Skip Navigation LinksHome > September 2007 - Volume 107 - Issue 3 > Apolipoprotein E e4 Allele Increases the Risk of Early Posto...
Anesthesiology:
doi: 10.1097/01.anes.0000278905.07899.df
Clinical Investigations

Apolipoprotein E e4 Allele Increases the Risk of Early Postoperative Delirium in Older Patients Undergoing Noncardiac Surgery

Leung, Jacqueline M. M.D., M.P.H.*; Sands, Laura P. Ph.D.†; Wang, Yun Ph.D.‡; Poon, Annie B.A.§; Kwok, Pui-yan M.D., Ph.D.∥; Kane, John P. M.D., Ph.D.#; Pullinger, Clive R. Ph.D.**

Free Access
Article Outline
Collapse Box

Author Information

Collapse Box

Abstract

Background: Whether patients who subsequently develop early postoperative delirium have a genetic predisposition that renders them at risk for postoperative delirium has not been determined.
Methods: The authors conducted a nested cohort study to include patients aged ≥ 65 yr who were scheduled to undergo major noncardiac surgery requiring anesthesia. A structured interview was conducted preoperatively and for the first 2 days postoperatively to determine the presence of delirium, defined using the Confusion Assessment Method. Blood was drawn for measurement of the apolipoprotein genotypes. Bivariate tests of association were conducted between delirium and apolipoprotein genotypes and other potentially important risk factors. Variables that had significant bivariate association with postoperative delirium were entered in a forward multivariable logistic regression model.
Results: Of the 190 patients studied, 15.3% developed delirium on both days 1 and 2 after surgery. Forty-six patients (24.2%) had at least one copy of the apolipoprotein e4 allele. The presence of one copy of the e4 allele was associated with an increased risk of early postoperative delirium (28.3% vs. 11.1%; P = 0.005). Even after adjusting for covariates, patients with one copy of the e4 allele were still more likely to have an increased risk of early postoperative delirium (odds ratio, 3.64; 95% confidence interval, 1.51–8.77) compared with those without the e4 allele.
Conclusions: Apolipoprotein e4 carrier status was associated with an increased risk for early postoperative delirium after controlling for known demographic and clinical risk factors. These results suggest that genetic predisposition plays a role and may interact with anesthetic/surgical factors contributing to the development of early postoperative delirium.
POSTOPERATIVE delirium is common in older patients after noncardiac surgery and is associated with increased rates of nursing home placement and hospital mortality.1 Despite this prevalence and clinical importance, no specific etiologic factor has been identified. Genetic studies in population-based investigations2,3 have demonstrated a relation between certain genotypes and the risk of dementia and cognitive decline. Specifically, elevated risk of Alzheimer disease has been demonstrated among individuals with the E4 allele of the apolipoprotein E (APOE) gene in many populations.4,5 The E4 allele of APOE is associated with a shift to an earlier age at onset of Alzheimer disease.6 However, the APOE E4 genotype is neither necessary nor sufficient for the occurrence of Alzheimer disease.6 The APOE polymorphism also affects response to trauma, age-related cognitive decline,7 and several other disorders.8–10
APOE is a polymorphic protein associated with plasma lipoproteins. Three major isoforms can be recognized, designated as APOE2, APOE3, and APOE4, according to their relative position after isoelectric focusing.11 APOE is unique among apolipoproteins in that it has a special relevance to nervous tissue.12 APOE is involved in the mobilization and redistribution of cholesterol in repair, growth, and maintenance of myelin and neuronal membranes during development or after injury.13–15 Whether patients who subsequently develop postoperative delirium have a genetic predisposition that renders them at risk for early postoperative delirium has not been determined.
This investigation hypothesized that the APOE4 allele increased the incidence of early postoperative delirium in older patients undergoing noncardiac surgery after controlling for covariates.
Back to Top | Article Outline

Materials and Methods

Patient Recruitment
The study was approved by the institutional review board for human research at the University of California, San Francisco, California, and informed consent was obtained preoperatively from each study patient. This nested cohort study was conducted from 2001 to 2006 at the University of California, San Francisco Medical Center, and the patients included were a subset of an ongoing investigation of the pathophysiology of postoperative delirium in elderly surgical patients. The inclusion criteria were consecutive English-speaking patients aged ≥ 65 yr who were scheduled to undergo major elective noncardiac surgery requiring anesthesia, and who were expected to remain in the hospital postoperatively for more than 48 h. Excluded were patients who did not provide or were incapable of providing informed consent.
Back to Top | Article Outline
Neurocognitive and Delirium Assessments
Each patient was interviewed by the same trained research assistant preoperatively and postoperatively on days 1 and 2 after surgery. The preoperative interview typically occurred less than 48 h before surgery in the preoperative clinic. During the preoperative interview, in addition to the assessment of medical history, the presence of depressive symptoms, pain, and functional status were also measured. Cognitive status was measured preoperatively using the Telephone Interview of Cognitive Status instrument,16 which was adapted from the Mini-Mental Status Examination. During both the preoperative and the two postoperative interviews, the presence of delirium was measured using the Confusion Assessment Method (CAM).17 The CAM assessments typically occurred 24–48 h after surgery and followed a brief structured interview that helped to determine the patients' ability to converse logically by asking several questions about the patients' postoperative experiences, including their levels of pain. This method was developed as a screening instrument based on operationalization of Diagnostic and Statistical Manual of Mental Disorders, Third Edition, Revised criteria for use by nonpsychiatric clinicians in high-risk settings. Based on a structured interview, the CAM algorithm consists of four clinical criteria: acute onset and fluctuating course, inattention, and disorganized thinking, and altered level of consciousness. For delirium to be defined, both the first and the second criteria have to be present, plus either the third or the fourth criterion. CAM has a sensitivity of 94–100%, a specificity of 90–95%, a high interobserver reliability,17 and convergent agreement with four other mental status tests.
Back to Top | Article Outline
Genotyping of APOE
Genomic DNA was prepared, from whole blood, using the Puregene DNA Purification System (Gentra Systems, Minneapolis, MN). Initially, APOE genotypes were determined using the restriction isotyping method described by Hixson and Vernier.18 Subsequently, a method was developed based on template directed dye terminator incorporation with fluorescence polarization detection as described by Hsu et al.19 to assay the two single nucleotide polymorphisms. These single nucleotide polymorphisms were rs429358 (p.Cys130Arg) and rs7412 (p.Arg176Cys). For the polymerase chain reaction (PCR), 2.4 ng DNA (dried) was amplified in 6 μl reaction solution containing 3 μl PCR primer mix (0.2 μm each primer), and PCR reagent mix using the following protocol: 95° for 2 min, 35 cycles of 92° for 10 s, 63° for 20 s, 68° for 30 s; 10 min at 68° to complete the elongation. The PCR reagent mix was as follows: 0.02 μl Platinum Taq (5 U/μl; Invitrogen, Carlsbad, CA), 0.5 μl 10X buffer, 0.25 μl MgCl2 (50 mm), 0.1 μl dNTP (2.5 mm), 0.5 μl Betaine–DMSO, and 1.63 μl water. The primers used were as follows: sense, AGACGCGGGCACGGCTGTCCAAGGA; antisense, CCTCGCGGGCCCCGGCCTGGTACAC. After exo-sap cleanup of the PCR product, the following primers were used for the two separate TDI reactions: TGCCGATGACCTGCAGAAG and GCGGACATGGAGGACGTG. We tested both methods (the DNA Purification System and the fluorescence polarization detection) independently against a large collection of isoelectric focusing gel data that records the phenotype (i.e., at the protein level) and found a high agreement (95%) between the genotype and phenotype.
Back to Top | Article Outline
Definition of Delirium
During the three interviews, trained interviewers determined the presence of delirium using the CAM.17 All assessments of postoperative delirium were validated by a second investigator (L.P.S.). We defined the occurrence of delirium as the patient meeting CAM criteria for delirium on both the first and second postoperative day assessments.
Back to Top | Article Outline
Assessment of Descriptive Characteristics and Covariates
The potential covariates included were those that in previous research were determined to be associated with postoperative delirium.20–22 The covariates included age, education, amount of alcohol intake, history of central nervous system disorders, preoperative depressive symptoms, preoperative functional status, and pain levels. Each of the covariates were collected either at the preoperative or postoperative interviews or abstracted from medical records. Preoperative demographics included age, highest education level achieved, amount of alcohol intake (more than 2 drinks vs. 2 drinks or fewer per day), depression, and functional status. Depression was measured using the Geriatric Depression Scale and defined as the presence of six or more symptoms of depression.23 Functional status was measured using the Activities of Daily Living24 and the Instrumental Activities of Daily Living.25 Assessment of pain at rest occurred both preoperatively and postoperatively using an 11-point rating scale in which 0 represents no pain and 10 represents the worst imaginable pain. Based on these assessments, it was determined whether the patient experienced an increase in level of pain after surgery. Medical record review was conducted to obtain information on perioperative blood pressure measurements. Other perioperative data obtained from chart review included the type of surgery; the American Society of Anesthesiologists physical status,26 which incorporates the number and severity of preoperative comorbid conditions; and the type of anesthesia (general, regional, or combined). Surgical risk was estimated using the guidelines from the American College of Cardiology and American Heart Association update for the perioperative cardiovascular evaluation for noncardiac surgery, which takes into consideration the type and duration of surgery, and intraoperative blood loss.27
Back to Top | Article Outline
Statistical Analysis
Bivariate associations between postoperative delirium and covariates that had been demonstrated in previous research to be associated with the presence of delirium were tested using Pearson chi-square tests for nominal predictor variables and Mantel-Haenszel chi-square tests for trend for ordinal predictor variables. Two-sample t tests or Wilcoxon rank sum test were used to test the association between the presence of delirium and continuous predictor variables. Variables that had a bivariate association with a P value of 0.20 or less were included in multivariate analyses to determine whether the association between apoE4 is associated with delirium after adjusting for potential explanatory variables. Bootstrapping techniques were used to determine the most consistent set of candidate variables for the final model. The procedure consisted of randomly drawing with replacement 1,000 samples and for each such sample, fitting the full model with all of the candidate variables. A threshold of P = 0.05 was used for eliminating a variable from the model. For each predictor variable, the percentage of models in which it was found significant was recorded. A multivariate logistic regression analysis was then computed to determine the independent effect of the e4 allele of APOE after adjusting for covariates that were associated with presence of delirium. Covariates included in the model were those variables that were associated with the outcome variable with a P value of 0.05 or less in at least 70% of the bootstrapped samples.
Back to Top | Article Outline

Results

A total of 203 patients were initially included, but only 190 were ultimately assessed for the presence of both APOE e4 allele and postoperative delirium. Delirium assessment was not performed in 13 patients because of postoperative intubation, unexpected early discharge from the hospital, or refusal/unavailability for testing. There was no difference in the demographics between patients who had missing delirium data versus those who were assessed for delirium.
Table 1
Table 1
Image Tools
Table 2
Table 2
Image Tools
Our study included an older cohort with a mean age of 72.5 ± 6 yr. The majority of the patients completed high school or higher education. Other preoperative and surgical characteristics are shown in tables 1 and 2.
Table 3
Table 3
Image Tools
Overall, 29 of 190 patients (15.3%) developed delirium that persisted for 2 days after surgery. By bivariate analysis, patients who developed postoperative delirium that persisted for 2 days after surgery were older, dependent in one or more independent activities of daily living, had a history of central nervous system disorder, had lower systolic postoperative blood pressures on postoperative day 1, and had increased pain levels at rest on postoperative day 1 (table 3). Patients who had postoperative delirium that persisted for 2 days after surgery had significantly longer hospital stay than those without delirium (8.1 ± 6.7 vs. 5.1 ± 3.5 days; P = 0.0008).
Table 4
Table 4
Image Tools
Of the 190 patients studied, 46 (24.2%) had at least one copy of the e4 allele. The presence of one copy of the e4 allele was associated with an increased risk of postoperative delirium that persisted for 2 days after surgery (28.3% vs. 11.1%; P = 0.005). Even after adjusting for covariates associated with postoperative delirium, which included age, change in postoperative pain levels, history of central nervous disorders, and so on, patients with at least one copy of the e4 allele were still more likely to have an increased risk of postoperative delirium (odds ratio, 3.64; 95% confidence interval, 1.51–8.77) compared with those without the e4 allele (table 4).
Back to Top | Article Outline

Discussion

Changes in cognitive status after surgery may present in the form of a frank delirium or more subtly as postoperative cognitive dysfunction (POCD). Delirium refers to observable changes in consciousness and attention,17,28 whereas POCD refers to a patient exhibiting significant declines from his or her own baseline level of performance in one or more neuropsychological domains.29–32 POCD presents more subtly than delirium and because it is detected with the administration of neuropsychological tests and often goes unrecognized in the clinical setting.
Our study is the first to report an association between APOE e4 status and the occurrence of postoperative delirium. Direct comparison of our results to previous studies is difficult because there is no information at present that directly compares the relation between postoperative delirium and POCD. One small study in critically ill patients, however, recently reported that apolipoprotein E4 was associated with longer duration of delirium.33 Several studies in surgical patients demonstrated conflicting results as to the impact of the APOE allele on POCD as determined by change from baseline in performance on neuropsychological tests.34–40 With the exception of one study,37 all were small and lacked the statistical power to detect a clinically significant effect of APOE allele on the occurrence of postoperative cognitive decline. The three smaller studies that demonstrated an association between APOE allele and cognitive decline were conducted in patients undergoing carotid endarterectomy and cardiac operations.34,39,40 The largest study that did not demonstrate an association between apolipoprotein E genotype and POCD did not measure postoperative delirium, and also likely underestimated the incidence of POCD because the investigators considered any patients who were not “fit enough for testing” as not having POCD.37 The APOE e4 frequency of 24.2% observed in our study is consistent with that previously reported, which ranged from 16% to 39.5%.34–40 If POCD and postoperative delirium are similar phenomena on a continuum, our results along with those from previous investigations would suggest that decline in cognitive status postoperatively does have a genetic predisposition.
What is the possible mechanism between apolipoprotein and postoperative delirium? Previous studies suggest that the effects of APOE are mediated through alterations in lipid transport in regenerating neurons, proinflammatory cytokine release from activated microglia, amyloid precursor protein metabolism, increased blood brain carrier permeability, alterations in platelet function, and systemic inflammation.41,42,43 One hypothesized mechanism is that APOE e4 allele diminishes the capacity for repair in cases of cerebral injury or capacity for homeostasis/maintenance. Whether this mechanism occurs to increase the likelihood of developing postoperative delirium remains to be proven.
In addition to the apolipoprotein genotype which was a novel finding in this study, several factors found to be independent predictors of postoperative delirium in our previous studies were also demonstrated. This includes older age and having a history of central nervous system disorders.
Back to Top | Article Outline
Potential Study Limitations
Although we have described an association between apolipoprotein genotype and postoperative delirium, we cannot determine the mechanism by which this genotypic appearance is related to postoperative delirium. We focused on measuring delirium in the early postoperative period, because subjects in this investigation were included in a larger studying examining perioperative management and delirium. As a result, incidents of later onset delirium may have been missed. Our study focuses on the comparison of the E4 alleles only; the study sample size precludes additional analyses to be performed in patients with other allele combinations. Finally, it is not known whether postoperative delirium is reversible, and the long-term prognostic significance, including whether patients with postoperative delirium and APOE e4 allele have higher risk for further cognitive impairment, is not known.
In conclusion, APOE e4 carrier status was associated with an increased risk for early postoperative delirium after controlling for known demographic and clinical risk factors. These results suggest that genetic predisposition plays a role and may interact with anesthetic/surgical factors and aging, contributing to the development of early postoperative delirium. Future studies on postoperative delirium and cognitive decline should consider the potential importance of genetic influence as one of the several etiologic factors.
The authors thank the following four individuals who were staff research associates in the Department of Anesthesia and Perioperative Care at the University of California, San Francisco: Ann Mullen, B.S., Linnea Vaurio, B.A., and Maureen Rico, B.S., for technical assistance in research data collection; and Tiffany Tsai, B.S., for literature search.
Back to Top | Article Outline

References

1. Cole MG: Delirium in elderly patients. Am J Geriatr Psychiatry 2004; 12:7–21

2. Yaffe K, Cauley J, Sands L, Browner W: Apolipoprotein E phenotype and cognitive decline in a prospective study of elderly community women. Arch Neurol 1997; 54:1110–4

3. Slooter A, Tang M-X, van Duign C, Stern Y, Ott A, Bell K, Breteler M, Broeckhoven C, Tatemichi T, Tycko B, Hofman A, Mayeux R: Apolipoprotein E ϵ4 and the risk of dementia with stroke: A population-based investigation. JAMA 1997; 277:818–21

4. Henderson A, Easteal S, Jorm A, Mackinnon A, Korten A, Christensen H, Croft L, Jacomb P: Apolipoprotein E allele ϵ4, dementia, and cognitive decline in a population sample. Lancet 1995; 346:1387–90

5. Maestre G, Ottman R, Stern Y, Gurland B, Chun M, Tang M, Shelanski M, Tycko B, Mayeux R: Apolipoprotein E and Alzheimer's disease: Ethnic variation in genotypic risks. Ann Neurol 1995; 37:254–9

6. Bird TD: Genetic factors in Alzheimer's disease. N Engl J Med 2005; 352:862–4

7. Dik M, Jonker C, Bouter L, Geerlings M, van Kamp G, Deeg D: APOE-e4 is associated with memory decline in cognitively impaired elderly. Neurology 2000; 54:1429–97

8. Lahoz C, Schaefer E, Cupples L, Wilson P, Levy D, Osgood D, Parpos S, Pedro-Botet J, Daly J, Ordovas J: Apolipoprotein E genotype and cardiovascular disease in the Framingham Heart Study. Atherosclerosis 2001; 154:529–37

9. Davignon J, Gregg R, Sing C: Apolipoprotein E polymorphism and atherosclerosis. Arteriosclerosis 1988; 8:1–21

10. Stengard J, Zebra K, Pekkanen J, Ehnholm C, Nissinen A, Sing C: Apolipoprotein E polymorphism predicts death from coronary heart disease in a longitudinal study of elderly Finnish men. Circulation 1995; 91:265–9

11. Mahley R, Rall S: Type III hyperlipoproteinemia (dysbetalipoproteinemia): The role of apolipoprotein E in normal and abnormal lipoprotein metabolism, The Metabolic and Molecular Bases of Inherited Disease. Edited by Scriver C, Beaudet A, Sly W, Valle D. New York, McGraw-Hill, 2001, pp 2835–62

12. Poirier J, Hess M, May P, Finch C: Astrocytic apolipoprotein E mRNA and GFAP mRNA in hippocampus after entorhinal cortex lesioning. Mol Brain Res 1991; 11:97–106

13. Boyle J, Zoellner C, Anderson L: A role for apolipoprotein E, apolipoprotein A-1, and low density lipoprotein receptors in cholesterol transport during regeneration and remyelination of rat sciatic nerve. J Clin Invest 1989; 83:1015–31

14. LeBlanc A, Poduslo J: Regulation of apolipoprotein E gene expression after injury of the rat sciatic nerve. J Neurosci Res 1990; 25:162–71

15. Mahley R: Apolipoprotein E: Cholesterol transport protein with expanding role in cell biology. Science 1988; 1988:622–30

16. Brandt J, Spencer M, Folstein M: The telephone interview for cognitive status. Neuropsychiatry Neuropsychol Behav Neurol 1988; 1:111–7

17. Inouye S, van Dyke C, Alessi C, Balkin S, Siegal A, Horwitz R: Clarifying confusion: The confusion assessment method. Ann Intern Med 1990; 113:941–8

18. Hixson JE, Vernier D: Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI. J Lipid Res 1990; 31:545–8

19. Hsu TM, Chen X, Duan S, Miller RD, Kwok PY: Universal SNP genotyping assay with fluorescence polarization detection. Biotechniques 2001; 31:560

20. Leung J, Sands L, Mullen E, Wang Y, Vaurio L: Are preoperative depressive symptoms associated with postoperative delirium in geriatric surgical patients? J Gerontol Med Sci 2005; 60A:1563–8

21. Leung JM, Sands LP, Vaurio LE, Wang Y: Nitrous oxide does not change the incidence of postoperative delirium or cognitive decline in elderly surgical patients. Br J Anaesth 2006; 96:754–60

22. Vaurio L, Sands L, Wang Y, Mullen E, Leung J: The role of pain and medications on postoperative delirium. Anesth Analg 2006; 102:267–73

23. Brink T, Yesavage J, Lum O, Heersema P, Adey M, Rose T: Screening tests for geriatric depression. Clinical Gerontologist 1982; 1:37–43

24. Katz W, Ford A, Moskokwitz R, Jackson B, Jaffe M: Studies of illness in the aged: The index of ADL: A standardized measure of biological and psychosocial function. JAMA 1963; 185:914–9

25. Lawton M, Brody E: Assessment of older people: Self-maintaining and instrumental activities of daily living. Gerontologist 1969; 9:179–86

26. American Society of Anesthesiologists: New classification of physical status. Anesthesiology 1963; 24:111

27. ACC/AHA guideline update for the perioperative cardiovascular evaluation for noncardiac surgery—Executive summary: A report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines (Committee to update the 1996 Guidelines on Perioperative Cardiovascular Evaluation for Noncardiac Surgery). Anesth Analg 2002; 94: 1052–64

28. Lipowski ZJ: Update on delirium. Psychiatr Clin North Am 1992; 15:335–46

29. Blumenthal JA, Mahanna EP, Madden DJ, White WD, Croughwell ND, Newman MF: Methodological issues in the assessment of neuropsychologic function after cardiac surgery. Ann Thorac Surg 1995; 59:1345–50

30. Mackensen GB, Gelb AW: Postoperative cognitive deficits: more questions than answers. Eur J Anaesthesiol 2004; 21:85–8

31. Hanning CD: Postoperative cognitive dysfunction. Br J Anaesth 2005; 95:82–7

32. Wu CL, Hsu W, Richman JM, Raja SN: Postoperative cognitive function as an outcome of regional anesthesia and analgesia. Reg Anesth Pain Med 2004; 29:257–68

33. Ely EW, Girard TD, Shintani AK, Jackson JC, Gordon SM, Thomason JW, Pun BT, Canonico AE, Light RW, Pandharipande P, Laskowitz DT: Apolipoprotein E4 polymorphism as a genetic predisposition to delirium in critically ill patients. Crit Care Med 2007; 35:112–7

34. Tardiff BE, Newman MF, Saunders AM, Strittmatter WJ, Blumenthal JA, White WD, Croughwell ND, Davis RD Jr, Roses AD, Reves JG: Preliminary report of a genetic basis for cognitive decline after cardiac operations. The Neurologic Outcome Research Group of the Duke Heart Center. Ann Thorac Surg 1997; 64:715–20

35. Steed L, Kong R, Stygall J, Acharya J, Bolla M, Harrison MJ, Humphries SE, Newman SP: The role of apolipoprotein E in cognitive decline after cardiac operation. Ann Thorac Surg 2001; 71:823–6

36. Robson MJ, Alston RP, Andrews PJ, Wenham PR, Souter MJ, Deary IJ: Apolipoprotein E and neurocognitive outcome from coronary artery surgery. J Neurol Neurosurg Psychiatry 2002; 72:675–6

37. Abildstrom H, Christiansen M, Siersma VD, Rasmussen LS: Apolipoprotein E genotype and cognitive dysfunction after noncardiac surgery. Anesthesiology 2004; 101:855–61

38. Askar FZ, Cetin HY, Kumral E, Cetin O, Acarer A, Kosova B, Yagdi T: Apolipoprotein E epsilon4 allele and neurobehavioral status after on-pump coronary artery bypass grafting. J Card Surg 2005; 20:501–5

39. Heyer EJ, Wilson DA, Sahlein DH, Mocco J, Williams SC, Sciacca R, Rampersad A, Komotar RJ, Zurica J, Benvenisty A, Quest DO, Todd G, Solomon RA, Connolly ES Jr: APOE-epsilon4 predisposes to cognitive dysfunction following uncomplicated carotid endarterectomy. Neurology 2005; 65:1759–63

40. Lelis RG, Krieger JE, Pereira AC, Schmidt AP, Carmona MJ, Oliveira SA, Auler JO Jr: Apolipoprotein E4 genotype increases the risk of postoperative cognitive dysfunction in patients undergoing coronary artery bypass graft surgery. J Cardiovasc Surg (Torino) 2006; 47:451–6

41. Parihar MS, Hemnani T: Alzheimer's disease pathogenesis and therapeutic interventions. J Clin Neurosci 2004; 11:456–67

42. Tsuang DW, Bird TD: Genetics of dementia. Med Clin North Am 2002; 86:591–614

43. Moretti EW, Morris RW, Podgoreanu M, Schwinn DA, Newman MF, Bennett E, Moulin VG, Mba UU, Laskowitz DT: APOE polymorphism is associated with risk of severe sepsis in surgical patients. Crit Care Med 2005; 33:2521–6

Cited By:

This article has been cited 14 time(s).

American Journal of Medical Genetics Part B-Neuropsychiatric Genetics
Genetic Polymorphisms in the DRD2, DRD3, and SLC6A3 Gene in Elderly Patients With Delirium
van Munster, BC; Yazdanpanah, M; Tanck, MWT; de Rooij, SEJA; van de Giessen, E; Sijbrands, EJG; Zwinderman, AH; Korevaar, JC
American Journal of Medical Genetics Part B-Neuropsychiatric Genetics, 153B(1): 38-45.
10.1002/ajmg.b.30943
CrossRef
Dementia and Geriatric Cognitive Disorders
The Role of Genetics in Delirium in the Elderly Patient
van Munster, BC; de Rooij, SE; Korevaar, JC
Dementia and Geriatric Cognitive Disorders, 28(3): 187-195.
10.1159/000235796
CrossRef
Canadian Journal of Anaesthesia-Journal Canadien D Anesthesie
Perioperative genomics and neurologic outcome: we can't change who we are
Grocott, HP
Canadian Journal of Anaesthesia-Journal Canadien D Anesthesie, 56(8): 562-566.
10.1007/s12630-009-9122-x
CrossRef
Mini-Reviews in Medicinal Chemistry
Anesthesia and Postoperative Cognitive Dysfunction (POCD)
Jungwirth, B; Zieglgansberger, W; Kochs, E; Rammes, G
Mini-Reviews in Medicinal Chemistry, 9(): 1568-1579.

International Review of Psychiatry
The genetics of deliria
Adamis, D; Van Munster, BC; Macdonald, AJD
International Review of Psychiatry, 21(1): 20-29.
10.1080/09540260802675510
CrossRef
Neurologic Clinics
Types of brain dysfunction in critical illness
Stevens, RD; Nyquist, PA
Neurologic Clinics, 26(2): 469-+.
10.1016/j.ncl.2008.02.004
CrossRef
American Journal of Medical Genetics Part B-Neuropsychiatric Genetics
The Association of the Dopamine Transporter Gene and the Dopamine Receptor 2 Gene With Delirium, a Meta-Analysis
van Munster, BC; de Rooij, SEJA; Yazdanpanah, M; Tienari, PJ; Pitkala, KH; Osse, RJ; Adamis, D; Smit, O; van der Steen, MS; van Houten, M; Rahkonen, T; Sulkava, R; Laurila, JV; Strandberg, TE; Tulen, JHM; Zwang, L; MacDonald, AJD; Treloar, A; Sijbrands, EJG; Zwinderman, AH; Korevaar, JC
American Journal of Medical Genetics Part B-Neuropsychiatric Genetics, 153B(2): 648-655.
10.1002/ajmg.b.31034
CrossRef
Clinics in Geriatric Medicine
Evaluation and Management of the Elderly Patient at Risk for Postoperative Delirium
Bagri, AS; Rico, A; Ruiz, JG
Clinics in Geriatric Medicine, 24(4): 667-+.
10.1016/j.cger.2008.06.002
CrossRef
Annals of Thoracic Surgery
The apolipoprotein E epsilon 4 allele is not associated with cognitive dysfunction in cardiac surgery
Silbert, BS; Evered, LA; Scott, DA; Cowie, TF
Annals of Thoracic Surgery, 86(3): 841-848.
10.1016/j.athoracsur.2008.04.085
CrossRef
Critical Care Clinics
Delirium: An Emerging Frontier in the Management of Critically Ill Children
Smith, HAB; Fuchs, DC; Pandharipande, PP; Barr, FE; Ely, EW
Critical Care Clinics, 25(3): 593-+.
10.1016/j.ccc.2009.05.002
CrossRef
Journal of Neuroinflammation
Changes in serum and cerebrospinal fluid cytokines in response to non-neurological surgery: an observational study
Bromander, S; Anckarsater, R; Kristiansson, M; Blennow, K; Zetterberg, H; Anckarsater, H; Wass, CE
Journal of Neuroinflammation, 9(): -.
ARTN 242
CrossRef
Anesthesiology
Case Scenario: Postoperative Delirium in Elderly Surgical Patients
Mantz, J; Hemmings, HC; Boddaert, J
Anesthesiology, 112(1): 189-195.
10.1097/ALN.0b013e3181c2d661
PDF (520) | CrossRef
Anesthesiology
We Care, Therefore We Are: Anesthesia-related Morbidity and Mortality: The 46th Rovenstine Lecture
Cottrell, JE
Anesthesiology, 109(3): 377-388.
10.1097/ALN.0b013e31818344da
PDF (1852) | CrossRef
The Neurologist
Adjunctive Haloperidol Prophylaxis Reduces Postoperative Delirium Severity and Duration in At-Risk Elderly Patients
Schrader, SL; Wellik, KE; Demaerschalk, BM; Caselli, RJ; Woodruff, BK; Wingerchuk, DM
The Neurologist, 14(2): 134-137.
10.1097/NRL.0b013e318166b88c
PDF (163) | CrossRef
Back to Top | Article Outline

© 2007 American Society of Anesthesiologists, Inc.

Publication of an advertisement in Anesthesiology Online does not constitute endorsement by the American Society of Anesthesiologists, Inc. or Lippincott Williams & Wilkins, Inc. of the product or service being advertised.
Login

Article Tools

Images

Share