Officers and Coordinators for the ALLHAT Collaborative Research Group. Major outcomes in high-risk hypertensive patients randomized to angiotensin-converting enzyme inhibitor or calcium channel blocker vs diuretic: the Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial (ALLHAT). JAMA. 2002;288:2981–2997.

15. Siragy H, de Gasparo M, El-Kersh M, et al. Angiotensin-converting enzyme inhibition potentiates angiotensin II type 1 receptor effects on renal bradykinin and cGMP. Hypertension. 2001;38:183–186.

16. Siragy HM, Carey RM. The subtype-2 (AT2) angiotensin receptor regulates renal cyclic guanosine 3′,5′-monophosphate and AT1 receptor-mediated prostaglandin E2 production in conscious rats. J Clin Invest. 1996;97:1978–1982.

17. Siragy HM, Carey RM. The subtype 2 (AT2) angiotensin receptor mediates renal production of nitric oxide in conscious rats. J Clin Invest. 1997;100:264–269.

18. Liu YH, Yang XP, Nass O, et al. Chronic heart failure induced by coronary artery ligation in Lewis inbred rats. Am J Physiol. 1997;272:H722–H727.

19. Schulman IH, Zhou M-S, Raij L. Nitric oxide, angiotensin II, and reactive oxygen species in hypertension and atherogenesis. Curr Hypertens Rep. 2005;7:61–67.

20. Schiffrin EL, Touyz RM. From bedside to bench to bedside: role of renin-angiotensin-aldosterone system in remodeling of resistance arteries in hypertension. Am J Physiol Heart Circ Physiol. 2004;287:H435–H446.

21. Zhang X, Recchia FA, Bernstein R, et al. Kinin-mediated coronary nitric oxide production contributes to the therapeutic action of angiotensin-converting enzyme and neutral endopeptidase inhibitors and amlodipine in the treatment of heart failure. J Pharmacol Exp Ther. 1999;288:742–751.

22. On Y-K, Kim C-H, Oh B-H, et al. Effects of angiotensin converting enzyme inhibitor and calcium antagonist on endothelial function in patients with essential hypertension. Hypertens Res. 2002;25:365–371.

23. Hryniewicz K, Dimayuga C, Hudaihed A, et al. Inhibition of angiotensin-converting enzyme and phosphodiesterase type 5 improves endothelial function in heart failure. Clin Sci. 2005;108:331–338.

24. Watanabe T, Barker T, Berk BC. Angiotensin II and the endothelium: diverse signals and effects. Hypertension. 2005;45:163–169.

25. Zhou M-S, Jaimes EA, Raij L. Inhibition of oxidative stress and improvement of endothelial function by amlodipine in angiotensin II-infused rats. Am J Hypertens. 2004;17:167–171.

26. Forfia PR, Zhang X, Knight DR, et al. NO modulates myocardial O2 consumption in the nonhuman primate: an additional mechanism of action of amlodipine. Am J Physiol Heart Circ Physiol. 1999;276:H2069–H2075.

27. Chou T-C, Yang S-P, Pei D. Amlodipine inhibits pro-inflammatory cytokines and free radical production and inducible nitric oxide synthase expression in lipopolysaccharide/interferon-γ-stimulated cultured vascular smooth muscle cells. Jpn J Pharmacol. 2002;89:157–163.

28. Kataoka C, Egashira K, Isibashi M, et al. Novel anti-inflammatory actions of amlodipine in a rat model of arteriosclerosis induced by long-term inhibition of nitric oxide synthesis. Am J Physiol Heart Circ Physiol. 2004;286:H768–H774.

29. Matsumori A, Ono K, Nishio R, et al. Amlodipine inhibits the production of cytokines induced by ouabain. Cytokine. 2000;12:294–297.

30. Mohler ER III, Sorensen LC, Ghali JK, et al. Role of cytokines in the mechanism of action of amlodipine: the PRAISE heart failure trial. J Am Coll Cardiol. 1997;30:35–41.

31. Asanuma H, Kitakaze M, Funaya H, et al. Nifedipine limits infarct size via NO-dependent mechanisms in dogs. Basic Res Cardiol. 2001;96:497–505.

32. Faulkner MA, Hilleman DE. Amlodipine/benazepril: fixed dose combination therapy for hypertension. Expert Opin Pharmacother. 2001;2:165–178.

33. Jamerson KA. The first hypertension trial comparing the effects of 2 fixed-dose combination therapy regimens on cardiovascular events: Avoiding Cardiovascular Events Through Combination Therapy in Patients Living With Systolic Hypertension (ACCOMPLISH). J Clin Hypertens. 2003;5:29–35.

34. Jamerson KA, Bakris GL, Wun C-C, et al. Rationale and design of the Avoiding Cardiovascular events through COMbination therapy in patients LIving with Systolic hypertension (ACCOMPLISH) trial: the first randomized controlled trial to compare the clinical outcome effects of first-line combination therapies in hypertension. Am J Hypertens. 2004;17:793–801.

35. Ruschitzka FT, Lüscher TF. Is there a rationale for combining angiotensin-converting enzyme inhibitors and calcium antagonists in cardiovascular disease? Am Heart J. 1997;134:S31–S47.

36. Ferrari R. Angiotensin converting enzyme inhibitor-calcium antagonist combination: an alliance for cardioprotection? J Hypertens. 1997;15:S109–S117.

37. Mital S, Loke KE, Slater JP, et al. Synergy of amlodipine and angiotensin-converting enzyme inhibitors in regulating myocardial oxygen consumption in normal canine and failing human hearts. Am J Cardiol. 1999;83:92H–98H.

Cited By:

This article has been cited 20 time(s).

Experimental & Clinical Cardiology
Beneficial effect of combination therapy using an angiotensin-converting enzyme inhibitor plus verapamil on circulating resistin levels in hypertensive patients with type 2 diabetes
Rubio-Guerra, AF; Vargas-Robles, H; Nuevo, JJL; Elizalde-Barrera, CI; Huerta-Ramirez, S; Escalante-Acosta, BA
Experimental & Clinical Cardiology, 17(4): 202-204.

American Journal of Cardiology
Comparison of Benazepril Plus Amlodipine or Hydrochlorothiazide in High-Risk Patients With Hypertension and Coronary Artery Disease
Bakris, G; Briasoulis, A; Dahlof, B; Jamerson, K; Weber, MA; Kelly, RY; Hester, A; Hua, T; Zappe, D; Pitt, B
American Journal of Cardiology, 112(2): 255-259.
10.1016/j.amjcard.2013.03.026
CrossRef
Current Pharmaceutical Design
Which is the Optimal Antihypertensive Combination in Different Diseases, a Renin-Angiotensin-aldosterone System Inhibitor with a Diuretic or with a Calcium Channel Blocker?
Riva, N; Lip, GYH
Current Pharmaceutical Design, 19(): 3753-3765.

Atherosclerosis
Ceramide: A common pathway for atherosclerosis?
Bismuth, J; Lin, P; Yao, QZ; Chen, CY
Atherosclerosis, 196(2): 497-504.
10.1016/j.atherosclerosis.2007.09.018
CrossRef
Journal of Pharmacy and Pharmacology
Enhancement of amlodipine cardioprotection by quercetin in ischaemia/reperfusion injury in rats
Ahmed, LA; Salem, HA; Attia, AS; El-Sayed, ME
Journal of Pharmacy and Pharmacology, 61(9): 1233-1241.
10.1211/jpp/61.09.0014
CrossRef
American Journal of Health-System Pharmacy
Combination therapy for the management of hypertension: A review of the evidence
Sood, N; Reinhart, KM; Baker, WL
American Journal of Health-System Pharmacy, 67(): 885-894.
10.2146/ajhp090419
CrossRef
Clinical and Experimental Hypertension
The effect of trandolapril and its fixed-dose combination with verapamil on circulating adhesion molecules levels in hypertensive patients with type 2 diabetes
Rubio-Guerra, AF; Vargas-Robles, H; Vargas-Ayala, G; Rodriguez-Lopez, L; Escalante-Acosta, BA
Clinical and Experimental Hypertension, 30(7): 682-688.
10.1080/10641960802251941
CrossRef
American Journal of Hypertension
Effects of calcium channel and renin-angiotensin system blockade on intravascular and neurohormonal mechanisms of hypertensive vascular disease
Mizuno, Y; Jacob, RF; Mason, RP
American Journal of Hypertension, 21(): 1076-1085.
10.1038/ajh.2008.258
CrossRef
Journal of Clinical Hypertension
Will the Results of the ACCOMPLISH Trial Affect the Recommendations of JNC 8?
Cohen, DL; Townsend, RR
Journal of Clinical Hypertension, 11(2): 100-101.
10.1111/j.1751-7176.2009.00075.x
CrossRef
Journal of Clinical Hypertension
Risk-Based Classification of Hypertension and the Role of Combination Therapy
Weir, MR
Journal of Clinical Hypertension, 10(1): 4-12.

Lancet
Renal outcomes with different fixed-dose combination therapies in patients with hypertension at high risk for cardiovascular events (ACCOMPLISH): a prespecified secondary analysis of a randomised controlled trial
Bakris, GL; Sarafidis, PA; Weir, MR; Dahlof, B; Pitt, B; Jamerson, K; Velazquez, EJ; Staikos-Byrne, L; Kelly, RY; Shi, V; Chiang, YT; Weber, MA
Lancet, 375(): 1173-1181.
10.1016/S0140-6736(09)62100-0
CrossRef
Journal of Clinical Hypertension
Combined Therapy With a Calcium Channel Blocker and an Angiotensin II Type 1 Receptor Blocker
Bakris, GL
Journal of Clinical Hypertension, 10(1): 27-32.

Journal of Human Hypertension
Targeting mechanisms of hypertensive vascular disease with dual calcium channel and renin-angiotensin system blockade
Weir, MR
Journal of Human Hypertension, 21(): 770-779.
10.1038/sj.jhh.1002254
CrossRef
Current Medical Research and Opinion
Efficacy and tolerability of amlodipine/valsartan combination therapy in hypertensive patients not adequately controlled on valsartan monotherapy
Sinkiewicz, W; Glazer, RD; Kavoliuniene, A; Miglinas, M; Prak, H; Wernsing, M; Yen, J
Current Medical Research and Opinion, 25(2): 315-324.
10.1185/03007990802630588
CrossRef
Postgraduate Medicine
Complementary Mechanisms of Angiotensin Receptor Blockers and Calcium Channel Blockers in Managing Hypertension
Neutel, JM
Postgraduate Medicine, 121(2): 40-48.

Pharmacological Reports
Influence of hypotensive drugs on lipopolysaccharide (LPS)-induced serum concentrations of tumor necrosis factor alpha (TNF-alpha), interleukin (IL)-1 beta, IL-6 in spontaneously hypertensive rats (SHR)
Andrzejczak, D; Gorska, D; Czarnecka, E
Pharmacological Reports, 59(): 183-191.

New England Journal of Medicine
Benazepril plus Amlodipine or Hydrochlorothiazide for Hypertension in High-Risk Patients
Jamerson, K; Weber, MA; Bakris, GL; Dahlof, B; Pitt, B; Shi, V; Hester, A; Gupte, J; Gatlin, M; Velazquez, EJ
New England Journal of Medicine, 359(): 2417-2428.

The American Journal of the Medical Sciences
Combination Therapy of Calcium Channel Blocker and Angiotensin II Receptor Blocker Reduces Augmentation Index in Hypertensive Patients
Doi, M; Miyoshi, T; Hirohata, S; Kamikawa, S; Usui, S; Kaji, Y; Sakane, K; Ogawa, H; Ninomiya, Y; Kusachi, S
The American Journal of the Medical Sciences, 339(5): 433-439.
10.1097/MAJ.0b013e3181d658c4
PDF (158) | CrossRef
Journal of Cardiovascular Pharmacology
Amlodipine Reduces the Antimigratory Effect of Diclofenac in Spontaneously Hypertensive Rats
Rodrigues, SF; dosSantos, RA; de Oliveira, MA; Rastelli, VM; Nucci, Gd; Tostes, Rd; Nigro, D; Carvalho, MH; Fortes, ZB
Journal of Cardiovascular Pharmacology, 51(5): 492-504.
10.1097/FJC.0b013e31816d1d37
PDF (1199) | CrossRef
Journal of Hypertension
Improving vascular function in hypertension: potential benefits of combination therapy with amlodipine and renin–angiotensin–aldosterone system blockers
Siragy, HM
Journal of Hypertension, 28(1): 2-8.
10.1097/HJH.0b013e328332bcf0
PDF (385) | CrossRef
Back to Top | Article Outline
Keywords:

amlodipine; angiotensin II; benazepril; cardiac interstitial fluid; cardiac ischemia; cGMP; nitric oxide; TNF-α

© 2006 Lippincott Williams & Wilkins, Inc.

Follow Us!

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.