Skip Navigation LinksHome > November 2013 - Volume 119 - Issue 5 > Epigenetic Regulation of Spinal CXCR2 Signaling in Incisiona...
Anesthesiology:
doi: 10.1097/ALN.0b013e31829ce340
Pain Medicine

Epigenetic Regulation of Spinal CXCR2 Signaling in Incisional Hypersensitivity in Mice

Sun, Yuan Ph.D.*; Sahbaie, Peyman M.D.; Liang, De-Yong Ph.D.; Li, Wen-Wu Ph.D.§; Li, Xiang-Qi M.D.; Shi, Xiao-You M.D.; Clark, J. David M.D., Ph.D.#

Free Access
Press Release
Article Outline
Collapse Box

Author Information

Collapse Box

Abstract

Background: The regulation of gene expression in nociceptive pathways contributes to the induction and maintenance of pain sensitization. Histone acetylation is a key epigenetic mechanism controlling chromatin structure and gene expression. Chemokine CC motif receptor 2 (CXCR2) is a proinflammatory receptor implicated in neuropathic and inflammatory pain and is known to be regulated by histone acetylation in some settings. The authors sought to investigate the role of histone acetylation on spinal CXCR2 signaling after incision.
Methods: Groups of 5–8 mice underwent hind paw incision. Suberoylanilide hydroxamic acid and anacardic acid were used to inhibit histone deacetylase and histone acetyltransferase, respectively. Behavioral measures of thermal and mechanical sensitization as well as hyperalgesic priming were used. Both message RNA quantification and chromatin immunoprecipitation analysis were used to study the regulation of CXCR2 and ligand expression. Finally, the selective CXCR2 antagonist SB225002 was administered intrathecally to reveal the function of spinal CXCR2 receptors after hind paw incision.
Results: Suberoylanilide hydroxamic acid significantly exacerbated mechanical sensitization after incision. Conversely, anacardic acid reduced incisional sensitization and also attenuated incision-induced hyperalgesic priming. Overall, acetylated histone H3 at lysine 9 was increased in spinal cord tissues after incision, and enhanced association of acetylated histone H3 at lysine 9 with the promoter regions of CXCR2 and keratinocyte-derived chemokine (CXCL1) was observed as well. Blocking CXCR2 reversed mechanical hypersensitivity after hind paw incision.
Conclusions: Histone modification is an important epigenetic mechanism regulating incision-induced nociceptive sensitization. The spinal CXCR2 signaling pathway is one epigenetically regulated pathway controlling early and latent sensitization after incision.
Back to Top | Article Outline

What We Already Know about This Topic

* Epigenetics refers to modifications of DNA or chromatin, which influence gene expression
* Epigenetic changes in CXCR2 expression are associated with hypersensitivity in animals after nerve injury and inflammation, but their role after incision is not known
Back to Top | Article Outline

What This Article Tells Us That Is New

* In mice, histone modification as one epigenetic mechanism is important to hypersensitivity after incision, and at least one epigenetic target after incision is the CXCR2 signaling pathway
THE term “epigenetics” commonly refers to modifications of DNA or surrounding chromatin, which influence gene expression but do not change DNA sequence. The covalent modification of the lysine tails of histone proteins and DNA methylation are two well-known mechanisms of epigenetic regulation.1,2 These changes tend to be persistent and may be responsible for long-term adaptations of cells and tissues. One of the best-studied histone modifications to date has been histone acetylation, a process regulated by the balance of activities of histone acetyltransferases (HATs) and histone deacetylases (HDACs) of which there are many. In general, increased histone acetylation causes chromatin relaxation and increased transcriptional activity, whereas decreased acetylation results in tighter DNA coiling and gene silencing.2 Histone acetylation/deacetylation is recognized to play critical roles in many physiological and pathological processes in the nervous system, such as neuronal differentiation,3,4 neuronal degeneration,5–7 memory formation,8,9 drug addiction,10,11 and pain sensitization.12–14
Pharmacological studies using HAT or HDAC inhibitors show that blocking or stimulating histone acetylation can affect pain behavior in several pain models. For example, Kiguchi et al.13 demonstrated HAT inhibition prevented sciatic nerve ligation-induced neuropathic sensitization in mice via suppression of the chemokine CC motif receptor 2 (CXCR2) signaling pathway. In these studies it was demonstrated using chromatin immunoprecipitation (ChIP) on samples of damaged sciatic nerve to quantify DNA-histone interactions that acetylation of lysine residues on the H3 histone protein regulated CXCR2 expression to control neuropathic sensitization. However, HDAC inhibitors have shown antinociceptive effects in inflammatory pain models.12,14 One proposed mechanism involves the enhanced expression of the mGlu2 gene in sensory neurons in the presence of HDAC inhibitors.15 The neurobiology of postoperative pain may be different from those of inflammatory and neuropathic pain,16 making it difficult to predict what the effects of HAT or HDAC inhibitors would be.
The CXC chemokine receptor 2 (CXCR2) and its ligands keratinocyte-derived chemokine (KC, CXCL1) and macrophage inflammatory protein-2 (MIP-2, CXCL2/3) have been implicated in modulation of inflammation and pain.13,17–19 Furthermore, our previous work has demonstrated strongly increased levels of KC in periincisional tissue.20 The current study, therefore, was designed to investigate the effects of epigenetic regulation on incisional pain and elucidate the possible molecular mechanism underlying CXCR2 pathway–mediated regulation of nociceptive sensitization in incised mice.
Back to Top | Article Outline

Materials and Methods

Animal Use
All experimental protocols were reviewed and approved by Veterans Affairs Palo Alto Healthcare System Institutional Animal Care and Use Committee before beginning the work. All protocols conform to the guidelines for the study of pain in awake animals, as established by the International Association for the Study of Pain. Eight- to nine-week old male mice of the C57BL/6J strain were obtained from Jackson Laboratory (Bar Harbor, ME). Mice were housed four per cage and maintained on a 12-h light/dark cycle and an ambient temperature of 22° ± 1°C, with food and tap water available ad libitum.
Back to Top | Article Outline
Hind Paw Incision
The hind paw incision model in mice was performed in our laboratory as described in previous studies.21–23 Briefly, mice were anesthetized using isoflurane 2–3% delivered through a nose cone. After sterile preparation with alcohol, a 5-mm longitudinal incision was made with a number 11 scalpel on the plantar surface of the right hind paw. The incision was sufficiently deep to divide deep tissue including the plantaris muscle longitudinally. After controlling bleeding, a single 6-0 nylon suture was placed through the midpoint of the wound and antibiotic ointment was applied. Mice used in these experiments did not show evidence of infection in the paws at the time of behavioral or biochemical assays.
Back to Top | Article Outline
Drug Administration
Suberoylanilide Hydroxamic Acid Administration.
Suberoylanilide hydroxamic acid (SAHA; Cayman Chemical, Ann Arbor, MI) was freshly dissolved in a vehicle of dimethyl sulfoxide (Sigma Chemical, St. Louis, MO). The concentration was adjusted to 40 µg/µl so that 50 mg/kg dose could be administrated intraperitoneally in a volume of 12.5 µl/10 g body weight. An equal volume of dimethyl sulfoxide was injected as vehicle. Animals received intraperitoneal injection of SAHA (50 mg/kg) 1 day before incision, 2 h before incision, and each morning after nociceptive testing for 4 days. The selected SAHA dose was based on our previous studies demonstrating that this dose of SAHA modified opioid tolerance, dependence, and nociceptive thresholds.24
Back to Top | Article Outline
Anacardic Acid Administration.
Anacardic acid (Calbiochem, Darmstadt, Germany) was freshly dissolved in a small amount of dimethyl sulfoxide and further diluted in 0.9% saline with 5% Tween 80 (Sigma). The concentration was adjusted to 50 µg/100 µl so that a 5 mg/kg dose could be administrated intraperitoneally in a volume of 100 µl/10 g body weight. Mice received either anacardic acid solution or matching vehicle, in accordance with the same schedule as described for SAHA. The selection of 5 mg/kg of anacardic acid is based on the finding that at this dose it effectively reduced histone acetylation in mice in other experiments.25
Back to Top | Article Outline
Prostaglandin E2 Administration for Incisional Priming.
Prostaglandin E2 (PGE2; Cayman Chemical) stock solutions were made in 100% ethanol as the stock solution (5 µg/µl), which was further diluted by 1,000 times in 0.9% saline before use. PGE2 (100 ng) or vehicle (0.1% ethanol in 0.9% saline) was injected on day 14 after incision subcutaneously into the plantar surface of the incisional hind paw in a volume of 15 μl.26
Back to Top | Article Outline
SB225002 Administration.
The selective CXCR2 antagonist SB225002 (Cayman Chemical) was freshly prepared in 100% ethanol as the stock solution (50 mg/ml), which was further diluted by 25 times in 0.9% saline. Mice received either SB225002 (10 µg) or vehicle (5% ethanol in 0.9% saline) intrathecally on day 4 after incision in a volume of 5 μl.27 Day 4 was selected based on the large difference in mechanical sensitization after incision between vehicle and SAHA-treated mice at this time point. The dose was chosen based on the finding that at this dose SB225002 significantly reduced carrageenan-induced hypersensitivity in mice.19
Back to Top | Article Outline
Nociceptive Testing
All nociceptive testing was done with the experimenter blind to drug treatment.
Back to Top | Article Outline
Mechanical Hypersensitivity.
Mechanical nociceptive thresholds were assayed using von Frey filaments according to a modification of the “up–down” algorithm described by Chaplan et al.,28 as described previously.21–23 Mice were placed on wire-mesh platforms in clear cylindrical plastic enclosures that were 10 cm in diameter and 30 cm in height. After 20 min of acclimation, fibers of sequentially increasing stiffness with initial bending force of 0.2 g were applied to the plantar surface of the hind paw adjacent to the incision, just distal to the first set of foot pads and left in place 5 s with enough force to slightly bend the fiber. Withdrawal of the hind paw from the fiber was scored as a response. When no response was obtained, the next stiffer fiber in the series was applied in the same manner. If a response was observed, the next less stiff fiber was applied. Testing proceeded in this manner until four fibers had been applied after the first one, causing a withdrawal response allowing the estimation of the mechanical withdrawal threshold using a curve-fitting algorithm.29
Back to Top | Article Outline
Thermal Sensitization.
Paw withdrawal response latencies to noxious thermal stimulation were measured using the method of Hargreaves et al.30 as we have modified for use with mice.22 In this assay, mice were placed on a temperature-controlled glass platform (29°C) in a clear plastic enclosure similar to those described in the method of Hargreaves et al.30 After 30 min of acclimation, a beam of focused light was directed toward the same area of the hind paw as described for the von Frey assay. A 20-s cutoff was used to prevent tissue damage. The light beam intensity was adjusted to provide an approximate 10-s baseline latency in control mice. Three measurements were made per animal per test session separated by at least 1 min.
Back to Top | Article Outline
Protein Isolation and Western Blot Analysis
Mice were first euthanized by carbon dioxide asphyxiation and spinal cord tissue was harvested by extrusion. Lumbar spinal cord segments were dissected on a chilled surface. Dissected tissue was then quick-frozen in liquid nitrogen and stored at −80°C until required for analysis. Mice lumbar spinal cord were dissolved at 4°C in T-PER Tissue Protein Extraction buffer (Thermo Scientific, Rockford, IL) in the presence of protease inhibitor cocktail (Roche, Mannheim, Germany). Equal amounts of protein (30 μg) were loaded for sodium dodecyl sulfate polyacrylamide gel electrophoresis (10% Tris-HCl acrylamide gel) and electrotransferred onto polyvinylidene difluorided membranes, as described previously.23,31 Blots were probed with the primary antibody of CXCR2 polycolonal antibody (1:500; Abcam, San Francisco, CA) at 4°C overnight. β-Actin (Sigma) was used as an internal control. The band intensity was quantified using National Institutes of Health image J analysis software (version 1.44; Bethesda, MD).
Back to Top | Article Outline
RNA Isolation and Quantitative Real-time Polymerase Chain Reaction (PCR)
The spinal cord samples were dissected as described in protein isolation and Western blot analysis. For RNA and real-time quantitative PCR, total RNA was isolated from spinal cord using the RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. The purity and concentration were determined spectrophotometrically. The messenger RNA samples were reverse transcribed into complementary DNA using a First Strand complementary DNA Synthesis Kit (Invitrogen, Carlsbad, CA). Real-time PCR was performed in an ABI prism 7900HT system (Applied Biosystems, Foster City, CA). All PCR experiments were performed using the SYBR Green I master kit (Applied Biosystems). The primer sets for 18S messenger RNA (mRNA) and the amplification parameters were described previously.23 Melting curves were performed to document single product formation and agarose electrophoresis confirmed product size. The CXCR2, MIP-2, KC primers were purchased from SABiosciences (Valencia, CA). As negative controls, RNA samples that were not reverse transcribed were run. Data were normalized to 18S mRNA expression.
Back to Top | Article Outline
ChIP Assay
ChIP assay was performed by using a commercially available ChIP kit according to the manufacturer’s protocol (Millipore, Billerica, MA). Briefly, the fresh spinal cord samples were cross-linked in phosphate-buffered saline containing 1% formaldehyde (Sigma) and then quenched with glycine to a final concentration of 125 mM as previously described.24 Lysates were sonicated on ice for 8 min (10 s on and 10 s off) using Vibra Cell sonicator (Sonics & Materials Inc, Newtown, CT) with a 2-mm microtip, followed by immunoprecipitation with specific antibody (5 µg) against acetylated histone H3 at lysine 9 (H3K9; Millipore) or IgG (Millipore) as negative control. Input control consisted of 1% sonicated chromatin. Target gene promoter enrichment in ChIP samples was measured in duplicate by quantitative PCR. Primer sequences used to amplify the promoter region were designed by the Primer 3 program: CXCR2, GCCAGGCAGATGGTGATACT (forward), and GTGGGTTTTCAGGCTGTGTT (reverse); KC, ATCTAGGAACCCCCTCCTCA (forward), and AGCATCCCTACCCTGCTGTA (reverse). Data were analyzed using the 2-ΔΔCt method and normalized with input samples as described previously.24 Melting curves were performed to document single product formation, and agarose electrophoresis confirmed product size.
Back to Top | Article Outline
Tissue Processing and Immunohistochemistry
The technique of immunohistochemical analysis was described previously.24 Briefly, the spinal cords were fixed in 10% buffered formalin for 24 h. Blocking of the sections took place overnight at 4°C in Tris-buffered saline containing 5% dry milk, followed by exposure to the primary polyclonal antibodies against rabbit antiacetylated histone H3K9 antibody (1:1,000; Epigentek, Brooklyn, NY), mouse antiacetylated histone H3K9 antibody (1:1,000; GeneTex, Irvine, CA), rabbit anti-CXCR2 antibody (1:200; Santa Cruz, Dallas, TX), and mouse anti-NeuN (1:500; Millipore) overnight at 4°C. Sections were then rinsed and incubated with fluorescein-conjugated secondary antibodies against the primary antibodies (1:500; Jackson ImmunoResearch Laboratories, West Grove, PA) for 1 h. Double-labeling immunofluorescence was performed with donkey antimouse IgG conjugated with cyanine dye 3, or donkey antirabbit IgG conjugated with fluorescein isothiocyanate secondary antibodies. Confocal laser-scanning microscopy was carried out using a Zeiss LSM/510 META microscope (Thornwood, NY). Sections from control and experimental animals were processed in parallel. Control experiments omitting either primary or secondary antibody revealed no significant staining.
Back to Top | Article Outline
Statistical Analysis
All data are expressed as mean ± SEM. The data for behavioral tests and mRNA expression in different groups were analyzed by two-way ANOVA followed by Bonferroni post hoc test for each test time point, comparing various treatment groups, where the repeated measure was time postincision or postinjection. H3K9 immunostaining morphometric analysis was analyzed by one-way ANOVA with post hoc Bonferroni testing. For simple comparisons of two groups, a two-tailed Student t test was used. P values less than 0.05 were considered significant (Prism 5; GraphPad Software, La Jolla, CA).
Back to Top | Article Outline

Results

Effects of HAT and HDAC Inhibitors on Incision-induced Nociceptive Sensitization
Fig. 1
Fig. 1
Image Tools
Fig. 2
Fig. 2
Image Tools
To determine whether histone acetylation/deacetylation alters incision-induced sensitization, the HDAC inhibitor SAHA or HAT inhibitor anacardic acid was administrated daily to incised mice. Figure 1, A and B presents data demonstrating that administration of SAHA significantly exacerbated incision-induced mechanical hypersensitivity without significant alteration of thermal sensitivity. Conversely, systemic administration of anacardic acid significantly attenuated incision-induced mechanical hypersensitivity again without any alteration of thermal sensitivity (fig. 2, A and B). Neither the HDAC inhibitor SAHA nor the HAT inhibitor anacardic acid had any effect on the nociceptive thresholds of control animals (figs. 1 and 2).
Back to Top | Article Outline
Effects of HAT and HDAC Inhibitors on Incision-induced Hyperalgesic Priming
Fig. 3
Fig. 3
Image Tools
Previous injury induces a prolonged period of vulnerability to exaggerated sensitization after subsequent injury termed “hyperalgesic priming.”32 Epigenetic regulation of chromatin structure via histone acetylation promotes sustained changes in neurons, which influence the neuroplasticity associated with memory formation,33 drug addiction,34 and neuroprotection.35 To determine whether histone acetylation/deacetylation alters incision-induced hyperalgesic priming, PGE2 was locally injected into the incised hind paws of mice 2 weeks after incision, and mechanical withdrawal threshold was measured over the next 3 days. Mice having previously undergone hind paw incision demonstrated greatly prolonged nociceptive sensitization after PGE2 injection (fig. 3, A and B), which was consistent with others’ findings.26 Incised mice that received treatment with SAHA in the periincisional period showed responses similar to incision alone (fig. 3A). However, previous anacardic acid administration partially blocked hyperalgesic priming (fig. 3B).
Back to Top | Article Outline
Alteration of Histone Acetylation Induced by Incision and SAHA Administration
Fig. 4
Fig. 4
Image Tools
Because blockade of HAT and HDAC activities significantly altered incisional nociceptive sensitivity, we hypothesized that histone acetylation may be changed after incision, particularly in mice treated with SAHA. To test this hypothesis, we examined the expression of acetylated histone H3 (H3K9) in lumbar spinal cord tissue. H3K9 is a crucial histone subtype observed to be hyperacetylated near the CXCR2 gene in a model of neuropathic pain.13 Immunohistochemical data demonstrated that incision significantly increased acetylation of H3K9 in the dorsal horn of spinal cord at 4 days after incision (fig. 4, A and B). Furthermore, acetylation of H3K9 was further increased in spinal cord in SAHA-treated group compared with vehicle-treated group (fig. 4, A and B). In addition, we did double immunostaining of H3K9 and NeuN (a marker of neurons). Figure 4C demonstrated that most H3K9 was found in neurons, and that most neurons (94.5 ± 0.5%, 5 sections/mouse; n = 4 mice) showed H3K9 positivity in the dorsal horn of lumbar spinal cord at 4 days after incision in mice treated with SAHA.
Back to Top | Article Outline
Effects of SAHA Administrations on CXCR2 Signaling Pathway Expression
Fig. 5
Fig. 5
Image Tools
Fig. 6
Fig. 6
Image Tools
Because the CXCR2 signaling pathway induces marked nociceptive alterations in several animal pain models,13,18,19 we examined the effects of incision and SAHA on CXCR2 expression in spinal cord tissue serving the incised paw. The mRNA levels of CXCR2 were significantly increased at day 1 and day 4 after incision in mice treated with SAHA (fig. 5A), however, incision per se did not change its expression (fig. 5A). In addition, HAT inhibitor anacardic acid did not change CXCR2 mRNA expression either (data not shown), indicating that anacardic acid acts by additional mechanisms other than regulation of CXCR2 expression. The spinal up-regulation of CXCR2 at day 4 after incision in SAHA group was demonstrated by Western blot (fig. 5B). Because several chemokine receptors and their ligands are demonstrated to be expressed by neurons and play an important role in the establishment and/or persistence of pain,36–38 we then sought to define which cells in the spinal cord expressed CXCR2. CXCR2 protein was strongly colocalized with NeuN (fig. 5C) and H3K9 (fig. 5D) in the dorsal horn of lumbar spinal cord at 4 days after incision in mice treated with SAHA, which is consistent with our finding that most neurons expressed H3K9. Finally, we examined the effects of incision and SAHA on the expression of two major CXCR2 ligands, KC (also known as CXCL1) and MIP-2 (also known as CXCL2) in spinal cord. The mRNA levels of KC were significantly up-regulated in spinal cord after incision, and further increased in mice treated with SAHA compared with that in mice treated with vehicle (fig. 6A). The mRNA levels of MIP-2 were not changed in spinal cord (fig. 6B).
Back to Top | Article Outline
Acetylation of Histone H3 (H3K9) in the Promoter Regions of KC and CXCR2
Fig. 7
Fig. 7
Image Tools
We next examined specifically the association of acetylated histone protein with the KC and CXCR2 genes promoter as previous evidence demonstrated this mechanism of epigenetic control in the setting of sciatic nerve injury.13 The comparison made was between spinal cord tissue from incised mice and tissue from incised/SAHA-treated mice because significant differences in KC mRNA and CXCR2 mRNA were observed between these groups (figs. 5A and 6A). We used acetylated histone H3 (H3K9) ChIP analysis of the KC and CXCR2 genes in spinal cord tissue. ChIP assay revealed that histone H3 acetylation (H3K9) in the promoter regions of KC and CXCR2 significantly increased at 1 day in incised mice treated with SAHA compared with incised mice treated with vehicle (fig. 7).
Back to Top | Article Outline
Effect of Intrathecal Injection of CXCR2 Antagonist on Incision-induced and SAHA-enhanced Incisional Pain
Fig. 8
Fig. 8
Image Tools
Because CXCR2 and its ligand KC were up-regulated in spinal cord tissue after incision and further increased in mice treated with SAHA, we examined whether intrathecal blockade of CXCR2 would attenuate incision-induced and/or SAHA administration– enhanced incisional sensitization. Intrathecal administration of the CXCR2 antagonist SB225002 (10 µg intrathecal) at day 4 after incision significantly reversed SAHA-enhanced, incision-induced mechanical hypersensitivity for 3 h after injection (fig. 8) and also reduced mechanical hypersensitivity induced by incision in vehicle-treated animals to the same level (fig. 8). SB225002 did not have any effect on the nociceptive thresholds of nonincised control animals (fig. 8).
Back to Top | Article Outline

Discussion

Postoperative pain is an incompletely understood and only partially controllable condition associated with suffering, medical complications, unplanned hospital admissions, and suboptimal functional outcomes. Moreover, there is a growing appreciation of the problem of chronic postoperative pain arising from a wide variety of surgeries. Histone acetylation is a key epigenetic mechanism controlling chromatin structure, DNA accessibility, and gene expression. However, the role of epigenetic histone modifications with regard to postoperative pain had not yet been explored. In this study, our principal observations were: (1) blockade of HDAC enhances incision-induced nociceptive sensitization, whereas, blockade of HAT diminishes incision-induced nociceptive sensitization as well as incision-induced hyperalgesic priming; (2) acetylation of the H3 histone subunit at lysine residue 9 (H3K9) in spinal cord dorsal horn tissue is significantly increased by incision and further increased with HDAC inhibitor (SAHA) treatment. Neurons are the main cell type containing acetylated H3K9. There is an increased association of H3K9 with the promoters of the CXCR2 and KC genes after incision and SAHA treatment; (3) the expression of KC and CXCR2 are increased in spinal cord tissue after incision and SAHA treatment; (4) spinal CXCR2 receptors are expressed primarily on neurons; (5) the CXCR2 receptor is functionally involved in nociceptive sensitization after incision in mice. Together these observations suggest that the CXCR2 signaling pathway helps to control nociceptive sensitization after incision, and that epigenetic mechanisms determine in part the extent to which CXCR2 signaling is involved.
Histone acetylation and deacetylation can epigenetically activate or silence the expression of pro- or antinociceptive genes and consequently affect pain-related behavior. Administration of the HAT inhibitor anacardic acid prevented partial sciatic nerve ligation-induced neuropathic sensitization by suppressing the up-regulation of MIP-2 and CXCR2.13 Similarly, Zhu et al.39 showed that reducing expression of the HAT p300 by using small hairpin RNA in spinal cord tissue reversed chronic constriction injury–induced nociceptive sensitization in rats. In those experiments the investigators suggested that p300 interacts with the COX-2 promoter in spinal tissue to support sensitization. Our data are consistent with both sets of observations in that HAT inhibitor anacardic acid reduced incision-induced mechanical hypersensitivity. Furthermore, our data demonstrate that HDAC inhibition using a relatively selective agent (SAHA) exacerbates incision-induced mechanical hypersensitivity as would be predicted from the anacardic acid results. Neither of the histone acetylation modifying agents significantly altered thermal sensitization, thus supporting the notion that this aspect of sensitization may rely on mechanisms at least partially distinct from those controlling the mechanical changes.
However, other reports in the literature involving the use of HDAC inhibitors provide opposite findings, particularly when applied to models of inflammatory pain. Bai et al.12 showed that injection of different classes of HDAC inhibitors delayed complete Freund adjuvant–induced thermal nociceptive sensitization. Inhibitors of HDAC classes I, II, and IIa all shared this property. Chiechio et al.15 found that 5-day pretreatment with an HDAC inhibitor but not single-dose administration reduced second-phase nociceptive responses in the formalin pain model. In this case, additional experiments demonstrated that the analgesic effect might be attributable to the up-regulation of mGlu2 receptor in dorsal root ganglion and spinal cord tissue. An additional study demonstrated through a series of observations that inflammatory and neuropathic pain may reduce GAD65 expression in the raphe magnus through histone hypoacetylation resulting in impaired γ-aminobutyric acid signaling. The use of HDAC inhibitors enhanced GAD65 gene expression and synaptic γ-aminobutyric acid function and reduced nociceptive sensitization.14
It is not immediately apparent how the pro- versus antinociceptive effects of HDAC inhibitors can be rectified. However, because the neurobiology of postoperative incisional pain may be different from inflammatory pain,40 differences in the genes involved in different types of pain models may provide at least a partial answer. For example, different patterns of spinal cyclooxygenase-1 and cyclooxygenase-2 mRNA expression are found in inflammatory and postoperative pain.41 Additionally, the different timing and routes of HDAC inhibitor administration used in the cited studies could result in diverse effects on different populations of genes. Finally, the HDAC enzyme family is very complex, and the majority of pharmacological agents provide only partial selectivity.42 Improvements in the selectivity of inhibitors and the availability of knockout and conditional knockout animals for a range of epigenetically functional genes will be important to our progress in this area.
Hyperalgesic priming is defined as a long-lasting latent hyperresponsiveness of nociceptors to inflammatory mediators subsequent to an inflammatory or neuropathic insult.43 In this study, we showed that surgical incision is capable of producing hyperalgesic priming consistent with the findings of Asiedu et al.26 and others. The neuroplastic changes that take place in nociceptors and the spinal cord after injury, which maintain the primed state might be thought of as a type of pain memory state; emerging evidence suggests the involvement of epigenetic processes in the regulation of persistent functional changes in the nervous system including memory and synaptic plasticity.9 Various mechanisms have been examined to explain hyperalgesic priming. One of the better described is the signaling cascades involving the ε isoform of protein kinase C and spinal protein kinase M ζ, which together can initiate and maintain the primed state.26,32 We found that the HAT inhibitor anacardic acid reduced incision-induced hyperalgesic priming, whereas HDAC inhibitor SAHA had no additional effect on PGE2-induced mechanical hypersensitivity when the PGE2 was administered 14 days after incisions were made. Thus it may be the case that incision alone is capable of providing full priming, and that extending the sensitized state after incision as happens when SAHA is administered does not exacerbate the problem. However, reduced incision-induced acetylation may be sufficient to reduce priming. Although this hypothesis clearly requires further investigation, better understanding of these processes may provide insight into the mechanisms supporting persistent pain states, especially in patients with chronic postoperative pain.
The acetylation state of a chromatin region is tightly controlled by HATs and HDACs. The best-studied histone modifications are the acetylation of specific lysine residues of histone H3 and H4. We focused on the acetylation of histone H3, as it has been shown that histone H3 acetylation is related to nociceptive sensitization14 and other types of neuroplasticity. It is notable in this regard that we observed an increased number of cells with acetylated H3K9 in spinal cord dorsal horn tissue after incision and that the level of acetylation was further increased when an HDAC inhibitor was administered. This indicates that incision does in fact alter histone acetylation, and that the HDAC inhibitor we used had the intended function of enhancing that acetylation.
Histone acetylation along with DNA methylation is the main epigenetic process that influences nociceptive gene expression in pain states identified to this point. Transcription-restrictive heterochromatin is converted to transcription-permissive euchromatin by histone acetylation and results in enhanced gene expression. Recently, several pain-related chemokine receptors and its relevant ligands are demonstrated to be epigenetically regulated via histone acetylation.13,44–46 The chemokine CCL2/monocyte chemoattractant protein-1 was shown separately to contribute to mechanical sensitization after surgical incision.45 Likewise, CXCR2 was of particular interest to us as this gene has been linked to nociceptive sensitization in several other studies.13,18,19 In the current study, we showed that both CXCR2 and its ligand KC were significantly increased in spinal cord tissue after incision when histone deacetylation was blocked. Furthermore, the relevant population of CXCR2 receptors probably resides on spinal neurons. Our ChIP experiments provided the key observation that when mice were treated with both incision and SAHA, there was an increased association of acetylated histone protein with KC and CXCR2 promoter DNA. Supporting a functional role for CXCR2 and KC up-regulation, pharmacological experiments showed that intrathecal injection of a CXCR2 antagonist attenuated SAHA-enhanced mechanical hypersensitivity after incision, suggesting that the up-regulation of CXCR2 in spinal cord neurons leads to increased incisional nociceptive sensitivity. Interestingly, though incision alone did not increase CXCR2 expression, at least as reflected in a change in mRNA level, our CXCR2 antagonist did modestly reduce mechanical sensitization under these conditions. The explanation may be that additional up-regulation of CXCR2 or KC gene expression occurs via mechanisms other than epigenetic ones, or that mechanisms such as enhanced release of KC or more efficient CXCR2 coupling to its associated G-proteins support this signaling system in the absence of changes in gene expression.47
In summary, our evidence suggests that regulation of histone acetylation can control the nociceptive sensitization after incision. HDAC inhibition enhanced incisional mechanical hypersensitivity, which appears to be due at least in part to the epigenetic regulation of spinal KC and CXCR2 expression. Because large numbers of genes in peripheral and central areas contribute to determining nociceptive sensitivity48 and histone acetylation broadly coordinates changes in gene expression in setting of pain response, our results reveal one of what may be many mechanisms regulated by histone acetylation. Future studies might include more broadly addressing the roles of epigenetic mechanisms by using whole-genome approaches to detect gene-expression changes in the incisional model, and more carefully evaluating the pathways leading to activation of epigenetic mechanisms after incision. These experiments may suggest additional approaches to the treatment or prevention of postoperative pain.
Back to Top | Article Outline

References

1. Klose RJ, Bird AP. Genomic DNA methylation: The mark and its mediators. Trends Biochem Sci. 2006;31:89–7

2. Kouzarides T. Chromatin modifications and their function. Cell. 2007;128:693–705

3. Hsieh J, Gage FH. Epigenetic control of neural stem cell fate. Curr Opin Genet Dev. 2004;14:461–9

4. Lunyak VV, Burgess R, Prefontaine GG, Nelson C, Sze SH, Chenoweth J, Schwartz P, Pevzner PA, Glass C, Mandel G, Rosenfeld MG. Corepressor-dependent silencing of chromosomal regions encoding neuronal genes. Science. 2002;298:1747–52

5. Hockly E, Richon VM, Woodman B, Smith DL, Zhou X, Rosa E, Sathasivam K, Ghazi-Noori S, Mahal A, Lowden PA, Steffan JS, Marsh JL, Thompson LM, Lewis CM, Marks PA, Bates GP. Suberoylanilide hydroxamic acid, a histone deacetylase inhibitor, ameliorates motor deficits in a mouse model of Huntington’s disease. Proc Natl Acad Sci U S A. 2003;100:2041–6

6. Hoshino M, Tagawa K, Okuda T, Murata M, Oyanagi K, Arai N, Mizutani T, Kanazawa I, Wanker EE, Okazawa H. Histone deacetylase activity is retained in primary neurons expressing mutant huntingtin protein. J Neurochem. 2003;87:257–67

7. Steffan JS, Bodai L, Pallos J, Poelman M, McCampbell A, Apostol BL, Kazantsev A, Schmidt E, Zhu YZ, Greenwald M, Kurokawa R, Housman DE, Jackson GR, Marsh JL, Thompson LM. Histone deacetylase inhibitors arrest polyglutamine-dependent neurodegeneration in Drosophila. Nature. 2001;413:739–43

8. Peixoto L, Abel T. The role of histone acetylation in memory formation and cognitive impairments. Neuropsychopharmacology. 2013;38:62–6

9. Sultan FA, Day JJ. Epigenetic mechanisms in memory and synaptic function. Epigenomics. 2011;3:157–81

10. Pascual M, Do Couto BR, Alfonso-Loeches S, Aguilar MA, Rodriguez-Arias M, Guerri C. Changes in histone acetylation in the prefrontal cortex of ethanol-exposed adolescent rats are associated with ethanol-induced place conditioning. Neuropharmacology. 2012;62:2309–19

11. Wang L, Lv Z, Hu Z, Sheng J, Hui B, Sun J, Ma L. Chronic cocaine-induced H3 acetylation and transcriptional activation of CaMKIIalpha in the nucleus accumbens is critical for motivation for drug reinforcement. Neuropsychopharmacology. 2010;35:913–28

12. Bai G, Wei D, Zou S, Ren K, Dubner R. Inhibition of class II histone deacetylases in the spinal cord attenuates inflammatory hyperalgesia. Mol Pain. 2010;6:51

13. Kiguchi N, Kobayashi Y, Maeda T, Fukazawa Y, Tohya K, Kimura M, Kishioka S. Epigenetic augmentation of the macrophage inflammatory protein 2/C-X-C chemokine receptor type 2 axis through histone H3 acetylation in injured peripheral nerves elicits neuropathic pain. J Pharmacol Exp Ther. 2012;340:577–87

14. Zhang Z, Cai YQ, Zou F, Bie B, Pan ZZ. Epigenetic suppression of GAD65 expression mediates persistent pain. Nat Med. 2011;17:1448–55

15. Chiechio S, Zammataro M, Morales ME, Busceti CL, Drago F, Gereau RW IV, Copani A, Nicoletti F. Epigenetic modulation of mGlu2 receptors by histone deacetylase inhibitors in the treatment of inflammatory pain. Mol Pharmacol. 2009;75:1014–20

16. Brennan TJ. Incisional sensitivity and pain measurements: Dissecting mechanisms for postoperative pain. ANESTHESIOLOGY. 2005;103:3–4

17. Katancik JA, Sharma A, de Nardin E. Interleukin 8, neutrophil-activating peptide-2 and GRO-alpha bind to and elicit cell activation via specific and different amino acid residues of CXCR2. Cytokine. 2000;12:1480–8

18. Carreira EU, Carregaro V, Teixeira MM, Moriconi A, Aramini A, Verri WA Jr, Ferreira SH, Cunha FQ, Cunha TM. Neutrophils recruited by CXCR1/2 signalling mediate post-incisional pain. Eur J Pain. 2013;17:654–63

19. Manjavachi MN, Quintão NL, Campos MM, Deschamps IK, Yunes RA, Nunes RJ, Leal PC, Calixto JB. The effects of the selective and non-peptide CXCR2 receptor antagonist SB225002 on acute and long-lasting models of nociception in mice. Eur J Pain. 2010;14:23–1

20. Clark JD, Shi X, Li X, Qiao Y, Liang D, Angst MS, Yeomans DC. Morphine reduces local cytokine expression and neutrophil infiltration after incision. Mol Pain. 2007;3:28

21. Clark JD, Qiao Y, Li X, Shi X, Angst MS, Yeomans DC. Blockade of the complement C5a receptor reduces incisional allodynia, edema, and cytokine expression. ANESTHESIOLOGY. 2006;104:1274–82

22. Liang DY, Li X, Shi X, Sun Y, Sahbaie P, Li WW, Clark JD. The complement component C5a receptor mediates pain and inflammation in a postsurgical pain model. Pain. 2012;153:366–72

23. Sun Y, Li XQ, Sahbaie P, Shi XY, Li WW, Liang DY, Clark JD. miR-203 regulates nociceptive sensitization after incision by controlling phospholipase A2 activating protein expression. ANESTHESIOLOGY. 2012;117:626–38

24. Liang DY, Li X, Clark JD. Epigenetic regulation of opioid-induced hyperalgesia, dependence, and tolerance in mice. J Pain. 2013;14:36–7

25. Colussi C, Rosati J, Straino S, Spallotta F, Berni R, Stilli D, Rossi S, Musso E, Macchi E, Mai A, Sbardella G, Castellano S, Chimenti C, Frustaci A, Nebbioso A, Altucci L, Capogrossi MC, Gaetano C. Nε-lysine acetylation determines dissociation from GAP junctions and lateralization of connexin 43 in normal and dystrophic heart. Proc Natl Acad Sci U S A. 2011;108:2795–800

26. Asiedu MN, Tillu DV, Melemedjian OK, Shy A, Sanoja R, Bodell B, Ghosh S, Porreca F, Price TJ. Spinal protein kinase M ζ underlies the maintenance mechanism of persistent nociceptive sensitization. J Neurosci. 2011;31:6646–53

27. Li X, Shi X, Liang DY, Clark JD. Spinal CK2 regulates nociceptive signaling in models of inflammatory pain. Pain. 2005;115:182–90

28. Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL. Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods. 1994;53:55–3

29. Poree LR, Guo TZ, Kingery WS, Maze M. The analgesic potency of dexmedetomidine is enhanced after nerve injury: A possible role for peripheral alpha2-adrenoceptors. Anesth Analg. 1998;87:941–8

30. Hargreaves K, Dubner R, Brown F, Flores C, Joris J. A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain. 1988;32:77–8

31. Sun Y, Fujigaki Y, Sakakima M, Fujikura T, Togawa A, Huang Y, Hishida A. Acquired resistance to rechallenge injury in rats that recovered from mild renal damage induced by uranyl acetate: Accelerated proliferation and hepatocyte growth factor/c-Met axis. Clin Exp Nephrol. 2011;15:666–75

32. Reichling DB, Levine JD. Critical role of nociceptor plasticity in chronic pain. Trends Neurosci. 2009;32:611–8

33. Levenson JM, Sweatt JD. Epigenetic mechanisms in memory formation. Nat Rev Neurosci. 2005;6:108–18

34. Renthal W, Nestler EJ. Epigenetic mechanisms in drug addiction. Trends Mol Med. 2008;14:341–50

35. Kazantsev AG, Thompson LM. Therapeutic application of histone deacetylase inhibitors for central nervous system disorders. Nat Rev Drug Discov. 2008;7:854–68

36. Gao YJ, Zhang L, Samad OA, Suter MR, Yasuhiko K, Xu ZZ, Park JY, Lind AL, Ma Q, Ji RR. JNK-induced MCP-1 production in spinal cord astrocytes contributes to central sensitization and neuropathic pain. J Neurosci. 2009;29:4096–108

37. Wilson NM, Jung H, Ripsch MS, Miller RJ, White FA. CXCR4 signaling mediates morphine-induced tactile hyperalgesia. Brain Behav Immun. 2011;25:565–73

38. Abbadie C, Bhangoo S, De Koninck Y, Malcangio M, Melik-Parsadaniantz S, White FA. Chemokines and pain mechanisms. Brain Res Rev. 2009;60:125–34

39. Zhu XY, Huang CS, Li Q, Chang RM, Song ZB, Zou WY, Guo QL. p300 exerts an epigenetic role in chronic neuropathic pain through its acetyltransferase activity in rats following chronic constriction injury (CCI). Mol Pain. 2012;8:84

40. Brennan TJ, Zahn PK, Pogatzki-Zahn EM. Mechanisms of incisional pain. Anesthesiol Clin North America. 2005;23:1–20

41. Prochazkova M, Dolezal T, Sliva J, Krsiak M. Different patterns of spinal cyclooxygenase-1 and cyclooxygenase-2 mRNA expression in inflammatory and postoperative pain. Basic Clin Pharmacol Toxicol. 2006;99:173–7

42. Giannini G, Cabri W, Fattorusso C, Rodriquez M. Histone deacetylase inhibitors in the treatment of cancer: Overview and perspectives. Future Med Chem. 2012;4:1439–60

43. Bogen O, Alessandri-Haber N, Chu C, Gear RW, Levine JD. Generation of a pain memory in the primary afferent nociceptor triggered by PKCε activation of CPEB. J Neurosci. 2012;32:2018–26

44. Wolter S, Doerrie A, Weber A, Schneider H, Hoffmann E, von der Ohe J, Bakiri L, Wagner EF, Resch K, Kracht M. c-Jun controls histone modifications, NF-kappaB recruitment, and RNA polymerase II function to activate the ccl2 gene. Mol Cell Biol. 2008;28:4407–23

45. Peters CM, Eisenach JC. Contribution of the chemokine (C-C motif) ligand 2 (CCL2) to mechanical hypersensitivity after surgical incision in rats. ANESTHESIOLOGY. 2010;112:1250–8

46. Iida S, Watanabe-Fukunaga R, Nagata S, Fukunaga R. Essential role of C/EBPalpha in G-CSF-induced transcriptional activation and chromatin modification of myeloid-specific genes. Genes Cells. 2008;13:313–27

47. Puma C, Danik M, Quirion R, Ramon F, Williams S. The chemokine interleukin-8 acutely reduces Ca(2+) currents in identified cholinergic septal neurons expressing CXCR1 and CXCR2 receptor mRNAs. J Neurochem. 2001;78:960–71

48. Mogil JS. Pain genetics: Past, present and future. Trends Genet. 2012;28:258–66

© 2013 American Society of Anesthesiologists, Inc.

Publication of an advertisement in Anesthesiology Online does not constitute endorsement by the American Society of Anesthesiologists, Inc. or Lippincott Williams & Wilkins, Inc. of the product or service being advertised.
Login

Article Tools

Images

Share