Skip Navigation LinksHome > August 1998 - Volume 32 - Issue 2 > Chronic Effects of Enalapril and Amlodipine on Cardiac Remo...
Journal of Cardiovascular Pharmacology:
Articles

Chronic Effects of Enalapril and Amlodipine on Cardiac Remodeling in Cardiomyopathic Hamster Hearts

Watanabe, Masashi; Kawaguchi, Hideaki*; Onozuka, Hisao; Mikami, Taisei; Urasawa, Kazushi; Okamoto, Hiroshi; Watanabe, Satoshi; Abe, Kazuhiro; Kitabatake, Akira

Free Access
Article Outline
Collapse Box

Author Information

Departments of Cardiovascular Medicine and *Laboratory Medicine, and Third Department of Anatomy, Hokkaido University School of Medicine; and College of Medical Technology, Hokkaido University, Sapporo, Japan

Received September 2, 1997; revision accepted February 2, 1998.

Address correspondence and reprint requests to Dr. H. Kawaguchi at Department of Laboratory Medicine, Hokkaido University, School of Medicine. N-15, W-7, Kita-ku, Sapporo 060, Japan.

Collapse Box

Abstract

This study examined the effects of long-term treatments with the angiotensin-converting enzyme inhibitor, enalapril, and the calcium antagonist, amlodipine, on the morphologic changes, progressive left ventricular dysfunction, and gene expression of the ryanodine receptor (RyR) and phospholamban (PLN) in dilated cardiomyopathy. From the ages of 5 through 20 weeks, dilated cardiomyopathic hamsters, BIO53.58 (BIO), and control hamsters, F1b, orally received either enalapril or amlodipine. Cardiac function was assessed by echocardiography. At the age of 20 weeks, the collagen volume fractions were analyzed by the stereologic method. RyR and PLN messenger RNAs (mRNAs) were examined by Northern blot in the amlodipine group. In BIO, the reduction of left ventricular percentage of fractional shortening was attenuated in the enalapril group (p < 0.05) and amlodipine group (p < 0.001), and the increase in the collagen volume fraction and the loss of myocytes were suppressed in the amlodipine group compared with the untreated group. RyR mRNA level decreased in BIO (p < 0.01) compared with F1b, but PLN mRNA level was unchanged. RyR and PLN mRNA levels were unaffected by the treatment with amlodipine. Enalapril and amlodipine prevent progressive remodeling and reduce cardiac dysfunction in BIO. Amlodipine prevents fibrosis and cell death without modifying RyR and PLN mRNA levels in BIO.

The accumulation of fibrillar collagen in the cardiac interstitium is one of the major morphologic features of left ventricular (LV) hypertrophy accompanied by genetic hypertension, acquired hypertension, and myocardial infarction. This morphologic change is called structural remodeling and may account for the abnormal ventricular function that eventually leads to congestive heart failure. Several lines of evidence suggest that both circulating and tissue renin-angiotensin systems may be involved in the remodeling of the myocardium. Treatment with only a low dose of angiotensin-converting enzyme inhibitor (ACEI) without subsequent reduction of the blood pressure causes a decrease in LV hypertrophy (1). Treatment with the ACEI lisinopril has been shown to reverse interstitial collagen accumulation in spontaneously hypertensive rats with established LV hypertrophy (2). These results suggest that angiotensin II acts as a growth factor for myocytes and other cells in the heart. Angiotensin II may affect ventricular remodeling, as previously suggested, thus promoting myocyte hypertrophy (3). However, our understanding of the responsiveness of severely failing myocardium to ACEI treatment and its mechanism of action is incomplete.

Calcium antagonist therapy has been controversial in the treatment of congestive heart failure. Treatment with verapamil, diltiazem, and nifedipine showed deleterious effects in the patients with congestive heart failure. A clinical trial recently demonstrated the possibility that amlodipine prolongs survival in patients with nonischemic dilated cardiomyopathy (4). However, such an effect requires confirmation in a further trial. To clarify the mechanism of the effect, it is necessary to investigate the effect of amlodipine on the cardiac remodeling in dilated cardiomyopathy. To elucidate the mechanism of these effects of ACEI and calcium antagonists, we used an animal model of dilated cardiomyopathic Syrian hamster (BIO53.58 strain: BIO) and control golden hamster (F1b strain: F1b). Previous studies suggested that the cardiac myocytolysis is caused by calcium overloading of myopathic cardiomyocytes, which may arise from abnormal calcium handling by these cells. Calcium transport through sarcoplasmic reticulum (SR) is considered to be important in intracellular calcium handling. There are many reports about the gene expressions for Ca2+-transporting proteins of SR, such as ryanodine receptor (RyR), Ca2+ adenosine triphosphatase (ATPase), and phospholamban (PLN). Decreased levels of messenger RNA for these proteins are reported in heart failure and are believed to the cause of abnormal calcium handling. However, the effect of therapy on these gene expressions remains uncertain. The purposes of our study were as follows: (a) to investigate the relation between the changes of extracellular matrix and cardiac function in an animal model of dilated cardiomyopathy; (b) to evaluate the effects of long-term treatments with the ACEI enalapril and the calcium antagonist amlodipine on the morphologic changes in the extracellular matrix, as well as progressive LV dysfunction; and (c) to evaluate gene expression of RyR and PLN in these cardiomyopathic hamsters, in addition to investigating whether amlodipine alters such gene expression.

Back to Top | Article Outline

MATERIALS AND METHODS

Experimental animals

The BIO53.58 strain of cardiomyopathic Syrian hamster develops abnormalities of the cardiac and skeletal muscles that are inherited as an autosomal recessive trait (5). The Syrian cardiomyopathic hamster is an inbred strain with genetic cardiomyopathy (6) that has been used as a model of human hereditary cardiomyopathy. In the heart of the BIO53.58 hamster, myocytolytic lesions start to develop at the age of 5-6 weeks. Such myocytolytic lesions subsequently heal with fibrosis and calcification. Between age 4 and 20 weeks, BIO53.58 hamsters gradually develop cardiac dilation accompanied by diffuse cell death. This strain also has a significantly shorter life span and demonstrates reduced cardiac function at an earlier age than the hypertrophic cardiomyopathic hamster (BIO14.6 hamster; 7,8). In contrast to the BIO14.6 hamster, BIO53.58 hamsters do not develop myolysis or hypertrophy before dilation (9). Therefore the BIO53.58 hamster provides a good model of cardiac dilation and congestive heart failure. Experiments were carried out by using 30 male, dilated cardiomyopathic BIO53.58 hamsters, aged 5 weeks (BIO Breeders, Fitchburg, MA, U.S.A.). Male F1b hamsters (n = 30), a noncardiomyopathic F1 hybrid of BIO1.5 and BIO87.2 hamsters, were used as controls. BIO (i.e., BIO53.58 and F1b) hamsters were randomly assigned to one of three groups, receiving by food either enalapril (20 mg/kg/day, p.o.; Banyu Pharmaceutical Co., Ltd.; n = 10), amlodipine (10 mg/kg/day, p.o.; Pfizer Pharmaceutical Co., Ltd., n = 10), or no treatment (n = 10). The study period was 15 weeks. The investigation conformed with the Guide for the Care and Use of Laboratory Animals, published by the U.S. National Institutes of Health (NIH Publication No. 85-23, revised 1985).

Back to Top | Article Outline
Biochemical assays

Arterial blood samples were drawn at the age of 20 weeks. A portion of each blood sample was treated with disodium EDTA and immediately centrifuged in microcentrifuge tubes. Plasma and serum specimens were stored at −20°C.

Back to Top | Article Outline
Amlodipine treatment

Drug doses of 10 mg/kg body weight were chosen on the basis of reports of using amlodipine in spontaneously hypertensive rats (10). Serum amlodipine concentrations were obtained to establish whether each animal fed a diet containing amlodipine actually received sufficient drug. At the age of 20 weeks, serum was collected from each animal, and amlodipine concentration was measured by high-performance liquid chromatography with an electron-capture detection system. Serum amlodipine concentrations in BIO and F1b were 16.5 ± 3.8 and 15.8 ± 2.6 ng/ml, respectively. These levels were considered sufficient to dilate the vascular smooth muscle.

Back to Top | Article Outline
Enalapril treatment

Drug doses of 20 mg/kg body weight were chosen on the basis of reports of using enalapril in cardiomyopathic hamsters (11,12). To confirm that each animal actually received sufficient drug, plasma renin activity in BIO and F1b was measured by radioimmunoassay and found to be higher than those in the no-treatment group (BIO: 12.0 ± 2.0 vs. 3.72 ± 0.88 ng/ml/h; p < 0.0001) and (F1b: 6.2 ± 3.0 vs. 2.38 ± 1.35 ng/ml/h; p < 0.01). Plasma angiotensin II was also measured by radioimmunoassay and showed no significant differences between untreated and enalapril treatment groups.

Back to Top | Article Outline
Echocardiography

During the study period, we performed transthoracic echocardiography on each hamster under urethane anesthesia (0.5 mg/g body mass, intraperitoneal injection) with an ultrasound system (Hitachi EUB565A), by using a 7.5 MHz transducer, which gives a good resolution in the assessment of small animals' hearts (13). The weight of hamster investigated was 60-140 g, and the heart rate was 400-500 beats/min. The precordiums of hamsters were shaved, and hamsters were lightly secured in the prone position on the balloon filled with an air-free water. The transducer was applied to the balloon, and through it, an anatomically validated transthoracic echocardiography was performed. Simultaneously electrocardiograms were recorded. The heart was first imaged in the two-dimensional mode in the parasternal long-axis or parasternal short-axis views or both. These views were used to position the M-mode cursor perpendicular to the ventricular septum and LV posterior wall, after which M-mode images were obtained at the level of the chordae tendineae. The LV posterior wall and ventricular septum were clearly defined by M-mode echocardiography; those positions oscillate at a frequency of 400-500 cycles/min, reflecting the heart rate. LV internal dimensions were measured by using the conventional "leading edge" method (14) from at least three consecutive cardiac cycles on the M-mode tracings. Heart rate was obtained by the M-mode tracings and electrocardiograms. The M-mode recordings were analyzed by one of two observers blinded to the group of hamsters (untreated, or treated with enalapril or amlodipine) they were investigating. Percentage of fractional shortening (%FS) was calculated as the percentage difference between the left ventricular end-diastolic (LVDd) and end-systolic dimensions (LVDs): Equation (1)

Equation 1
Equation 1
Image Tools

Intraobserver and interobserver differences were calculated as the difference between two observations divided by the mean of the observations and were expressed as percentages. Intraobserver and interobserver variabilities of LV dimension measurement in our method were 2.6 ± 2.6% and 6.0 ± 3.6% (mean ± SD), respectively.

Back to Top | Article Outline
Tissue preparation

Before the animals were killed, they were anesthetized with diethylethel. The chest was opened by median sternotomy, and the heart was removed from the animal. Atria, great vessels, and valvular structures were trimmed away and weighed after the blood was carefully washed out with saline. The right and left ventricle from the hamster of each group was used for a histologic analysis. The left ventricle (plus septum) obtained by trimming away a right ventricular free wall was weighed and used for a biochemical analysis.

Back to Top | Article Outline
Histologic analysis

The right and left ventricles were fixed with 10% formaldehyde, embedded in paraffin after dehydration through a graded alcohol series, and cut transversely (perpendicular to the long axis) from aortic root to the apex, a set of 40-50 sequential, 8-μm-thick sections.

The distance between sections was 200 μm. The investigator responsible for the morphometric analysis was blinded as to each experimental group.

Back to Top | Article Outline
Collagen volume fraction

The serial sections were stained with Gomori's aldehyde fuchsin by using the Masson-Goldner method (15,16). It stained the cytoplasm brick red and the collagen and mucus, bluish green. The area occupied with collagen was easily differentiated by the stain and the shape of a fiber from the myocyte area. Sections were also stained with von Kossa to identify the calcified area. For stereologic analysis, the very efficient and simple unbiased estimator of the volume of an arbitrary object is reported (17). The estimator of the volume, V, of an object can be obtained by slicing it exhaustively, starting at a random position within a length T, with a series of parallel planes a distance (T) apart, and measuring the area, A, of the object as it appears on each of the planes (Fig. 1A and B), Equation (2) where m is the number of sections. In this study, the sections were picked up at 400-μm intervals from serial sections and enlarged to 44× with a light microscope projector on a sheet of paper that had a regular triangle lattice of points spaced 20 mm from the nearest neighbors (Fig. 1C). At this magnification, each point was 0.45 mm apart in the sections and represented a hexagonal area, Equation (3)

Fig. 1
Fig. 1
Image Tools
Equation 2
Equation 2
Image Tools
Equation 3
Equation 3
Image Tools
Equation 4
Equation 4
Image Tools

The number of points lying within the feature of interest (e.g., myocytes, vessels, or fibrotic collagen area) was counted on each slice. The corresponding point counts were P1, P2,...Pm, respectively. Subsequently, multiplying the total number of test points counted in all images, by the area associated with each point, S, gives an estimate of the total area of the feature on the sections. Subsequent multiplication by the slice interval, T, gives an estimate of the feature volume (i.e. Eq. 2 is modified to Equation (4)

The volume of right and left ventricles (VT) was divided into the volume of myocytes (VM), calcification(Vcal), vessels (Vcap), and the fibrous connective tissue (VF): Equation (5)

Equation 5
Equation 5
Image Tools

Then collagen volume fraction (R) was calculated as follows. Equation (6)

Equation 6
Equation 6
Image Tools

In this study, a set of 20 to 25 parallel planes was selected to estimate the sectional area, and total point counts were 4,000-6,000 for the estimation of one right and LV volume. The precision of the estimator V (i.e. Eq. 4) may be measured by its coefficient of error or relative standard error: CE (V) = SE (V)/V. To predict CE (V), a special formula has been developed over the years (18). A recent report showed that the unbiased estimation of the volumes of a heart chamber was obtained by the use of magnetic resonance imaging (MRI) and stereology, and it presented the formula for calculating the coefficient of error, CE (19). By the use of the formula, CE (VT) and (VF) in our study were predicted as 1.7% and 3.5%. We previously showed that total collagen volume fraction determined by this morphometric approach is closely related to hydroxyproline concentration (20).

Back to Top | Article Outline
Myocyte breadth and numerical nuclear density of myocytes

The section that had the largest diameter of the left ventricle was selected from the serial sections and stained with periodic acid-Schiff (PAS) hematoxylin to measure myocyte breadth and to count numerical nuclear density by the use of the conventional stereologic methods (21-23).

Myocyte breadth. Short diameters of myocytes were measured by using an eyepiece micrometer with a 1-μm scale at a magnification of ×1,000. Lines that ran transversely on the LV wall were selected from the anterior, lateral, posterior, and septal walls. The myocyte diameters were measured along the line from epicardium to endocardium. The mean value was used as a representative value for each specimen.

Numeric nuclear density. Numbers of myocyte nuclei were counted in 16 randomly selected fields from the LV myocytes space through an eyepiece with a 250 μm-square micrometer at a magnification of ×400 under a light microscope. Only nuclei, and only those belonging to ventricular myocytes in the area apart from the focal necrosis, were counted. The nuclei that seemed to have degenerated were not counted. Nuclear number is equal to cardiomyocyte number only if each cell contains one nucleus. Myocytes are known to vary in nuclear content. In this study, a few binucleates were found, and the numbers of their nuclei were counted as single. Therefore nuclear number can be thought of as viable myocyte number.

Back to Top | Article Outline
Northern blot analysis

Three cDNA probes were used for Northern blot analyses, a probe for cardiac RyR mRNA, a 1,348-bp HindIII fragment of pHRR105 (recombinant Bluescript KS plasmid; 24) corresponding to nucleotides 5,071-6,418 of rabbit cardiac RyR cDNA, a probe for a 159-bp PLN mRNA fragment corresponding to nucleotides of the coding region of BIO hamster PLN cDNA, and a probe for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA-a Xba I/HindIII fragment of cDNA (57091; American Type Culture Collection, Rockville, MD, U.S.A.). All cDNA probes were uniformly labeled with random primers by using Klenow and [α-32P]dCTP. The PLN cDNA probe was cloned from BIO hamster heart total RNA. Sense and antisense primers, PHL-185S (ATGGAAAAAGTCCAATACCT) and PHL-343A (TCACAGAAGCATCAC-AATGA) respectively, were designed based on the published sequence for the rat heart phospholamban (25; numbers designating each oligonucleotide refer to the position in the published sequence). The polymerase chain reaction products were separated from primers on low-melt agarose gels, and a 159-bp cDNA product was excised, purified, and subcloned into pBluescript (Stratagene, La Jolla, CA, U.S.A.). Each preparation of total RNA was isolated from a LV tissue sample by using TRIzol reagent (GIBCO BRL Cat. No. 15596-018). Forty micrograms of denatured RNA was size fractionated on 2% formaldehyde/1.2-1.5% agarose gels and then transferred onto nylon membrane (Pall Biodyne) overnight by using ×20 saline sodium citrate (SSC) transfer buffer. Northern blot analysis was carried out according to the established method (26). Each membrane was exposed at −80°C on x-ray films (X-OMAT; Eastman Kodak, Rochester, NY, U.S.A.) with a single intensifying screen for increasing exposure times to obtain signals in the linear range for densitometric analysis of each mRNA species. The GAPDH mRNA diffuse density score used as an internal control has been shown to be unchanged in the cardiomyopathic hamster.

Back to Top | Article Outline
Statistical analysis

Values are given as mean ± SD. Relations between parameters were evaluated by least-squares linear-regression analysis. Comparisons between two groups were performed with unpaired t test, and comparisons among three groups were performed with one-way factorial analysis of variance (ANOVA). A value of p < 0.05 was considered the limit of significance.

Back to Top | Article Outline

RESULTS

Spontaneous course of the BIO53.58 cardiomyopathic hamster

A LV-to-body weight ratio in BIO was larger than in F1b hamsters. The echocardiography showed that the LVDd of the left ventricles of BIO hamsters was significantly enlarged in cardiomyopathic hamsters at age 20 weeks as compared with age-matched F1b hamsters (Fig. 2A). The %FS of the left ventricles of BIO hamsters was significantly decreased at age 5 weeks and decreased further at age 20 weeks as compared with age-matched F1b hamsters (Fig. 2B). Histopathologic study showed the LV cavity was dilated, and the LV wall was thin in 20-week-old BIO compared with 5-week-old BIO (Fig. 3A and B). In F1b, no significant fibrosis was recognized, and the LV wall was kept thick throughout the study period (Fig. 3C and D). Cardiac myocytes of the left ventricle were enlarged in BIO at the age of 20 weeks, whereas they remained normal in size in F1b (Fig. 4A and D). As reported in many studies (27), the pathologic accumulation of collagen had distinct morphologic presentations. It appeared around intramyocardial coronary arteries and arterioles, where it represents a perivascular fibrosis. From this perivascular location, fibrillar collagen extended into the interstitial space, where it represents an interstitial fibrosis. Discrete focal collections of fibrillar collagen were quite distinct from perivascular/interstitial fibrosis. They represent microscopic scars that replace lost cardiac myocytes. Sometimes calcium deposits were seen within the focal fibrotic lesions. Interstitial fibrotic areas and discrete focal fibrotic areas were mainly counted by systematic point counting. Fibrotic collagen areas were distributed from aortic root to apex. The collagen volume fraction was large at the coronal sections and reduced as the sections approached aortic root or apex. The PAS-positive materials, which are glycosaminoglycans, components of the fibrous connective tissue, occupied more thickly the interstitial space between myocytes, and myocytes were hypertrophic and loosely located with each other in BIO compared with F1b (Fig. 4A-D), reflects that individual myocytes were encircled by collagen fibers even where the apparent interstitial or focal fibrotic lesions did not exist. In F1b, no significant fibrotic lesions were noted, and the ratio of fibrotic lesions to ventricular area was very small (less than a few percent). Therefore, data on fibrosis in F1b are not shown in this report. Morphometry showed myocyte breadth is larger (Fig. 5A), and the numerical nuclear density was reduced (Fig. 5B) in BIO compared with F1b. The decrease in the numerical nuclear density was due to the myocyte hypertrophy, degeneration or atrophy of myocytes, myocytolysis, and the collagen fibers accumulated between myocytes. All these histopathologic properties appear to have a deleterious effect on cardiac function. The numeric nuclear density of myocytes had a good correlation with %FS (r = 0.82; p < 0.0001; Fig. 6).

Fig. 2
Fig. 2
Image Tools
Fig. 3
Fig. 3
Image Tools
Fig. 3
Fig. 3
Image Tools
Fig.  4
Fig. 4
Image Tools
Fig. 4
Fig. 4
Image Tools
Fig.  5
Fig. 5
Image Tools
Fig. 6
Fig. 6
Image Tools
Back to Top | Article Outline
Effects of enalapril and amlodipine treatment

Enalapril treatment did not significantly change LV/body weight ratios in BIO and F1b hamsters, as compared with hamsters that received no treatment (Table 1). The plasma renin activities in BIO and F1b treated with enalapril were higher than those in the no-treatment group (BIO, 12.0 ± 2.0 vs. 3.72 ± 0.88 ng/ml/h; p < 0.0001) and (F1b, 6.2 ± 3.0 vs. 2.38 ± 1.35 ng/ml/h; p < 0.01). This indicates that the dose of enalapril was enough to stimulate renin secretion by reducing blood pressure or negative feedback. Plasma angiotensin II also was measured by radioimmunoassay, and no significant differences were found between untreated and enalapril-treatment groups. Amlodipine did not significantly change LV/body weight ratios in BIO and F1b hamsters (Table 1). Serum amlodipine concentrations in BIO and F1b were 16.5 ± 3.8 and 15.8 ± 2.6 ng/ml, respectively. These levels were considered sufficient to dilate the vascular smooth muscle. Echocardiographic findings showed the increase of LVDd was significantly reduced in the enalapril and amlodipine group of BIO compared with the no-treatment group (Fig. 7A). The reduction of %FS was attenuated in the enalapril and amlodipine group of BIO compared with the no-treatment group (Fig. 7B). Heart rate was similar in all groups of BIO. However, whereas the heart rate of F1b was increased by the treatment with enalapril, the treatment with amlodipine did not increase it (Fig. 7C).

Table 1
Table 1
Image Tools
Fig. 7
Fig. 7
Image Tools

Histologic findings indicated that enalapril and amlodipine reduced both interstitial fibrosis and focal fibrotic lesions uniformly through the entire ventricles from aortic root to apex compared with the no-treatment group. The areas of calcification tended to decrease in enalapril (0.52 ± 0.49%) and amlodipine (0.31 ± 0.13%) groups compared with the no-treatment group (1.04 ± 0.66%). Myocyte size was smaller, and myocytes were more densely located in the enalapril and amlodipine groups (Fig. 4B and C) than in the no-treatment group (Fig. 4A). The increased PAS-positive materials in the interstitial spaces between myocytes of untreated BIO were reduced in the enalapril and amlodipine groups (Fig. 4A-C). The increase in collagen volume fraction tended to reduce in the enalapril group and significantly reduced in the amlodipine group compared with the notreatment group, whereas the ventricular volumes were similar in three groups of BIO (Table 2). Myocyte breadth tended to decrease (Fig. 5A), and the numeric nuclear density tended to increase in the enalapril group and significantly increased in the amlodipine group compared with the no-treatment group (Fig. 5B). Northern blot analysis of RyR mRNA demonstrated that RNA from control and cardiomyopathic hamsters hybridized to the cDNA probe specific for the cardiac RyR (Fig. 8A) and the cDNA specific for PLN (Fig. 8C). The cardiac RyR mRNA levels decreased in cardiomyopathic hamsters compared with control hamsters (Fig. 8B), and PLN mRNA levels did not change in BIO compared with F1b. At age 20 weeks, in both control and cardiomyopathic hamsters, there were no significant differences in the cardiac RyR and PLN mRNA levels between the amlodipine and the no-treatment groups.

Table 2
Table 2
Image Tools
Fig. 8
Fig. 8
Image Tools
Back to Top | Article Outline

DISCUSSION

Amlodipine-treatment group of cardiomyopathic hamsters

Echocardiography showed that amlodipine prevented cardiac dilation and improved cardiac systolic function in the 20-week-old cardiomyopathic hamsters. Histologic studies showed that amlodipine reduced not only the discrete focal fibrosis but also the interstitial fibrosis. Amlodipine suppressed myocytes necrosis and their replacement fibrosis, which appears as discrete focal collections of fibrillar collagen. Calcification, presumably representative of a chronic response to repeated injuries, was also suppressed. Amlodipine may ameliorate inflammation by preventing cell death and retarding the progression of cardiac dysfunction and heart failure. Amlodipine did not increase the heart rate in both BIO and F1b. It is postulated that neuroendocrine activation was weak in the amlodipine-treatment group, and the reactive fibrosis to these hormones, which appears as interstitial fibrosis, was suppressed. In the ventricles of BIO at the age of 20 weeks, the matrix of collagen fibers resembles hard tissues like bone (20,27). The prevention of collagen accumulation leads to reduce a ventricular stiffness and improve cardiac diastolic function. It is likely that the preservation of the numeric myocyte density by amlodipine is due to the prevention of the myocyte cell loss, hypertrophy, and fibrosis. All these effects favored the cardiac systolic functions. We expect that LV diastolic functions, such as transmitral LV filling pattern, may improve in the echocardiographic Doppler study. In this study, a diastolic function was not measured because of difficulty of discriminating the E wave (early filling velocities) and A wave (late filling velocities) at the heart rate of 400-500 beats/min. Preliminarily, we confirmed that amlodipine improved the diastolic function by hemodynamic study (data not shown). It was postulated that amlodipine improved calcium handling, ameliorated calcium overload, and prevented calcium-mediated cell death. Our studies demonstrated the downregulation of the RyR mRNA level in this animal model. Amlodipine did not modify the SR gene expressions of RyR and PLN. It seems that amlodipine ameliorated calcium overload of myocytes by inhibiting Ca2+ influx through sarcolemmal voltage-dependent Ca2+ channels and not by modifying gene expression of the RyR and PLN. A similar effect of amlodipine is shared with other calcium antagonists. Verapamil also showed a cardioprotective effect in the cardiomyopathic hamster (28-32). However, there is a report that nifedipine, which is more vascular selective than is verapamil, was completely inactive in preventing necrosis or calcium accumulation (33). In the cardiomyopathic hamster, the cardioprotective effect of dihydropyridines remains uncertain. It is believed that amlodipine exerts its beneficial effects by improving intracellular calcium handling in the failing heart. This study showed for the first time that dihydropyridine prevented cardiac cell death and fibrosis in the dilated cardiomyopathic hamster. Also we showed the correlation of a improved cardiac function with morphologic amelioration in the extracellular matrix. A dihydropyridine (e.g., nifedipine, amlodipine) is vascular selective, and its negative inotropic action is weak compared with verapamil. Unlike nifedipine, amlodipine is a long-acting Ca2+ channel antagonist with highly selective preference for the vascular system. Its effect on neuroendocrine activation is thought to be weak. All these properties of amlodipine contribute not only to the improvement of myocardial tissue but also to the amelioration of cardiac systolic function.

Back to Top | Article Outline
Enalapril-treatment group of cardiomyopathic hamsters

Enalapril improved cardiac function, prevented cardiac dilation, and tended to reduce fibrosis. Whereas amlodipine significantly inhibited myocyte cell death, the protective effect of enalapril on cell loss was weak. Therefore it is likely that the preventive effect of enalapril on replacement fibrosis was not so large as that of amlodipine. It is known that angiotensin II stimulates collagen synthesis in cultured cardiac fibroblasts (34). We found that plasma renin activity increased ∼3.5-fold compared with an untreated group of BIO hamsters. This indicates that the dose of enalapril was enough to stimulate renin secretion by reducing blood pressure or negative feedback by angiotensin II. In our study, circulating angiotensin II was not more reduced in the enalapril-treatment group than in the untreated group. However, the dose is considered to be sufficient to prevent a fibrosis by inhibiting tissue angiotensin II (11). Angiotensin II increases intracellular Ca2+ levels and vascular tone mainly through its action on phospholipase C and activation of Ca2+ influx by the L-type Ca2+ channels, and Ca2+ release from intracellular stores by the inositol triphosphate-sensitive C2+ release channels. Besides angiotensin II, various neurotransmitters and hormones affect vascular tone through the same signaling pathway as angiotensin II. Whereas enalapril mainly inhibits the effects of angiotensin II, amlodipine decreases vascular tone and microvascular spasm through modifying intracellular Ca2+ mobilization induced by these vasoconstrictors. It is one of the reasons that enalapril did not show so significant an effect as amlodipine in BIO hamsters. The second is the term of treatment. The 15-week ACEI treatment may not have been long enough to change the collagen metabolism, especially the degradation of collagen, even if angiotensin II-induced collagen synthesis was inhibited. In our preliminary experiments, enalapril treatment for 25 weeks significantly suppressed the fibrosis of ventricles in cardiomyopathic hamsters compared with the no-treatment group. The third is the stage of cardiomyopathy. We studied an early stage when myocyte necrosis starts from almost normal heart followed by replacement fibrosis and progressive LV dysfunction. In this stage, a myocytolysis due to calcium overload caused by the genetic sarcolemmal defect (6) has a major role in the pathogenesis of the disease, and a calcium antagonist, amlodipine, seems to be more advantageous in ameliorating calcium overload than is the ACEI, enalapril. There is a report that ACEI showed a cardioprotective effect in the later stage (12,35).

Back to Top | Article Outline
Study limitations

The method of calculating LV%FS used for estimating LV systolic function may be limited by the fact that afterload may be altered by treatment with drugs. The improvement of LV%FS may be due to a reduction in afterload, an improvement in contractility, or both. However, the good correlation between LV%FS and a numeric nuclear density of myocytes in this study indicates that the treatment with drugs improved the contractility itself. The second limitation is that BIO may be an atypical model of congestive heart failure relative to other animal models and human cardiomyopathic heart failure because of its severe multiple focal areas of myocytolytic necrosis. Although we should be cautious of applying our results to clinical settings, they can be related to human cardiac disease in which myocytolytic, noncoronogenic necrosis assumes a central role in the pathogenesis, such as late dilated cardiomyopathy and disorders of ischemia and reperfusion in which spasm of small arteries is suspected. Our result indicates that amlodipine shows a prophylactic effect if it is used from the early stage of cardiomyopathy before myocytolysis occurs.

Back to Top | Article Outline

CONCLUSIONS

Our results demonstrated the correlation of a improved cardiac function with the morphologic amelioration in the extracellular matrix. Enalapril suppresses fibrosis and improves cardiac function in the cardiomyopathic hamster. Amlodipine preserves myocyte viability by preventing cell death, suppresses fibrosis, and significantly improves cardiac function in the cardiomyopathic hamster. The effect of enalapril on prevention of cell loss is weak compared with that of amlodipine. Amlodipine was more effective for prevention of cardiac remodeling in the early stage of cardiomyopathy than was enalapril. It is postulated that the effect of amlodipine is due to the amelioration of cellular calcium overload. This study demonstrated differential gene expression of RyR and PLN (decreased expression of RyR and normal expression of PLN) in the cardiomyopathic hamster (BIO53.58), and amlodipine did not modify these gene expressions.

Acknowledgment: We are very grateful to Dr. Yasushi Takagi for cloning phospholamban cDNA. We also thank Ms. Fuyuko Kanda for her technical assistance.

Back to Top | Article Outline

REFERENCES

1. Sen S, Bumpus FM. Collagen synthesis in development and reversal of cardiac hypertrophy in spontaneously hypertensive rats. Am J Cardiol 1979;44:954-8.

2. Brilla CG, Janicki JS, Weber KT. Cardioreparative effects of lisinopril in rats with genetic hypertension and left ventricular hypertrophy. Circulation 1991;83:1771-9.

3. Baker KM, Aceto JF. Angiotensin II stimulation of protein synthesis and cell growth in chick heart cells. Am J Physiol 1990;259:H610-8.

4. Packer M, O'Connor CM, Ghali JK, et al., for the Prospective Randomized Amlodipine Survival Evaluation study group. Effect of amlodipine on morbidity and mortality in severe chronic heart failure. N Engl J Med 1996;335:1107-14.

5. Bajusz E. Hereditary cardiomyopathy: a new disease model. Am Heart J 1969;77:686-96.

6. Roberds SL, Ervasti JM, Anderson RD, et al. Disruption of the dystrophin-glycoprotein complex in the cardiomyopathic hamster. J Biol Chem 1993;268:11496-9.

7. Homburger F, Baker JR, Nixon CW, Whitney R. Primary generalized polymyopathy and cardiac necrosis in an inbred line of Syrian hamsters. Med Exp 1962;6:339-45.

8. Bajusz E, Baker JR, Nixon CW, Homburger F. Spontaneous hereditary myocardial degeneration and congestive heart failure in a strain of Syrian hamsters. Ann N Y Acad Sci 1969;156:105-29.

9. Strobeck JE, Factor SM, Bhan A, et al. Hereditary and acquired cardiomyopathies in experimental animals: mechanical, biochemical, and structural features. Ann N Y Acad Sci 1979;317:59-88.

10. Nayler WG. The effect of amlodipine on hypertension-induced cardiac hypertrophy and reperfusion-induced calcium overload. J Cardiovasc Pharmacol 1988;12(suppl 7):S41-4.

11. Mansoor MA, Honda M, Kuramochi T, Tanaka K, Morioka S, Takabatake T. Effects of ACE inhibition and beta-blockade on collagen remodelling in the heart of BIO14.6 hamsters. Clin Exp Pharmacol Physiol 1996;23:43-9.

12. Nascimben L, Friedrich J, Liao R, Pauletto P, Pessina CA, Ingwall SJ. Enalapril treatment increases cardiac pertormance and energy reserve via the creatine kinase reaction in myocardium of Syrian myopathic hamsters with advanced heart failure. Circulation 1995;91:1824-33.

13. Litwin SE, Katz SE, Weinberg EO, Lorell BH, Aurigemma GP, Douglas PS. Serial echocardiographic-Doppler assessment of left ventricular geometry and function in rats with pressure-overload hypertrophy: chronic angiotensin-converting enzyme inhibition attenuates the transition to heart failure. Circulation 1995;91:2642-54.

14. Crawford MH, Grant D, O'Rourke RA, Starling MR, Groves BM. Accuracy and reproducibility of new M-mode echocardiographic recommendations for measuring left ventricular dimensions. Circulation 1980;61:137-42.

15. Sano Y. Histological technics: theoretical and applied. Tokyo: Nanzando, 1976:1-868.

16. Goldner J. A modification of the Masson trichrome technique for routine laboratory purpose. Am J Pathol 1938;14:237-43.

17. Gundersen HJG, Jensen EB. The efficiency of systematic sampling in stereology and its prediction. J Microsc 1987;147:229-63.

18. Cruz-Ovie LM. Systematic sampling in stereology. Bull Intern Statist Inst 1993;55:451-68.

19. Roberts N, Cruz-Ovie LM, Bourne M, Herfkens RJ, Karwoski RA, Whitehouse H. Analysis of cardiac function by MRI and stereology. J Microsc 1997;187:31-42.

20. Okada H, Kawaguchi H, Kudo T, et al. Alteration of extracellular matrix in dilated cardiomyopathic hamster heart. Mol Cell Biochem 1996;156:9-15.

21. Weibel ER. Stereological method, Vol. 1: practical methods for biological morphometry. New York: Academic, 1979.

22. Weibel ER, Gromez DM. A principle for counting tissue structures on random sections. J Appl Physiol 1962;17:343-8.

23. Cruz-Ovie LM, Weibel ER. Recent stereological methods for cell biology: a brief survey. Am J Physiol 1990;258:L148-56.

24. Nakai J, Imagawa T, Hakamata Y, Shigekawa M, Takeshima H, Numa S. Primary structure and functional expression from cDNA of the cardiac ryanodine receptor/calcium release channel. FEBS Lett 1990;271:169-77.

25. Moorman AFM, Vermeulen JLM, Koban MU, Schwartz K, Lamers WH, Boheler KR. Patterns of expression of sarcoplasmic reticulum Ca2+-ATPase and phospholamban mRNA during rat heart development. Circ Res 1995;76:616-25.

26. Alwine JC, Kemp DJ, Stark GR. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridization with DNA probes. Proc Natl Acad Sci U S A 1977;74:5350-4.

27. Kawaguchi H, Kitabatake A. Renin-angiotensin system in failing heart. J Mol Cell Cardiol 1995;27:201-9.

28. Factor SM, Minase T, Cho S, Dominitz R, Sonnenblick EH. Microvascular spasm in the cardiomyopathic Syrian hamster: a preventable cause of focal myocardial necrosis. Circulation 1982;66:342-54.

29. Jasmin G, Solymoss B. Prevention of hereditary cardiomyopathy in the hamster by verapamil and other agents. Proc Soc Exp Biol Med 1975;149:193-8.

30. Yamashita T, Kobayashi A, Yamazaki N, Miura K, Shirasawa H. Effects of L-carnitine and verapamil on myocardial carnitine concentration and histopathology of Syrian hamster BIO14.6. Cardiovasc Res 1986;20:614-20.

31. Kobayashi A, Yamashita T, Kaneko M, Nishiyama T, Hayashi H, Yamazaki N. Effects of verapamil on experimental cardiomyopathy in the BIO14.6 Syrian hamster. J Am Coll Cardiol 1987;10:1128-34.

32. Factor SM, Cho S, Scheuer J, Sonnenblick EH, Malhotra A. Prevention of hereditary cardiomyopathy in the Syrian hamster with chronic verapamil therapy. J Am Coll Cardiol 1988;12:1599-604.

33. Jasmin G, Proshek L. Calcium and myocardial cell injury: an appraisal in the cardiomyopathic hamster. Can J Physiol Pharmacol 1984;62:891-8.

34. Sano H, Okada H, Kawaguchi H, Yasuda H. Increased angiotensin II stimulated collagen synthesis in cultured cardiac fibroblasts from spontaneously hypertensive rats. Circulation 1991;84(supple II):II-48.

35. Anger M, Lambert F, Chemla D, et al. Sarcoplasmic reticulum Ca2+ pumps in heart and diaphragm of cardiomyopathic hamster: effects of perindopril. Am J Physiol 1995:H1947-53.

Key Words: Collagen; Loss of myocytes; Dilated cardiomyopathic hamster; Gene expression; Ryanodine receptor; Phospholamban

Cited By:

This article has been cited 39 time(s).

Heart Failure
Cardiac remodeling: Role of neovascularization in heart failure
Okamoto, H; Watanabe, M; Kumamoto, H; Chiba, S; Yoneya, K; Onozuka, H; Mikami, T; Kawaguchi, H; Abe, K; Kitabatake, A
Heart Failure, (): 89-102.

Biological & Pharmaceutical Bulletin
Improvement in the histopathology of hearts from cardiomyopathic BIO TO-2 hamsters following long-term administration of amlodipine and cilnidipine
Urayama, A; Yamada, S; Hirano, K; Kimura, R; Watanabe, H; Ohashi, K
Biological & Pharmaceutical Bulletin, 23(): 1189-1192.

Microbiology and Immunology
The role of osteopontin in the development of granulomatous lesions in lung
Chiba, S; Rashid, MM; Okamoto, H; Shiraiwa, H; Kon, S; Maeda, M; Murakami, M; Inobe, M; Kitabatake, A; Chambers, AF; Uede, T
Microbiology and Immunology, 44(4): 319-332.

Biochimica Et Biophysica Acta-Molecular Basis of Disease
Modification of myosin protein and gene expression in failing hearts due to myocardial infarction by enalapril or losartan
Wang, JW; Guo, XB; Dhalla, NS
Biochimica Et Biophysica Acta-Molecular Basis of Disease, 1690(2): 177-184.
10.1016/j.bbadis.2004.06.004
CrossRef
Methods and Findings in Experimental and Clinical Pharmacology
Antagonism of the renin-angiotensin-aldosterone system and collagen metabolism in cardiac fibroblasts
Lijnen, P; Petrov, V
Methods and Findings in Experimental and Clinical Pharmacology, 21(3): 215-227.

Journal of Pharmacological and Toxicological Methods
The tachycardia-induced dog model of atrial fibrillation: clinical relevance and comparison with other models
Gaspo, R
Journal of Pharmacological and Toxicological Methods, 42(1): 11-20.

American Journal of Physiology-Heart and Circulatory Physiology
Hepatocyte growth factor prevents tissue fibrosis, remodeling, and dysfunction in cardiomyopathic hamster hearts
Nakamura, T; Matsumoto, K; Mizuno, S; Sawa, Y; Matsuda, H; Nakamura, T
American Journal of Physiology-Heart and Circulatory Physiology, 288(5): H2131-H2139.
10.1152/ajpheart.01239.2003
CrossRef
American Journal of Physiology-Heart and Circulatory Physiology
Amlodipine inhibits granulation tissue cell apoptosis through reducing calcineurin activity to attenuate postinfarction cardiac remodeling
Ogino, A; Takemura, G; Kanamori, H; Okada, H; Maruyama, R; Miyata, S; Esaki, M; Nakagawa, M; Aoyama, T; Ushikoshi, H; Kawasaki, M; Minatoguchi, S; Fujiwara, T; Fujiwara, H
American Journal of Physiology-Heart and Circulatory Physiology, 293(4): H2271-H2280.
10.1152/ajpheart.00303.2007
CrossRef
Cardiovascular Drugs and Therapy
Effects of mibefradil, a T- and L-type calcium channel blocker, on cardiac remodeling in the UM-X7.1 cardiomyopathic hamster
Villame, J; Massicotte, J; Jasmin, G; Dumont, L
Cardiovascular Drugs and Therapy, 15(1): 41-48.

Acta Pharmacologica Sinica
Effects of lercanidipine on coronary reactivity and myocardial remodeling in transition to heart failure in cardiomyopathic hamsters
Massicotte, J; Viens, A; Yao, MH; Leonardi, A; Sironi, G; Wang, HB; Dumont, L
Acta Pharmacologica Sinica, 24(3): 199-206.

Circulation Journal
In vivo echocardiographic detection of cardiovascular lesions in apolipoprotein E-knockout mice using a novel high-frequency high-speed echocardiography technique
Onozuka, H; Fujii, S; Mikami, T; Yamada, S; Ishimori, N; Shimizu, T; Furumoto, T; Nakai, Y; Komura, K; Nishihara, K; Okamoto, H; Kitabatake, A
Circulation Journal, 66(3): 272-276.

Molecular and Cellular Biochemistry
Pure pressure stress increased monocarboxylate transporter in human aortic smooth muscle cell membrane
Oikawa, K; Iizuka, K; Murakami, T; Nagai, T; Okita, K; Yonezawa, K; Kitabatake, A; Kawaguchi, H
Molecular and Cellular Biochemistry, 259(): 151-156.

Canadian Journal of Physiology and Pharmacology
Hemodynamic and histomorphometric characteristics of dilated cardiomyopathy of Syrian hamsters (Bio TO-2 strain)
Goineau, S; Pape, D; Guillo, P; Ramee, MP; Bellissant, E
Canadian Journal of Physiology and Pharmacology, 79(4): 329-337.

Molecular and Cellular Biochemistry
Partial prevention of changes in SR gene expression in congestive heart failure due to myocardial infarction by enalapril or losartan
Guo, XB; Chapman, D; Dhalla, NS
Molecular and Cellular Biochemistry, 254(): 163-172.

Methods and Findings in Experimental and Clinical Pharmacology
Induction of cardiac fibrosis by angiotensin II
Lijnen, PJ; Petrov, VV; Fagard, RH
Methods and Findings in Experimental and Clinical Pharmacology, 22(): 709-723.

International Journal of Cardiology
Diverse effects of chronic treatment with losartan, fosinopril, and amlodipine on apoptosis, angiotensin II in the left ventricle of hypertensive rats
Yu, GL; Liang, XQ; Xie, XM; Su, M; Zhao, SP
International Journal of Cardiology, 81(): 123-129.

Microscopy Research and Technique
Sarcoglycans in muscular dystrophy
Hack, AA; Groh, ME; McNally, EM
Microscopy Research and Technique, 48(): 167-180.

Molecular and Cellular Biochemistry
N-terminal kinase, and c-Src are activated in human aortic smooth muscle cells by pressure stress
Morita, N; Iizuka, K; Murakami, T; Kawaguchi, H
Molecular and Cellular Biochemistry, 262(): 71-78.

Canadian Journal of Cardiology
Opposite effects of amlodipine and enalapril on infarct collagen and remodelling during healing after reperfused myocardial infarction
Jugdutt, BI; Musat-Marcu, S
Canadian Journal of Cardiology, 16(5): 617-625.

Life Sciences
Ameliorating effects of amlodipine on plasma and myocardial catecholamines in BIO 53.58 Syrian hamsters, a model of dilated cardiomyopathy
Yamada, S; Urayama, A; Kimura, R; Watanabe, H; Ohashi, K
Life Sciences, 67(): 3051-3059.

Journal of Molecular and Cellular Cardiology
Impaired nitric oxide modulation of myocardial oxygen consumption in genetically cardiomyopathic hamsters
Loke, KE; Messina, EJ; Mital, S; Hintze, TH
Journal of Molecular and Cellular Cardiology, 32(): 2299-2306.
10.1006/jmcc.2000.1258
CrossRef
Diabetologia
Long-acting calcium channel blocker benidipine suppresses expression of angiogenic growth factors and prevents cardiac remodelling in a Type II diabetic rat model
Jesmin, S; Sakuma, I; Hattori, Y; Fujii, S; Kitabatake, A
Diabetologia, 45(3): 402-415.

Journal of the American College of Cardiology
Vascular remodeling during healing after myocardial infarction in the dog model - Effects of reperfusion, amlodipine and enalapril
Jugdutt, BI; Menon, V; Kumar, D; Idikio, H
Journal of the American College of Cardiology, 39(9): 1538-1545.
PII S0735-1097(02)01805-3
CrossRef
American Journal of Physiology-Heart and Circulatory Physiology
NAD(P)H oxidase-generated superoxide anion accounts for reduced control of myocardial O-2 consumption by NO in old Fischer 344 rats
Adler, A; Messina, E; Sherman, B; Wang, ZP; Huang, H; Linke, A; Hintze, TH
American Journal of Physiology-Heart and Circulatory Physiology, 285(3): H1015-H1022.
10.1152/ajpheart.01047.2002
CrossRef
Methods and Findings in Experimental and Clinical Pharmacology
Role of intracardiac renin-angiotensin-aldosterone system in extracellular matrix remodeling
Lijnen, PJ; Petrov, VV
Methods and Findings in Experimental and Clinical Pharmacology, 25(7): 541-564.

Cardiovascular Research
The influence of antihypertensive drug treatment on the prevention and regression of left ventricular hypertrophy
van Zwieten, PA
Cardiovascular Research, 45(1): 82-91.

Japanese Heart Journal
Long-term combined therapy with an angiotensin type I receptor blocker and an angiotensin converting enzyme inhibitor prolongs survival in dilated cardiomyopathy
Shimizu, T; Okamoto, H; Chiba, S; Matsui, Y; Sugawara, T; Onozuka, H; Mikami, T; Kumamoto, H; Kitabatake, A
Japanese Heart Journal, 43(5): 531-543.

Life Sciences
Amlodipine decreases fibrosis and cardiac hypertrophy in spontaneously hypertensive rats: persistent effects after withdrawal
Sevilla, MA; Voces, F; Carron, R; Guerrero, EI; Ardanaz, N; San Roman, L; Arevalo, MA; Montero, MJ
Life Sciences, 75(7): 881-891.
10.1016/j.lfs.2004.04.004
CrossRef
Cardiovascular Research
VEGF-mediated angiogenesis is impaired by angiotensin type 1 receptor blockade in cardiomyopathic hamster hearts
Shimizu, T; Okamoto, H; Chiba, S; Matsui, Y; Sugawara, T; Akino, M; Nan, J; Kumamoto, H; Onozuka, H; Mikami, T; Kitabatake, A
Cardiovascular Research, 58(1): 203-212.
10.1016/S0008-6363(02)00843-X
CrossRef
Circulation
Inhibition of collagen synthesis with prolyl 4-hydroxylase inhibitor improves left ventricular function and alters the pattern of left ventricular dilatation after myocardial infarction
Nwogu, JI; Geenen, D; Bean, M; Brenner, MC; Huang, XF; Buttrick, PM
Circulation, 104(): 2216-2221.

Japanese Heart Journal
Altered microvasculature is involved in remodeling processes in cardiomyopathic hamsters
Shimizu, T; Okamoto, H; Watanabe, M; Kumamoto, H; Chiba, S; Matsui, Y; Sugawara, T; Onozuka, H; Mikami, T; Kitabatake, A
Japanese Heart Journal, 44(1): 111-126.

Faseb Journal
A nitric oxide-releasing derivative of enalapril, NCX 899, prevents progressive cardiac dysfunction and remodeling in hamsters with heart failure
Iwanaga, Y; Gu, Y; Dieterle, T; Presotto, C; Del Soldato, P; Peterson, KL; Ongini, E; Condorelli, G; Ross, J
Faseb Journal, 18(1): 587-+.
10.1096/fj.03-0872fje
CrossRef
Molecular and Cellular Biochemistry
Electrical and ionic abnormalities in the heart of cardiomyopathic hamsters: In quest of a new paradigm for cardiac failure and lethal arrhythmia
Sakamoto, A
Molecular and Cellular Biochemistry, 259(): 183-187.

Cardiovascular Pathology
The effects of NK4 on viral myocarditis mice
Shen, DF; Tang, QZ; Huang, ZR; Chen, Y; Xiong, R; Wu, H; Huang, J; Feng, ST; Yan, L; Bian, ZY
Cardiovascular Pathology, 18(6): 323-331.
10.1016/j.carpath.2008.10.008
CrossRef
American Journal of Physiology-Heart and Circulatory Physiology
Beneficial effect of myocardial angiogenesis on cardiac remodeling process by amlodipine and MCI-154
Kumamoto, H; Okamoto, H; Watanabe, M; Onozuka, H; Yoneya, K; Nakagawa, I; Chiba, S; Watanabe, S; Mikami, T; Abe, K; Kitabatake, A
American Journal of Physiology-Heart and Circulatory Physiology, 276(4): H1117-H1123.

Journal of Cardiovascular Pharmacology
Combined Effects of Enalapril and Spironolactone in Hamsters With Dilated Cardiomyopathy
Goineau, S; Pape, D; Guillo, P; Ramée, M; Bellissant, E
Journal of Cardiovascular Pharmacology, 41(1): 49-59.

PDF (1034)
Journal of Cardiovascular Pharmacology
Effect of Prolonged Treatment with Amlodipine on Enhanced Vascular Contractility in Cardiomyopathic Hamsters
Sato, A; Hattori, Y; Watanabe, M; Okamoto, H; Tomioka, H; Fukao, M; Sakuma, I; Kitabatake, A; Kanno, M
Journal of Cardiovascular Pharmacology, 34(1): 124-131.

Journal of Cardiovascular Pharmacology
Effects of First and Second Generation Calcium Channel Blockers on Diastolic Function of the Failing Hamster Heart: Relationship with Coronary Flow Changes
Beaucage, P; Massicotte, J; Boileau, J; Dumont, L
Journal of Cardiovascular Pharmacology, 42(1): 142-150.

PDF (438)
Journal of Cardiovascular Pharmacology
Cardiotonic Agent SCH00013 Prolongs Survival of Cardiomyopathic Hamsters
Narita, T; Yui, R; Koide, Y; Sakato, M; Kawashima, S
Journal of Cardiovascular Pharmacology, 42(3): 364-371.

PDF (767)
Back to Top | Article Outline

© Lippincott-Raven Publishers

Follow Us!

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.