Skip Navigation LinksHome > February 2008 - Volume 108 - Issue 2 > Identification and Biochemical Characterization of a Novel R...
Anesthesiology:
doi: 10.1097/01.anes.0000299431.81267.3e
Clinical Investigations

Identification and Biochemical Characterization of a Novel Ryanodine Receptor Gene Mutation Associated with Malignant Hyperthermia

Anderson, Ayuk A. Ph.D.*; Brown, Rosemary L. Ph.D.†; Polster, Brenda B.S.‡; Pollock, Neil M.B., Ch.B.§; Stowell, Kathryn M. Ph.D.∥

Free Access
Article Outline
Collapse Box

Author Information

Collapse Box

Abstract

Background: Mutations in the skeletal muscle ryanodine receptor gene may result in altered calcium release from sarcoplasmic reticulum stores, giving rise to malignant hyperthermia (MH). MH is a pharmacogenetic skeletal muscle disorder triggered by volatile anesthetics and depolarizing muscle relaxants. Diagnosis of MH is by in vitro contracture testing of quadriceps muscle. DNA analysis of causative mutations is limited by the large number of mutations that cosegregate with MH and the relatively few that have been biochemically characterized.
Methods: DNA sequence analysis was used to screen the skeletal muscle ryanodine receptor gene in MH-susceptible individuals. A diagnostic test using real-time polymerase chain reaction was developed to detect the mutation in individuals diagnosed as MH susceptible by in vitro contracture testing. The functional relevance of this mutation was examined in Epstein-Barr virus–immortalized B-lymphoblastoid cells.
Results: A novel ryanodine receptor mutation (cytosine 14997 thymine resulting in a histidine 4833 tyrosine substitution) was identified in pathology specimens from two patients with fatal MH reactions. B lymphocytes from patients with this mutation were approximately twofold more sensitive than MH-negative cells to activation with 4-chloro-m-cresol. The amount of 45Ca2+ released from B lymphocytes of MH-susceptible patients was significantly greater than that released from cells of family members without this mutation. Haplotype analysis suggests that both families had a common ancestor.
Conclusions: DNA analysis to detect mutations which cosegregate with MH as well as biochemical assays on cultured lymphocytes obtained from blood can serve as useful diagnostic tools for MH susceptibility and genotype–phenotype correlations.
MUTATIONS in the skeletal muscle RYR1 gene have been reported to cause malignant hyperthermia (MH) and central core disease (CCD).1–3 MH, a disorder that is often inherited as an autosomal trait, is a pharmacogenetic disorder of skeletal muscle triggered by inhalational anesthetics and depolarizing muscle relaxants.4 It is characterized by hypermetabolism, hypercapnia, tachycardia, hyperthermia, hypoxemia, muscle rigidity, and metabolic acidosis, which can lead to death of the patient if unabated.5 MH is provoked by an increase in myoplasmic calcium concentration resulting from an abnormal release of calcium from the sarcoplasmic reticulum6 through the ryanodine receptor calcium channel (RyR). With an incidence of 1 in 15,000 to 1 in 60,000 anesthetics administered,7,8 the actual proportion of MH-susceptible (MHS) individuals in the community has been reported to be 1 in 8,5009 and may be as high as 1 in 2,000.10 Molecular genetic studies have identified more than 100 mutations in the RYR1 gene associated with MH and/or CCD,11–13 with at least 28 of these having been functionally characterized and reported to be causative of MH.13#
In this study, we describe the use of DNA analysis to identify a novel RYR1 mutation in pathology specimens from patients with fatal MH reactions that occurred 20–25 yr previously. We also comment on two other unexplained deaths where MH susceptibility was subsequently confirmed by DNA analysis. Several studies have demonstrated that human B lymphocytes express RYR1 14–17 with the gene product functioning as a calcium release channel. Therefore, we investigated the effect of the H4833Y transition on calcium release induced by 4-chloro-m-cresol (4-CmC), a potent and specific activating agent of the skeletal muscle ryanodine receptor,18 in B lymphocytes from MH-positive family members related to the deceased individuals harboring the same mutation.
Back to Top | Article Outline

Materials and Methods

Patients and Samples
Blood and tissue samples were obtained after informed consent from all individuals involved in each aspect of this study or from relatives of deceased individuals. Ethical approval was obtained from the Manawatu-Whanganui (Palmerston North, New Zealand) and Massey University (Palmerston North, New Zealand) human ethics committees.
Back to Top | Article Outline
Case 1.
Fig. 1
Fig. 1
Image Tools
A 15-yr-old girl (fig. 1, V:16) underwent a cortical mastoidectomy in 1980 after a diagnosis of bacterial meningitis secondary to a suppurating ear infection treated with antibiotics. She subsequently had two anesthetics, using succinylcholine and halothane, over a 2-week period lasting 20 and 40 min for suction clearance and further review, respectively. Apart from a brief episode of bigeminal rhythm in the second procedure, which responded rapidly to 50 mg lignocaine intravenously, there were no problems. Anesthesia for the cortical mastoidectomy was induced with 40 mg alfaxalone, intubation facilitated with 80 mg alcuronium, and anesthesia maintained with nitrous oxide, oxygen, and halothane. The surgery was performed in semidarkness, with light provided only by the microscope. Monitoring consisted of manual palpation of the radial pulse. Darkness in the blood of the skin flaps was the first abnormality, noted after approximately 2.5 h; nitrous oxide was discontinued, and oxygen flow was increased to 6 l/min. The procedure was completed 15 min later. After removing the drapes, the patient appeared stiff, with pupils dilated and no respiratory effort, and twitching of the face muscles was apparent. Cardiac arrest occurred after a rapid deterioration. Resuscitation was unsuccessful. Core temperature of greater than 40°C was noted postmortem. Autopsy findings showed no intracranial or cardiac pathology. Subsequent questioning of the family indicated that a cousin had died 4 yr previously (case 2) with a presumptive diagnosis of MH.
Back to Top | Article Outline
Case 2.
An 11-yr-old girl (fig. 1, IV:6) underwent appendicectomy in May 1976. She received 200 mg thiopentone and 50 mg succinylcholine, she was intubated, and anesthesia was maintained with halothane. Within 10 min of induction, her pulse rate increased from 94 to 155 beats/min and remained at about this rate. Preoperatively, the temperature was recorded at 37.5°C but was not measured intraoperatively. The procedure took 35 min, and the patient arrived in recovery tachypneic with rigid limbs. She woke 10 min later, reporting stiffness and painful feet and legs. A succinylcholine reaction was considered to be the cause. She was noted to be mildly cyanosed, with a pulse rate of 152 beats/min, blood pressure of 185/100 mmHg, and grunting respiration. She arrested in ventricular fibrillation 15 min later and was defibrillated twice unsuccessfully. Postmortem examination showed no significant findings.
Back to Top | Article Outline
In Vitro Contracture Testing
In vitro contracture testing (IVCT) of muscle biopsies was performed according to the European Malignant Hyperthermia Group (Leeds, United Kingdom) protocol.#
Back to Top | Article Outline
Extraction of RNA and Genomic DNA
Total RNA was extracted from 30–100 mg frozen skeletal muscle tissue using Trizol RNA extraction reagent according to the manufacturer's instructions (Invitrogen Life Technologies, Carlsbad, CA). Genomic DNA was isolated from leukocytes using the Wizard DNA extraction kit according to manufacturer's instructions (Promega Corporation, Madison, WI). Paraffin-embedded autopsy tissue samples were obtained from the two individuals with suspected MH (cases 1 and 2). DNA was prepared from deparaffinized tissue with prolonged treatment with proteinase K followed by phenol–chloroform extraction.19
Back to Top | Article Outline
Mutation Screening by Reverse-transcription Polymerase Chain Reaction and DNA Sequencing
First strand synthesis was performed using the Superscript reverse transcriptase preamplification system (Invitrogen Life Technologies) with 4 μg total RNA and either 50 ng random hexamers or 500 ng oligo (dT) in a 20-μl volume. Hot-start polymerase chain reaction was performed using 1 μl of a 20-fold dilution of the first strand complementary DNA reaction in 50-μl reactions with 0.32 μm of each primer, 0.3 mm dNTPs, 1.5 mm MgCl2, and 1.5 U Taq polymerase (Invitrogen Life Technologies). Exon 100 of the RYR1 gene was amplified in one 208–base pair (bp) fragment using forward and reverse primers ACCTGGGCTGGTATATGGTG/TTATCCCTTCACCACCCACT, respectively. Sequencing was performed from a CCCTCTTGGGACACTACAACA primer using an ABI 377 with Big-Dye terminator chemistry (Applied Biosystems, Foster City, CA). The three mutational hot spots for MH/CCD were amplified and sequenced as previously described.20
Back to Top | Article Outline
Single-stranded Conformational Polymorphism Analysis
Exon 100 of RYR1 was amplified from genomic DNA and screened for the presence of the C14497T mutation by single-stranded conformation polymorphism analysis as previously described.21
Back to Top | Article Outline
Diagnostic Testing Using Allele-specific Polymerase Chain Reaction
A diagnostic test for the C14497T mutation was developed using hybridization probes and real-time polymerase chain reaction using a Light Cycler (Roche Applied Science, Mannheim, Germany)22,23 as follows. The allele-specific probe (CACCCACAATGGGAAACAGC) was labeled with Cy5.5, and the anchor probe (GCGCACCATCCTGTCCTC) was labeled with fluorescein. The sequences of the flanking primers were 5′-CACAGTCCTTCCTGTACC-3′ (forward) and 5′-GCCCTTATCCCTTCACC-3′ (reverse). The oligonucleotide primers and probes were designed using Light Cycler Primer Design software (Roche Applied Science). The following thermocycling protocol with the Light Cycler Hybridization probe kit (Roche Applied Science) was used for amplification: denaturation at 95°C for 120 s, followed by 55 cycles of 95°C for 0 s, 55°C for 10 s, and 72°C for 12 s, each with a temperature transition rate of 20°C/s and data acquisition at the annealing step. Primers were used at 0.5 μm, and probes at 0.2 μm, and MgCl2 at 4 mm. Melting curve analysis was as follows: 95°C for 0 s and 45°C for 30 s, each with a temperature transition rate of 20°C/s followed by 75°C for 0 s at a temperature transition rate of 0.2°C/s with continuous data acquisition. For each step in the protocol, the fluorescence display was F3/1.
Back to Top | Article Outline
Haplotype Analysis
Haplotype analysis was performed using the D19S22024,25 and D19S4726 chromosome 19q microsatellite repeat markers that flank the RYR1 locus and three intragenic restriction fragment length polymorphism markers,27 Ile1151 (TaqI), Asp2729 (FokI), and Ser2862 (CfoI), as described previously.20 Allele frequencies were as published.24–26
Back to Top | Article Outline
Establishment of Lymphoblastoid Cell Lines
Peripheral mononuclear cells were isolated by Ficoll-Hypaque (Amersham Biosciences, Amersham, United Kingdom) density gradient centrifugation, from whole blood. The isolated mononuclear cells were then transformed with Epstein-Barr virus.28 Cells were grown in OptiMem medium (Invitrogen Life Technologies) supplemented with 2% fetal calf serum (Invitrogen Life Technologies), 2 mm l-glutamine (Invitrogen Life Technologies), and 100 U penicillin and streptomycin (Invitrogen Life Technologies), at 37°C, 5% CO2.
Back to Top | Article Outline
Membrane Preparation and Western Blot Analysis
Total microsomes were isolated from HEK293 cells, rat skeletal muscle, and Epstein-Barr virus–transformed B lymphocytes.28 RYR1 expression was analyzed using 6% SDS-PAGE and Western blotting. Immunostaining of proteins was performed using the ryanodine receptor–specific monoclonal antibody, 34C (Sigma, St. Louis, MO) and peroxidase-conjugated antimouse immunoglobulin G (Sigma) as secondary antibody followed by chemiluminescent detection (Roche Applied Science).
Back to Top | Article Outline
Radioactive 45Ca2+ Uptake and Release by B Lymphocytes
45Ca2+ uptake assays were performed in Hanks balanced salt solution (HBSS) containing 140 mm NaCl, 1 mm MgCl2, 2 mm CaCl2, and 10 mm HEPES (pH 7.4) as described previously.29 Briefly, approximately 1 × 107 cells/ml were incubated with 5–10 μCi 45CaCl2 (Amersham Biosciences) at 37°C for 60 min in HBSS buffer, into which 0.5 mm Na–adenosine triphosphate, 5 mm K2C2O4, and 100 μg/ml heparin were added. Aliquots of 200 μl containing 0.8 × 106 cells were removed from the incubation medium at appropriate time intervals and washed four times with HBSS buffer. The final wash was performed in calcium-free HBSS buffer containing 2 mm EGTA. Cell pellets were either resuspended and lysed in 200 μl Triton, 0.1%, or resuspended in 200 μl calcium-depleted HBSS buffer and incubated with 400–800 nm thapsigargin to release incorporated 45Ca2+. Radioactivity of the loaded/released 45Ca2+ was determined by liquid scintillation counting.
45Ca2+ release assays were performed using 4-CmC, after lymphocytes had been actively loaded for 1 h, with radioactive 45Ca2+. Cells were washed as above. Supernatant (200 μl) from the final wash was reserved for scintillation counting as prestimulated released 45Ca2+. Cell pellets were resuspended in 1 ml calcium-depleted HBSS buffer, and 200-μl aliquots of approximately 0.8 × 106 viable cells were transferred to separate microcentrifuge tubes and incubated with increasing concentrations of 4-CmC. Each sample was briefly centrifuged, and the resulting supernatant was collected and radioactivity determined by liquid scintillation counting. Counts per minute obtained for prestimulation were subtracted from those obtained after stimulation of cells with 4-CmC. The concentration of 4-CmC causing half-maximal release (EC50) of 45Ca2+ was determined by curve fitting. Parallel experiments were performed where thapsigargin14 was used to establish a reference standard for complete release of 45Ca2+ from endoplasmic reticulum stores. A time-dependence study of 4-CmC–stimulated calcium release was also performed29,30 to compare the amount and the rate of 45Ca2+ release from B lymphocytes of both MHS and MH-negative (MHN) individuals over a period of 20 min. Except where indicated, all manipulations including loading and release assays were performed at 37°C and washes in ice-cold HBSS buffers.
Back to Top | Article Outline
Statistical Analysis
Statistical analysis was performed using a paired t test and one-way analysis of variance (repeated measures). Analysis was performed using Analyse-it** (Microsoft, Redmond, WA) software for general and clinical laboratory statistics Excel version 1.73.
Back to Top | Article Outline

Results

Identification of the Novel H4833Y Mutation
Fig. 2
Fig. 2
Image Tools
A T4826I mutation had previously been identified in exon 100 of RYR1 in a large Maori MHS pedigree.21 As part of screening for the presence of this mutation in other MHS families, a 208-bp fragment encompassing exon 100 was amplified from genomic DNA of MHS individuals from other families and subjected to single-stranded conformation polymorphism analysis. An additional variant was identified, in a relative of case 1 (fig. 1, IV:17), by the appearance of an additional single-stranded DNA species that migrated slightly slower than the band associated with the T4826I mutation (fig. 2A, lane 2). DNA sequence analysis of the 208-bp polymerase chain reaction product revealed a novel C14997T transition that substituted tyrosine for histidine 4833 (fig. 2B). The three MH/CCD mutation regions were then sequenced, and no additional mutations were identified. Two hundred twenty chromosomes from unrelated (no family history of MH) control subjects of both Maori and Caucasian origin were analyzed by single-stranded conformation polymorphism for the presence of the C14997T polymorphism. The mutation was not detected in any of these families. H4833 is conserved across 14 ryanodine receptor sequences from human to Drosophila melanogaster.
Back to Top | Article Outline
Diagnosis by In Vitro Contracture Testing
Fig. 3
Fig. 3
Image Tools
Relatives of both individuals have had IVCT using the European Malignant Hyperthermia Group Protocol. Four had MHS test results, 3 had MH-equivocal results, and 12 had MHN results and are indicated in figures 1 and 3.
Back to Top | Article Outline
Diagnostic Test
A diagnostic test from genomic DNA was developed to facilitate analysis of additional family members. The heterozygote was clearly distinguished from the homozygote with melting temperatures of the wild-type and mutant alleles of 64°C and 55°C, respectively (data not shown). The RYR1 C14497T mutation was identified in DNA extracted from postmortem specimens of both case studies. The same mutation was identified in extended family members (fig. 1) as well as in a second family previously suspected to be susceptible to MH (fig. 3). There was complete concordance between the presence of the mutation and MHS in both families. These data suggest that the H4833Y mutation is causative of MH in the two families. The mutation was not detected in any of the MH-equivocal patients. We have yet to identify an MH-equivocal patient in any New Zealand family with an RYR1 mutation.
Back to Top | Article Outline
Haplotype Analysis
Haplotype analysis was performed on selected samples to examine the possibility that the two families had a common ancestor. Microsatellite markers flanking the RYR1 locus and three intragenic restriction fragment length polymorphism markers were used to analyze the chromosome 19q13.1 genotype in both families.24–26 This analysis revealed a common haplotype (3-2-2-1-5) that segregated with MHS in each family (figs. 1 and 3). Allele 3 for the D19S220 dinucleotide repeat is one of the least common reported in the Caucasian population.24,25 Allele 5 for the D19S47 dinucleotide repeat has an intermediate frequency in an undefined population.26 These results suggest that both families have inherited the H4833Y mutation from a common ancestor.
Back to Top | Article Outline
RYR1 Expression in B Lymphocytes
Fig. 4
Fig. 4
Image Tools
The expression of RYR1 in immortalized lymphocytes was investigated by immunoblotting analysis on subcellular membrane fractions. A distinct immunoreactive band of approximately 565 kd representing the ryanodine receptor was identified in rat skeletal muscle (fig. 4, lane 2) as well as in B lymphocytes (lane 4) but not in HEK293 cells (lane 3), which do not express the gene for the ryanodine receptor. Although the 34C antibody does recognize all three RyR isoforms, it has a lower affinity for RyR2 and RyR3, and RyR1 has been shown to be the predominant isoform expressed by B lymphocytes.16
Back to Top | Article Outline
Adenosine Triphosphate–dependent 45Ca2+ Uptake by Epstein-Barr Virus–immortalized B Lymphocytes
Lymphocytes were loaded with 45Ca2+ and total Ca2+ stores estimated after lysis with Triton X-100. The total 45Ca2+ incorporated into the cells and released by lysis with 0.1% Triton (results not shown) was only 2% greater than that released by 800 nm thapsigargin. Therefore, the amount released by 800 nm thapsigargin (considered to be approximately 100%) was used as a reference for 45Ca2+ release.14,31 Cells from MHS (fig. 1, IV:2 and V:13, and fig. 3, II:4) and MHN (fig. 1, V:10 and V:15, and fig. 3, III:4) patients were treated with 400–800 mm thapsigargin, which specifically blocks the sarco(endo) plasmic reticulum Ca2+–adenosine triphosphatase,32,33 to stimulate Ca2+ release from stores. No significant differences were found between MHS and MHN lymphocytes (data not shown). Therefore, the H4833Y mutation does not affect the thapsigargin-sensitive Ca2+ pool.
Back to Top | Article Outline
4-Chloro-m-Cresol Concentration–Response Activation of B Lymphocytes
Fig. 5
Fig. 5
Image Tools
Drug-induced 45Ca2+ release was initiated in a concentration-dependent manner with 4-CmC.18 Cells were stimulated with increasing concentrations of 4-CmC up to 1,000 μm, and the amount of 45Ca2+ released was calculated as a percentage relative to that which could be released by 800 nm thapsigargin. The amount of 45Ca2+ released from MHS cells was significantly greater than that from MHN cells at all concentrations of 4-CmC used (fig. 5). The EC50 of 45Ca2+ was lower for MHS cells (370 μm) than for MHN cells (670 μm), indicating a higher sensitivity to 4-CmC (fig. 5).
Back to Top | Article Outline

Discussion

A novel RYR1 C14997T mutation has been identified from postmortem tissue of two individuals who had fatal MH episodes, as well as from genomic DNA of relatives. MH susceptibility was confirmed by positive IVCT results of relatives. In addition, we have shown unequivocal evidence of cosegregation of the C14997T mutation with clinical diagnosis of MHS in two patients with fulminant MH episodes and in four patients diagnosed as MHS by IVCT, and absence of this mutation in 15 relatives diagnosed as MHN or MH-equivocal by IVCT. Taken together, these observations suggest a causative role in MH for the C14997T mutation.
We have shown that H4833Y is a potential candidate for MHS rather than a rare polymorphic codon by performing biochemical assays with 4-CmC in immortalized B lymphocytes from MHS individuals carrying the mutation and MHN individuals from two families. The amount of actively loaded 45Ca2+ released by 4-CmC from MHS cells was significantly greater than that released from MHN cells. Compared with MHN cells, 1.8-fold lower concentrations of 4-CmC were required to activate the release of 50% of the releasable 45Ca2+ from lymphocytes of MHS individuals harboring the skeletal muscle ryanodine receptor H4833Y mutation. This suggests that the increased 45Ca2+ response by B cells of MHS individuals to lower concentrations of 4-CmC is associated with this RYR1 mutation. These results are similar to those of previous studies on other RYR1 mutations that showed a 1.8- to 2.0-fold decrease in EC50 for 4-CmC–induced Ca2+ release from MHS compared with MHN cells.14,34–36 The H4833Y mutation does not seem to affect the thapsigargin-sensitive calcium pool, indicating that it is likely to be an MH-specific mutation rather than causative of CCD, because many CCD mutations in this region of the gene cause the channel to be leaky.1
We have developed a robust DNA-based diagnostic test for MH susceptibility in these two families so that other family members can be tested without the need for the IVCT. According to the European Malignant Hyperthermia Group guidelines,37 a negative result for the DNA test does not necessarily confer nonsusceptibility; however, a negative mutation analysis coupled with a negative B-lymphocyte test should be sufficient to make an MHN diagnosis. Of course, this does not rule out spontaneous mutations in the dihydropyridine receptor or other genes yet to be identified with MH. Some caution must also be exercised with an MHN diagnosis by DNA analysis, in families where discordance has been reported.21,38–40
This method of identifying MH susceptibility from postmortem tissue has yielded positive results in two other individuals. Both were sudden deaths unrelated to anesthesia, and both were from a family with a known RYR1 mutation. DNA was extracted from archival postmortem tissue from a female child who died at 9 months of age in 1969 and from a 2-yr-old girl several months after death following a 3-day viral illness. In both of these cases, DNA was extracted from postmortem tissue, and the familial mutation was demonstrated in both specimens.20
Patients may present for anesthesia with a family history of a fatality associated with anesthesia in a family member, which has not been previously investigated. In some cases, it may be possible to investigate the index case by postmortem analysis.21 Such a practice will assist in confirming MH susceptibility in families where little historic clinical information is available.
In conclusion, we suggest that the H4833Y substitution is causative of MH because Y4833 is associated with the MHS phenotype in two families and is absent in control individuals, H4833 is conserved across species, and it is located in an MH/CCD hot spot region of the RYR1 gene. Moreover, functional assays using immortalized B lymphocytes from patients harboring this mutation showed a significant increase in the amount of 45Ca2+ released compared with MHN cells.
Back to Top | Article Outline

References

1. Dirksen RT, Avila G: Altered ryanodine receptor function in central core disease: Leaky or uncoupled Ca(2+) release channels? Trends Cardiovasc Med 2002; 12:189–97

2. Jurkat-Rott K, McCarthy T, Lehmann-Horn FT: Genetics and pathogenesis of malignant hyperthermia. Muscle Nerve 2000; 23:4–17

3. Loke J, MacLennan DH: Malignant hyperthermia and central core disease: Disorders of Ca2+ release channels. Am J Med 1998; 104:470–86

4. Denborough M, Lovell R: Anaesthetic deaths in a family. Lancet 1960; 2:45

5. Wappler F: Malignant hyperthermia. Eur J Anaesthesiol 2001; 18:632–52

6. MacLennan DH, Duff C, Zorzato F, Fujii J, Phillips M, Korneluk RG, Frodis W, Britt BA, Worton RG: Ryanodine receptor gene is a candidate for predisposition to malignant hyperthermia. Nature 1990; 343:559–61

7. Britt BA, Kalow W: Malignant hyperthermia: A statistical review. Can Anaesth Soc J 1970; 17:293–315

8. Ording H: Incidence of malignant hyperthermia in Denmark. Anesth Analg 1985; 64:700–4

9. Hopkins PM: Malignant hyperthermia: Advances in clinical management and diagnosis. Br J Anaesth 2000; 85:118–28

10. Monnier N, Krivosic-Horber R, Payen JF, Kozak-Ribbens G, Nivoche Y, Adnet P, Reyford H, Lunardi J: Presence of two different genetic traits in malignant hyperthermia families: Implication for genetic analysis, diagnosis, and incidence of malignant hyperthermia susceptibility. Anesthesiology 2002; 97:1067–74

11. Monnier N, Kozak-Ribbens G, Krivosic-Horber R, Nivoche Y, Qi D, Kraev N, Loke J, Sharma P, Tegazzin V, Figarella-Branger D, Romero N, Mezin P, Bendahan D, Payen JF, Depret T, Maclennan DH, Lunardi J: Correlations between genotype and pharmacological, histological, functional, and clinical phenotypes in malignant hyperthermia susceptibility. Hum Mutat 2005; 26:413–25

12. Sambuughin N, Holley H, Muldoon S, Brandom BW, de Bantel AM, Tobin JR, Nelson TE, Goldfarb LG: Screening of the entire ryanodine receptor type 1 coding region for sequence variants associated with malignant hyperthermia susceptibility in the North American population. Anesthesiology 2005; 102:515–21

13. Robinson R, Carpenter D, Shaw MA, Halsall J, Hopkins P: Mutations in RYR1 in malignant hyperthermia and central core disease. Hum Mutat 2006; 27:977–89

14. Girard T, Cavagna D, Padovan E, Spagnoli G, Urwyler A, Zorzato F, Treves S: B-lymphocytes from malignant hyperthermia-susceptible patients have an increased sensitivity to skeletal muscle ryanodine receptor activators. J Biol Chem 2001; 276:48077–82

15. Sei Y, Brandom BW, Bina S, Hosoi E, Gallagher KL, Wyre HW, Pudimat PA, Holman SJ, Venzon DJ, Daly JW, Muldoon S: Patients with malignant hyperthermia demonstrate an altered calcium control mechanism in B lymphocytes. Anesthesiology 2002; 97:1052–8

16. Sei Y, Gallagher KL, Basile AS: Skeletal muscle type ryanodine receptor is involved in calcium signaling in human B lymphocytes. J Biol Chem 1999; 274:5995–6002

17. Tilgen N, Zorzato F, Halliger-Keller B, Muntoni F, Sewry C, Palmucci LM, Schneider C, Hauser E, Lehmann-Horn F, Muller CR, Treves S: Identification of four novel mutations in the C-terminal membrane spanning domain of the ryanodine receptor 1: Association with central core disease and alteration of calcium homeostasis. Hum Mol Genet 2001; 10:2879–87

18. Herrmann-Frank A, Richter M, Sarkozi S, Mohr U, Lehmann-Horn F: 4-Chloro-m-cresol, a potent and specific activator of the skeletal muscle ryanodine receptor. Biochim Biophys Acta 1996; 1289:31–40

19. Goelz SE, Hamilton SR, Vogelstein B: Purification of DNA from formaldehyde fixed and paraffin embedded human tissue. Biochem Biophys Res Commun 1985; 130:118–26

20. Davis M, Brown R, Dickson A, Horton H, James D, Laing N, Marston R, Norgate M, Perlman D, Pollock N, Stowell K: Malignant hyperthermia associated with exercise-induced rhabdomyolysis or congenital abnormalities and a novel RYR1 mutation in New Zealand and Australian pedigrees. Br J Anaesth 2002; 88:508–15

21. Brown RL, Pollock AN, Couchman KG, Hodges M, Waaka R, Lynch P, McCarthy TV, Stowell KM: A novel ryanodine receptor mutation and genotype-phenotype correlation in a large malignant hyperthermia New Zealand Maori pedigree. Hum Mol Genet 2000; 9:1515–24

22. Schutz E, von Ahsen N: Spreadsheet software for thermodynamic melting point prediction of oligonucleotide hybridization with and without mismatches. Biotechniques 1999; 27:1218–22, 1224

23. von Ahsen N, Oellerich M, Armstrong VW, Schutz E: Application of a thermodynamic nearest-neighbor model to estimate nucleic acid stability and optimize probe design: Prediction of melting points of multiple mutations of apolipoprotein B-3500 and factor V with a hybridization probe genotyping assay on the lightcycler. Clin Chem 1999; 45:2094–101

24. Gyapay G, Morisette JM, Vignal A, Dib C, Fizames C, Millaeau P, Marc P: The 1993-94 Genethon human genetic linkage map. Nat Genet 1994; 7:246–339

25. Weissenbach J, Gyapay G, Dib C, Vignal. A, Moissette J, Millasseau P, Vaysseix G, Lathrop M: A second-generation linkage map of the human genome. Nature 1992; 359:794–801

26. Weber JL, May PE: Abundant class of human polymorphisms which can be typed using the polymerase chain reaction. Am J Hum Genet 1989; 44:388–96

27. Gillard EF, Otsu K, Fujii J, Duff C, de Leon S, Khanna VK, Britt BA, Worton RG, MacLennan DH: Polymorphisms and deduced amino acid substitutions in the coding sequence of the ryanodine receptor (ryr1) gene in individuals with malignant hyperthermia. Genomics 1992; 13:1247–54

28. Neitzel H: A routine method for the establishment of permanent growing lymphoblastoid cell lines. Hum Genet 1986; 73:320–6

29. Du GG, Khanna VK, Guo X, MacLennan DH: Central core disease mutations R4892W, I4897T and G4898E in the ryanodine receptor isoform 1 reduce the Ca2+ sensitivity and amplitude of Ca2+-dependent Ca2+ release. Biochem J 2004; 382:557–64

30. Tintinger GR, Theron AJ, Steel HC, Anderson R: Accelerated calcium influx and hyperactivation of neutrophils in chronic granulomatous disease. Clin Exp Immunol 2001; 123:254–63

31. Ducreux S, Zorzato F, Ferreiro A, Jungbluth H, Muntoni F, Monnier N, Muller CR, Treves S: Functional properties of ryanodine receptors carrying three amino acid substitutions identified in patients affected by multi-minicore disease and central core disease, expressed in immortalized lymphocytes. Biochem J 2006; 395:259–66

32. Lytton J, Westlin M, Hanley MR: Thapsigargin inhibits the sarcoplasmic or endoplasmic reticulum Ca-ATPase family of calcium pumps. J Biol Chem 1991; 266:17067–71

33. Takemura H, Hughes AR, Thastrup O, Putney JW Jr: Activation of calcium entry by the tumor promoter thapsigargin in parotid acinar cells: Evidence that an intracellular calcium pool and not an inositol phosphate regulates calcium fluxes at the plasma membrane. J Biol Chem 1989; 264:12266–71

34. Censier K, Urwyler A, Zorzato F, Treves S: Intracellular calcium homeostasis in human primary muscle cells from malignant hyperthermia-susceptible and normal individuals: Effect of overexpression of recombinant wild-type and arg163cys mutated ryanodine receptors. J Clin Invest 1998; 101:1233–42

35. Endo M, Yagi S, Ishizuka T, Horiuti K, Koga Y, Amaha K: Changes in the calcium induced release mechanism in the sarcoplasmic reticulum of the muscle from a patient with malignant hyperthermia. Biomed Res 1983; 4:83–9

36. Wehner M, Rueffert H, Koenig F, Neuhaus J, Olthoff D: Increased sensitivity to 4-chloro-m-cresol and caffeine in primary myotubes from malignant hyperthermia susceptible individuals carrying the ryanodine receptor 1 thr2206met (C6617T) mutation. Clin Genet 2002; 62:135–46

37. Urwyler A, Deufel T, McCarthy T, West S: Guidelines for molecular genetic detection of susceptibility to malignant hyperthermia. Br J Anaesth 2001; 86:283–7

38. Fagerlund TH, Ording H, Bendixen D, Islander G, Ranklev Twetman E, Berg K: Discordance between malignant hyperthermia susceptibility and RYR1 mutation C1840T in two Scandinavian MH families exhibiting this mutation. Clin Genet 1997; 52:416–21

39. MacLennan DH: Discordance between phenotype and genotype in malignant hyperthermia. Curr Opin Neurol 1995; 8:397–401

40. Robinson RL, Anetseder MJ, Brancadoro V, van Broekhoven C, Carsana A, Censier K, Fortunato G, Girard T, Heytens L, Hopkins PM, Jurkat-Rott K, Klinger W, Kozak-Ribbens G, Krivosic R, Monnier N, Nivoche Y, Olthoff D, Rueffert H, Sorrentino V, Tegazzin V, Mueller CR: Recent advances in the diagnosis of malignant hyperthermia susceptibility: How confident can we be of genetic testing? Eur J Hum Genet 2003; 11:342–8

# European Malignant Hyperthermia Group. http://www.emhg.org/. Accessed August 5, 2007. Cited Here...
** Available at: www.analyse-it.com. Accessed June 1, 2007. Cited Here...

Cited By:

This article has been cited 9 time(s).

British Journal of Anaesthesia
Sequence capture and massively parallel sequencing to detect mutations associated with malignant hyperthermia
Schiemann, AH; Durholt, EM; Pollock, N; Stowell, KM
British Journal of Anaesthesia, 110(1): 122-127.
10.1093/bja/aes341
CrossRef
Pharmacogenomics
Malignant hyperthermia: a pharmacogenetic disorder
Stowell, KM
Pharmacogenomics, 9(): 1657-1672.
10.2217/14622416.9.11.1657
CrossRef
Anaesthesia and Intensive Care
Effects of propofol on calcium homeostasis in human skeletal muscle
Migita, T; Mukaida, K; Hamada, H; Kobayashi, M; Nishino, I; Yuge, O; Kawamoto, M
Anaesthesia and Intensive Care, 37(3): 415-425.

Anesthesia and Analgesia
Functional Properties of RYR1 Mutations Identified in Swedish Patients with Malignant Hyperthermia and Central Core Disease
Vukcevic, M; Broman, M; Islander, G; Bodelsson, M; Ranklev-Twetman, E; Muller, CR; Treves, S
Anesthesia and Analgesia, 111(1): 185-190.
10.1213/ANE.0b013e3181cbd815
CrossRef
Anaesthesia and Intensive Care
DNA analysis and malignant hyperthermia susceptibility
Stowell, KM; Pollock, N
Anaesthesia and Intensive Care, 36(3): 305-307.

Anesthesiology
Functional Studies of RYR1 Mutations in the Skeletal Muscle Ryanodine Receptor Using Human RYR1 Complementary DNA
Sato, K; Pollock, N; Stowell, K
Anesthesiology, 112(6): 1350-1354.
10.1097/ALN.0b013e3181d69283
PDF (270) | CrossRef
Plastic and Reconstructive Surgery
Evidence-Based Patient Safety Advisory: Malignant Hyperthermia
Gurunluoglu, R; Swanson, JA; Haeck, PC; the ASPS Patient Safety Committee,
Plastic and Reconstructive Surgery, 124(4S): 68S-81S.
10.1097/PRS.0b013e3181b54626
PDF (2152) | CrossRef
Anesthesiology
Case Scenario: Increased End-tidal Carbon Dioxide: A Diagnostic Dilemma
Tautz, TJ; Urwyler, A; Antognini, JF
Anesthesiology, 112(2): 440-446.
10.1097/ALN.0b013e3181ca7c38
PDF (402) | CrossRef
Current Opinion in Anesthesiology
Ambulatory surgery and malignant hyperthermia
Brandom, BW
Current Opinion in Anesthesiology, 22(6): 744-747.
10.1097/ACO.0b013e328332a45b
PDF (269) | CrossRef
Back to Top | Article Outline

© 2008 American Society of Anesthesiologists, Inc.

Publication of an advertisement in Anesthesiology Online does not constitute endorsement by the American Society of Anesthesiologists, Inc. or Lippincott Williams & Wilkins, Inc. of the product or service being advertised.
Login

Article Tools

Images

Share