Skip Navigation LinksHome > February 2007 - Volume 106 - Issue 2 > Increased Plasminogen Activator Inhibitor-1 Concentrations i...
Anesthesiology:
Clinical Investigations

Increased Plasminogen Activator Inhibitor-1 Concentrations in Bronchoalveolar Lavage Fluids Are Associated with Increased Mortality in a Cohort of Patients with Pseudomonas aeruginosa

Song, Yuanlin M.D.*; Lynch, Susan V. Ph.D.†; Flanagan, Judith Ph.D.†; Zhuo, Hanjing M.P.H.‡; Tom, Wynnson M.D.§; Dotson, Rachel H. M.D.∥; Baek, Marshall S. B.S.#; Rubio-Mills, Amua B.S.#; Singh, Gaurav B.A.**; Kipnis, Eric M.D.††; Glidden, David Ph.D.‡‡; Brown, Ron B.S.§§; Garcia, Oscar M.D.∥∥; Wiener-Kronish, Jeanine P. M.D.##

Free Access
Article Outline
Collapse Box

Author Information

Collapse Box

Abstract

Background: Increased plasminogen activator inhibitor-1 (PAI-1) concentrations are found in bronchoalveolar lavage (BAL) fluids from patients with ventilator-associated pneumonia or acute respiratory distress syndrome. The authors hypothesized that PAI-1 concentrations were associated with increased mortality in patients with either Pseudomonas aeruginosa–induced ventilator-associated pneumonia or tracheobronchial colonization.
Methods: In a prospective cohort study, daily aspirates from intubated patients were cultured for P. aeruginosa. Positive patients had blind BAL (bBAL) that was processed for biomarker concentrations. Secretion of type III secretion cytotoxins were also analyzed from the P. aeruginosa strains.
Results: Thirty-three patients were enrolled. Ten of the 33 patients died. bBAL PAI-1 concentrations were significantly increased in nonsurvivors compared with survivors (31.7 vs. 3.4 ng/ml, P = 0.001 for hospital mortality; 35.9 vs. 4.7 ng/ml, P = 0.02 for 28-day mortality). Even when acute respiratory distress syndrome patients were excluded, there was a significant difference between the survivors and nonsurvivors for bBAL PAI-1 concentrations (P = 0.005). Eighty-three percent of P. aeruginosa strains isolated from patients with high concentrations of bBAL PAI-1 also had strains that secreted cytotoxins.
Conclusions: PAI-1 concentrations in bBALs correlated with mortality in ventilated patients with positive cultures for P. aeruginosa. Elevated bBAL PAI-1 concentrations also correlated with the secretion of type III exotoxins by P. aeruginosa.
BIOMARKERS of lung injury have been actively sought because they could serve as objective diagnostic tools as well as prognostic indicators. Biomarkers that have been investigated in patients with ventilator-associated pneumonia (VAP) include biomarkers reflecting the activity of the coagulation/fibrinolysis cascade. Concentrations of plasminogen activator inhibitor 1 (PAI-1), a protease inhibitor that blocks fibrinolysis, were increased in the airspaces of patients who were diagnosed with VAP.1,2 In patients with VAP and infiltration of only one lung, PAI-1 concentrations were only increased in the infected lung.1 In contrast, patients with acute respiratory distress syndrome (ARDS) have increased PAI-1 concentrations in their plasma, suggesting a breakdown of the lung epithelial and endothelial barrier functions in ARDS.3,4 Furthermore, the patients with the highest plasma concentrations of PAI-1 had increased mortalities.3,4 PAI-1 concentrations were elevated in the bronchoalveolar lavage (BAL) fluids obtained from patients with aspiration pneumonia that subsequently progressed to ARDS,5 suggesting that fibrin deposition may be occurring in the airspaces of patients who develop ARDS.
Plasminogen activator inhibitor-1 concentrations have not been evaluated as prognostic indicators in mechanically ventilated patients without ARDS. As part of a prospective investigation of Pseudomonas aeruginosa colonization and infection of intubated, mechanically ventilated patients, we collected samples of blind BAL (bBAL) obtained from P. aeruginosa culture–positive patients suspected of having VAP. We were able to investigate the association of PAI-1, as well as two other biomarkers that have been evaluated in patients suspected of having VAP, protein C and soluble triggering receptor expressed on myeloid cells (sTREM-1),6,7 with patient mortality and with quantitative cultures.
Back to Top | Article Outline

Materials and Methods

Patient Enrollment Criteria and Study Design
This study was approved by the Institutional Review Board of University of California, San Francisco, California. The study was conducted in a single-center tertiary care hospital. The patients originated from three intensive care units (ICUs), including a combined medical–surgical ICU, a neurointensive care unit, and a vascular–cardiac intensive care unit. The inclusion criteria were any mechanically ventilated adult older than 18 yr who was not pregnant and required a fraction of inspired oxygen (Fio2) of 0.80 or less. Only patients that remained ventilated for 48 h were cultured, and if they had a positive culture for P. aeruginosa, they were approached for consent. All patients in the three ICUs had daily endotracheal aspirates obtained, which were then cultured selectively for P. aeruginosa on Pseudomonas isolation agar in our laboratory. Patients with positive endotracheal aspirate cultures were approached for enrollment; written informed consent was obtained from either the patient or the patient’s surrogate before collecting the bBALs. The day of enrollment was the first day of a positive endotracheal aspirate culture for P. aeruginosa. Patients with positive P. aeruginosa cultures were requested to undergo bBAL (when they were suspected to have VAP based on clinical symptoms such as fever, purulent sputum, and increased leukocyte count), and we were permitted to retain a portion of the fluid from enrolled patients for our studies.
All patients were followed up for a minimum of 28 days, until hospital discharge or death. Quantitative cultures of P. aeruginosa were performed daily on the endotracheal aspirates for as long as the patient was intubated or for 28 days, whichever came first. bBALs were conducted with a sterile catheter (Combicath; Plastimed Lab, Le Plessis Bouchard, France; see Materials and Methods, Collection of bBAL and Quantitative Bacteria Culture, second sentence). Other patient data obtained included Simplified Acute Physiology Score II and Acute Physiology and Chronic Health Evaluation Score II, Lung Injury Scores, Multiple Organ Dysfunction Score, Logistic Organ Dysfunction System Score, Sequential Organ Failure Assessment, antibiotic usage, tidal volume, mode of ventilation, and other physiologic data.
Back to Top | Article Outline
Definitions Used
Ventilator-associated Pneumonia.
The diagnosis of VAP was established according to published criteria.8,9 Mechanical ventilation for 48 h or more was required, the occurrence of a new and persistent pulmonary infiltrate on chest radiograph had to be seen, and two of the following criteria had to be present: (1) temperature greater than 38°C or less than 36°C, (2) leukocyte count of greater than 10 × 109/l or less than 4 × 109/l, or (3) purulent tracheal secretions. Finally, quantitative cultures with a threshold of 104 colony-forming units/ml in the bBAL were required to confirm the diagnosis.
Back to Top | Article Outline
Colonization.
Colonization was defined as isolation of P. aeruginosa with or without other bacteria, from at least one endotracheal aspirate culture in the absence of clinical signs or symptoms of infection.
Back to Top | Article Outline
Bacteremia and Fungemia.
Bacteremia and fungemia were defined as positive blood cultures for bacteria or fungi.
Back to Top | Article Outline
Septic Shock.
Patients were diagnosed with septic shock if they presented with the following two criteria10: (1) confirmed positive blood culture; (2) systolic blood pressure less than 90 mmHg, a mean artery pressure less than 60 mmHg, or a reduction of 40 mmHg in the systolic blood pressure from baseline. These two criteria in combination with two or more of the following criteria defined septic shock: (1) heart rate greater than 90 beats/min; (2) body temperature less than 36°C or greater than 38°C; (3) hyperventilation greater than 20 breaths/min or, on blood gas, arterial carbon dioxide tension (Paco2) less than 32 mmHg; (4) leukocyte count less than 4,000 cells/mm3 or greater than 12,000 cells/mm3 (< 4 × 109 cells/l or > 12 × 109 cells/l).
Back to Top | Article Outline
Adequate Antibiotic Treatment.
This term was defined as a regimen that included at least one anti-pseudomonal antibiotic that the organism was sensitive to. The antibiotic had to have been administered 3 days before the bBAL and/or 1 week after bBAL.
Back to Top | Article Outline
Collection of bBAL and Quantitative Bacteria Culture
The bBAL was performed by experienced respiratory therapists working in the ICUs.11 Briefly, a sterile plugged telescoping catheter was inserted into the lung blindly through the endotracheal tube until the tip of the catheter met resistance. The catheter was withdrawn a short distance to allow advancement of the inner catheter displacing the plug and allowing infusion of the saline. Up to 60 ml sterile warm saline was infused into the airway (average instillation 20 ml). Approximately 3–5 ml was then suctioned with a sterile syringe. The BAL fluid sample was centrifuged at 5,000 rpm for 10 min, and the supernatant was aliquoted and immediately stored at −70°C. Approximately 1 ml bBAL fluid was transferred to the clinical microbiology laboratory for quantitative cultures of all bacteria. Calibrated loops (which have been shown to be as accurate as serial dilution12) were used in the clinical laboratory to quantify bacteria in the bBAL fluid.
Back to Top | Article Outline
Protein C, PAI-1, and sTREM-1 Measurement
Three biomarkers were compared in the bBAL samples. All were measured in duplicate according to the manufacturer’s protocol. Briefly, PAI-1 was measured by an enzyme-linked immunosorbent assay kit (Catalog no. REF8223; American Diagnostica Inc., Stamford, CT) without any dilution. Protein C concentrations were measured by an enzyme-linked immunosorbent assay kit without dilution (Helena Laboratories, Beaumont, TX; Ca# 529113). Each patient’s bBAL protein C level was calculated as percentile of normal plasma protein C activity. sTREM-1 was measured using a self-coated 96-well plate (R&D Systems, Inc., Minneapolis, MN; Ca# DY1278) without additional dilution. The sensitivity of PAI-1 detection was 1 ng/ml for undiluted samples. Intraassay variation was 4.3%, 6.1%, and 6.8% for PAI-1, protein C, and sTREM-1 assays, respectively.
Back to Top | Article Outline
Multiplex PCR Analyses of Type III Secretion System Genotype
Pseudomonas aeruginosa clinical isolates were cultured in 200 μl Luria broth in 96-well plates overnight at 37°C without shaking. Cultures were diluted 1:10 or 1:100 in sterile water before addition into the polymerase chain reaction (PCR) mixture. Multiplex PCR reactions consisted of 5 μl diluted culture, 3.75 pmol of each primer, (exoU, CCGTTGTGGTGCCGTTGAAG, CCAGATGTTCACCGACTCGC; exoS, GCGAGGTCAGCAGAGTAT, TTCGGCGTCA CTGTGGATGC; exoY, CGGATTCTATGGCAGGGAGG, GCCCTTGATGCACTCGAC CA; exoT, AATCGCCGTCCAACTGCA TGCG, TGTTCGCCGAGGTACTGCTC), 12.5 μl TaqPCR Mastermix (Qiagen, Valencia, CA), and 5.5 μl sterile H2O to give a final volume of 25 μl. Reactions were performed in a GeneAmp thermocycler (Applied Biosystems, Foster City, CA) as follows: 94°C for 2 min, followed by 36 cycles of 94°C for 30 s, 58°C for 30 s, 68°C for 1 min, and a final extension step of 68°C for 7 min. PCR products were visualized on a 3% agarose gel, stained with ethidium bromide, and viewed under ultraviolet light.
Back to Top | Article Outline
Immunoblot Analysis of PcrV, ExoS, and ExoU
Representative isolates from each patient were cultured under type III secretion system–inducing conditions in MIN-S medium.14 Cultures were incubated with shaking overnight at 37°C before dilution to optical density at 600 nm wavelength of 0.1 in fresh MIN-S medium and cultured for a further 5 h. Bacterial cells were harvested by centrifugation and the supernatant removed. Cell-free supernatant from each sample was concentrated using Centricon tubes (molecular weight cutoff 10 kd; Millipore, Bedford, MA). The cell pellet was lysed using sodium dodecyl sulfate lysis buffer (1% sodium dodecyl sulfate and 50 mm Tris-HCl, pH 8.0) and boiling. Protein concentration in both cell lysate and secreted fractions was determined by the Biorad Dc protein quantification kit (Bio-Rad Laboratories, Hercules, CA). Standardized protein concentrations were loaded onto polyacrylamide gels and run under denaturing conditions. Polyacrylamide gels were transferred to polyvinylidene fluoride membrane and immunoblotted with anti-PcrV, anti-ExoS, or anti-ExoU as previously described.15 ExoS and ExoU secretion was quantified by densitometry and normalization to a known concentration of pure cytotoxin loaded on the same gel. Immunoblot analysis sensitivity was determined to be greater than 20 ng, greater than 13 ng, and less than 20 ng for anti-PcrV, anti-ExoS, and anti-ExoU, respectively.
Back to Top | Article Outline
Statistics
Data were analyzed using STATA 9.0 Software (StataCorp LP, College Station, TX). Student t tests were used for the comparisons of approximately normally distributed continuous variables and Wilcoxon–Mann–Whitney tests were used for the comparisons of skewed continuous variables. Categorical variables were compared by chi-square tests or Fisher exact tests, as appropriate. Logistic regression was used to calculate odds ratios for the association between the biomarkers’ (PAI-1, protein C, sTREM-1) concentrations in the bBAL and mortality. Spearman analysis was used to correlate between bBAL PAI-1 and ExoS and ExoU secretion. All tests were two-sided. Statistical significance was defined as P values of 0.05 or less.
Back to Top | Article Outline

Results

Patient Characteristics
Table 1
Table 1
Image Tools
Thirty-three patients who underwent BAL were enrolled in this study from August 2002 to May 2005. Table 1 summarizes the patient characteristics. Among the 33 patients whose endotracheal aspirate cultures were positive for P. aeruginosa at enrollment, 31 were positive for P. aeruginosa and/or other bacteria in the bBAL samples, and 2 patients had no bacterial growth in their bBAL fluid. The overall ICU mortality was 21.2%, the 28-day mortality was 15.2%, and the hospital mortality was 30.3%.
Back to Top | Article Outline
Antibiotic Administration
All 33 patients received antibiotics during their stay in ICU, 26 (81.3%) patients received antibiotics that were active against the P. aeruginosa cultured before the bBAL was performed, and 30 (96.8%) received the antibiotics after the bBAL was performed. Antibiotics were changed in 20 patients within 72 h of the performance of the bBAL, and there was no association between the antibiotics the patients received and the bBAL fluid concentrations of PAI-1, protein C, or sTREM-1 (data not shown).
Back to Top | Article Outline
Biomarker Concentrations in Patients Who Met and Did Not Meet VAP Criteria
Table 2
Table 2
Image Tools
Classification of patients according to the criteria for VAP resulted in 11 patients who met the criteria and 22 patients who did not met these criteria (table 2). There were no significant differences between the concentrations of the bBAL PAI-1, protein C, or sTREM-1 between the patients who met the criteria for VAP and those who did not. There was a significant difference between the clinical scores; the Logistic Organ Dysfunction System Score (P < 0.02), the Multiple Organ Dysfunction Score (P < 0.03), and the Sequential Organ Failure Assessment (P < 0.03) scores obtained on the day of bBAL were different between the patients who met the VAP criteria and the patients who did not meet the criteria (table 2).
Back to Top | Article Outline
Biomarker Concentrations and Mortality
Table 3
Table 3
Image Tools
Table 3 summarizes the clinical parameters on the day of study enrollment between the survivors and the nonsurvivors. There was no significant difference for age, arterial oxygen tension (Pao2)/Fio2, Simplified Acute Physiology Score II, or Acute Physiology and Chronic Health Evaluation Score II on the day of enrollment, or clinical scores on the day of enrollment between the survivors and nonsurvivors (table 3). The survivors had significantly more ventilator-free days than the nonsurvivors (table 3).
Back to Top | Article Outline
bBAL PAI-1
Fig. 1
Fig. 1
Image Tools
Figures 1A and B illustrate that bBAL PAI-1 concentrations were significantly higher in the patients who died than in the patients who lived. This was true for both hospital mortality (P = 0.001) and 28-day mortality (P = 0.003). Figure 1C shows that there was a continuous increase of mortality as PAI-1 concentration increased. Analysis of quartile bBAL PAI-1 concentrations documents a stepwise increase of mortality with increasing bBAL PAI-1 concentrations (fig. 1D). Comparisons between the concentrations of bBAL PAI-1 from patients with different quantitative cultures of P. aeruginosa and other bacteria showed that there was no correlation between the bBAL PAI-1 concentrations and the BAL bacteria burdens (fig. 1E).
Fig. 2
Fig. 2
Image Tools
Blind bronchoalveolar lavage PAI-1 concentrations in ARDS patients were significantly higher than the concentrations measured in patients without ARDS (P = 0.003; fig. 2A). We therefore performed a secondary analysis excluding patients with ARDS. A significant difference between survivors and nonsurvivors in bBAL fluid PAI-1 concentration remained, even after the exclusion of the ARDS patients (P = 0.005 for hospital mortality, fig. 2B; and P = 0.078 for 28-day mortality, fig. 2C).
Other possible confounders that might increase PAI-1 concentrations in the circulation and in the lungs of patients include the presence of bacteremia, fungemia, and septic shock. Only one patient had bacteremia within 1 week of the bBAL. The bacteremic patient’s bBAL PAI-1 concentration was not elevated, so this patient was not excluded. None of the patients met the criteria for septic shock before the performance of the bBAL; therefore, septic shock does not seem to be a confounding factor in this group of patients.
Coinfection by other bacteria e.g., Staphylococcus aureus, Staphylococcus epidermis, Stenotrophomonas, Enterococcus species, and/or Candida albicans, could affect patient outcomes16; therefore, we analyzed the PAI-1 concentration of the bBALs with respect to colony-forming units of other bacterial species identified in the patient bBALs (less or more than 104 colony-forming units/ml). No difference between the bBAL PAI-1 concentrations was found even when these other bacteria were considered. Further, no difference in patient mortality was detected when these other bacteria were considered. This suggests that the quantity of P. aeruginosa colony-forming units on the day of mini-BAL and the presence of other bacterial species did not seem to affect bBAL PAI-1 concentration or patient mortality.
The majority of patients were ventilated with a volume control ventilation mode, either assist control or synchronized intermittent mandatory ventilation. Post end-expiratory pressure was set at 5 cm H2O almost uniformly. Because high tidal volume may induce lung injury,17 we compared the tidal volumes between the survivors and nonsurvivors. Tidal volume per ideal body weight did not differ between survivors and nonsurvivors, suggesting that tidal volume was not a confounding factor in this study (tables 2 and 3).
Back to Top | Article Outline
Association of Type III Virulence Secretion and bBAL PAI-1 Concentrations
Fig. 3
Fig. 3
Image Tools
Type III virulence is dependent on the expression and active secretion of both a cytotoxin and the PcrV protein.15 Thirty strains (a representative strain for each patient) were chosen from the cohort. Of the strains analyzed, 24 possessed the exoS gene, and 6 strains possessed exoU (determined by multiplex PCR); all strains carried the gene for pcrV. The ability to produce and secrete cytotoxins (ExoS and ExoU) and PcrV was determined by immunoblot analysis. Figure 3A illustrates a typical immunoblot analysis of the secreted fraction using anti-ExoS, anti-ExoU, and anti-PcrV immunoglobulin G to detect each respective protein. The majority of strains secreted PcrV. Strains associated with high BAL PAI-1 exhibited PcrV secretion and high concentrations of ExoS in the extracellular fraction. Those associated with low PAI-1 concentrations exhibited low or nondetectable concentrations of ExoS and/or PcrV in the secreted fraction (fig. 3B; the Spearman correlation between ExoS and PAI-1 is 0.44 with P = 0.03). Because ExoU is a significantly more potent cytotoxin compared with ExoS, considerably less ExoU cytotoxin secretion is necessary to cause significant lung damage. Analysis of ExoU-containing strains demonstrated that all strains secreted PcrV. Strains associated with low PAI-1 concentrations exhibited secretion of very low ExoU concentrations. Those with elevated PAI-1 levels (these were among the highest concentrations of PAI-1 detected in the total cohort) demonstrated the highest concentrations of the potent ExoU cytotoxin in the extracellular fraction (fig. 3C; the Spearman correlation between ExoU and PAI-1 is 0.83 with P = 0.04).
Back to Top | Article Outline
bBAL Protein C Level
Fig. 4
Fig. 4
Image Tools
The protein C levels of the bBALs measured in this study were substantially lower than those previously reported in either lung edema or plasma samples.13 This is likely due to the fact that unlike the previous two samples, bBAL samples are diluted with saline. In contrast to the bBAL PAI-1 concentration differences in the two patient groups (survivors vs. nonsurvivors), we did not find a significant difference in protein C concentrations between these two groups (fig. 4A). There was also no correlation between the bBAL protein C concentrations and the quantitative cultures of P. aeruginosa in the bBAL fluid (data not shown).
Back to Top | Article Outline
bBAL sTREM-1 Concentrations
We developed an enzyme-linked immunosorbent assay to quantify the BAL sTREM-1 concentration. Previous reports used an immunoblot technique that was not standardized to the amount of protein in the various fluids.7 We measured sTREM-1 concentrations that were much higher than had been reported using the immunoblot. There was huge variability of bBAL sTREM-1 concentrations, which ranged from near 0 to around 1,653 pg/ml. There were no significant differences between the bBAL sTREM-1 concentrations between the survivors and nonsurvivors (fig. 4B). No association was found between bBAL sTREM-1 concentrations and quantities of bacteria in bBAL fluid (data not shown).
Back to Top | Article Outline
Univariate Analysis of Mortality and Concentrations of the Measured Biomarkers
Table 4
Table 4
Image Tools
Table 4 details the univariate analysis of bBAL PAI-1, protein C, and sTREM-1 concentrations and mortality. From the analysis, it is evident that only PAI-1 concentrations predicted hospital and 28-day mortality.
Back to Top | Article Outline

Discussion

Biomarker Concentration and Mortality
The most significant finding of this investigation is that elevated concentrations of PAI-1 in bBAL fluids are associated with increased hospital and 28-day mortality in mechanically ventilated patients who had positive bBAL cultures for P. aeruginosa and/or other bacteria. We did not find an association between mortality and elevated concentrations of either sTREM-1 or of protein C in the bBALs. This result documents that elevated PAI-1 concentrations in bBALs are similar to the finding of elevated PAI-1 in edema fluids from ARDS patients, suggesting that elevated PAI-1 concentrations are associated with increased mortality in a variety of patients, with and without severe lung injury.
This result further suggests that the presence of airspace P. aeruginosa might specifically affect the coagulation/fibrinolysis system. In fact, Kipnis et al.18 demonstrated that the instillation of P. aeruginosa activated alveolar thrombin in isolated lungs. Whether P. aeruginosa activates the coagulation system more than other bacteria has not been shown, but the ability of P. aeruginosa to injure both the epithelial and endothelial barriers of the lung19,20 explains why it could activate the coagulation system and increase PAI-1.
Notably, the concentrations of PAI-1 in the bBAL did not correlate with concentrations of total protein or myeloperoxidase concentrations in the bBAL (data not shown). The PAI-1 concentrations also did not correlate with the clinical markers of lung injury, nor did the PAI-1 concentrations correlate with the physiologic Pao2/Fio2 ratio used to detect lung injury. Previous reports in patients with ARDS21 also noted that plasma PAI-1 did not correlate with lung injury scores in that population, but elevated PAI-1 concentrations were also associated with increased mortality in the ARDS patients.3,4 The cause of death of the patients in this study (similar to that of patients who have ARDS) was primarily due to multisystem organ failure that always included lung injury. Six of the 10 patients who died in our study had more than two organs failing before death. Our results are also similar to those of a recent investigation5 where the median bBAL PAI-1 concentrations were approximately fivefold higher in the ARDS patients than the concentrations found in patients without ARDS.
Elevated PAI-1 concentrations have also been previously found in the airspaces of patients with unilateral lung infections and not found in the airspaces of the opposite, uninfected lungs.1 The patients with the unilateral lung infections clearly had a contained infection that was not associated with other organ failure. In contrast to that investigation, we obtained bBAL fluid from patients with more diffuse lung infiltrates. Our patients also usually had multisystem organ failure (see previous paragraph). Because the presence of ARDS is associated with elevations in the concentrations of PAI-1, we performed analyses from which ARDS patients were excluded. Elevations of PAI-1 in the bBAL of patients without ARDS were still associated with increased mortality.
Back to Top | Article Outline
Elevations of PAI-1 Concentrations and Quantitative Cultures
Several reports have shown that PAI-1 levels increase in patients who develop VAP but are not elevated in patients who do not develop VAP.1,22 The 11 patients in the current study who met the criteria for VAP did not have different PAI-1 concentrations compared with the concentrations in the patients who did not meet the criteria for VAP. All patients received antibiotics before and after the bBAL. This may have influenced the quantitative culture results. Therefore, we cannot be sure whether PAI-1 concentrations correlate with bacterial number in the absence of antibiotics. However, this investigation documents that the elevated PAI-1 concentrations in the bBAL fluids, despite antibiotic treatments, correlates with mortality.
Back to Top | Article Outline
bBAL PAI-1 Concentrations and P. aeruginosa Secretion of Toxins
Pseudomonas aeruginosa binds to airway epithelium through lipopolysaccharide, flagella, and pili. Upon cell contact, the type III secretion system, which delivers toxins directly into host cells through a needle-like apparatus, is activated.23 Key component proteins of the needle-like translocator include PopB, PopD, and PcrV. The known P. aeruginosa cytotoxins injected include ExoU, ExoS, ExoT, and ExoY. These cytotoxins vary in potency with ExoU, a phospholipase/lysophospholipase, being more than 100 times more virulent than ExoS.24 ExoU is responsible for decompartmentalization of the inflammatory response in a septic mouse model,25 and its secretion (in conjunction with PcrV secretion) correlates strongly with patient mortality.15 Mutual exclusive secretion between ExoS and ExoU suggest that ExoS is also an important toxin in certain strains. In all cases, secretion of PcrV is crucial to efficient intoxication of eukaryotic cells.
Analysis of the toxin secretion by the P. aeruginosa strains documented a correlation between cytotoxin and PcrV secretion and the measurement of elevated bBAL PAI-1 concentrations. It seems that a relatively linear correlation exists between the quantity and potency of cytotoxin secreted and the PAI-1 levels recorded. Strains secreting ExoU exhibited some of the highest PAI-1 concentrations in the cohort, whereas the majority of those secreting low concentrations of ExoS exhibited nondetectable PAI-1 concentrations. These results suggest that effective type III cytotoxin secretion results in increased PAI-1 concentrations in lung airspaces. The explanation for the nonsecreting strains maybe that alternative epithelium-damaging virulence factors, such as pyocyanin or elastase, may be responsible for the elevated PAI-1 concentrations in these strains. Furthermore, there may be secretion of nonfunctional cytotoxins or PcrV that account for the small number of strains that exhibit cytotoxin secretion but had low levels of bBAL PAI-1. Further characterization of these anomalous strains is necessary to confirm or disprove these hypotheses.
Back to Top | Article Outline
Limitations of the Investigation
The investigation included a small number of patients in a single institution, limiting the generalizability of the conclusions. The universal administration of antibiotics in these patients may have affected the quantitative cultures, preventing a discovery of an association between the biomarkers and quantitative cultures. Because we did not measure PAI-1, protein C, and sTREM-1 in the patients’ plasma samples, we could not compare the local versus systemic effects of these biomarkers. However, the robust association seen between elevated PAI-1 bBAL concentrations and mortality in patients with and without ARDS, despite ongoing antibiotic treatment, suggests that elevations of PAI-1 concentrations in the airspaces of patients’ lungs reflects a grave prognosis. Also, the association of the secretion of type III cytotoxins by the P. aeruginosa strains with the highest elevations of PAI-1 suggests that the virulence of the P. aeruginosa may affect the concentrations of PAI-1 in the airspaces of patients. Clearly further investigation is needed to determine whether a causal relation exists between these or other cytotoxins and PAI-1 elevations.
Back to Top | Article Outline
Summary
Elevations of PAI-1 concentrations in bBAL fluids were significantly associated with increased mortality in a cohort of patients with positive endotracheal cultures for P. aeruginosa. The association with mortality remained even after excluding patients with ARDS from the analyses. Results demonstrated an association between patients with the highest elevations of PAI-1 concentrations in their bBAL and secretion of type III cytotoxins by the P. aeruginosa strains. These observations suggest that PAI-1 concentrations may be affected by the virulence factors produced by P. aeruginosa.
The authors thank DeAnna Sosnowchik, B.S. (Research Associate, Department of Anesthesia and Perioperative Care, University of California, San Francisco), for her help in sample storage in this investigation.
Back to Top | Article Outline

References

1. Choi G, Schultz MJ, van Till JW, Bresser P, van der Zee JS, Boermeester MA, Levi M, van der Poll T: Disturbed alveolar fibrin turnover during pneumonia is restricted to the site of infection. Eur Respir J 2004; 24:786–9

2. Schultz MJ, Haitsma JJ, Zhang H, Slutsky AS: Pulmonary coagulopathy as a new target in therapeutic studies of acute lung injury or pneumonia: A review. Crit Care Med 2006; 34:871–7

3. Prabhakaran P, Ware LB, White KE, Cross MT, Matthay MA, Olman MA: Elevated levels of plasminogen activator inhibitor-1 in pulmonary edema fluid are associated with mortality in acute lung injury. Am J Physiol Lung Cell Mol Physiol 2003; 285:L20–8

4. Ware LB, Eisner MD, Wickersham N, Olman MA, Thompson BT, Parsons P, Matthay MA: Plasminogen activator inhibitor-1 (PAI-1) a marker of impaired fibrinolysis, is associated with higher mortality in patients with ALI/ARDS (abstract). Am J Respir Crit Care 2004; 169:A115

5. El Solh AA, Bhora M, Pineda L, Aquilina A, Abbetessa L, Berbary E: Alveolar plasminogen activator inhibitor-1 predicts ARDS in aspiration pneumonitis. Intensive Care Med 2006; 32:110–5

6. Choi G, Schultz MJ, Levi M, van der Poll T, Millo JL, Garrard CS: Protein C in pneumonia. Thorax 2005; 60:705–6

7. Gibot S, Cravoisy A, Levy B, Bene MC, Faure G, Bollaert PE: Soluble triggering receptor expressed on myeloid cells and the diagnosis of pneumonia. N Engl J Med 2004; 350:451–8

8. Zedtwitz-Liebenstein K, Schenk P, Apfalter P, Fuhrmann V, Stoiser B, Graninger W, Schuster E, Frass M, Burgmann H: Ventilator-associated pneumonia: Increased bacterial counts in bronchoalveolar lavage by using urea as an endogenous marker of dilution. Critical Care Med 2005; 33:756–9

9. Mayhall CG: Ventilator-associated pneumonia or not? Contemporary diagnosis. Emerg Infect Dis 2001; 7:200–4

10. Tsiotou AG, Sakorafas GH, Anagnostopoulos G, Bramis J: Septic shock: Current pathogenetic concepts from a clinical perspective. Med Sci Monit 2005; 11:RA76–85

11. Rouby JJ, Rossignon MD, Nicolas MH, Martin de Lassale E, Christin S, Grosset J, Viars P: A prospective study of protected bronchoalveolar lavage in the diagnosis of nosocomial pneumonia. Anesthesiology 1989; 71:679–85

12. Afessa B, Hubmayr RD, Vetter EA, Keegan MT, Swanson KL, Baddour LM, Cockerill FR III, Peters SG: Bronchoscopy in ventilator-associated pneumonia: Agreement of calibrated loop and serial dilution. Am J Respir Crit Care Med 2006; 173:1229–32

13. Ware LB, Fang X, Matthay MA: Protein C and thrombomodulin in human acute lung injury. Am J Physiol Lung Cell Mol Physiol 2003; 285:L514–21

14. Nicas TI, Iglewski BH: Isolation and characterization of transposon-induced mutants of Pseudomonas aeruginosa deficient in production of exoenzyme S. Infect Immun 1984; 45:470–4

15. Roy-Burman A, Savel RH, Racine S, Swanson BL, Revadigar NS, Fujimoto J, Sawa T, Frank DW, Wiener-Kronish JP: Type III protein secretion is associated with death in lower respiratory and systemic Pseudomonas aeruginosa infections. J Infect Dis 2001; 183:1767–74

16. Stephan F, Mabrouk N, Decailliot F, Delclaux C, Legrand P: Ventilator-associated pneumonia leading to acute lung injury after trauma: Importance of haemophilus influenzae. Anesthesiology 2006; 104:235–41

17. Bregeon F, Delpierre S, Chetaille B, Kajikawa O, Martin TR, Autillo-Touati A, Jammes Y, Pugin J: Mechanical ventilation affects lung function and cytokine production in an experimental model of endotoxemia. Anesthesiology 2005; 102:331–9

18. Kipnis E, Guery BP, Tournoys A, Leroy X, Robriquet L, Fialdes P, Neviere R, Fourrier F: Massive alveolar thrombin activation in Pseudomonas aeruginosa-induced acute lung injury. Shock 2004; 21:444–51

19. Pittet JF, Kudoh I, Wiener-Kronish JP: Endothelial exposure to Pseudomonas aeruginosa proteases increases the vulnerability of the alveolar epithelium to a second injury. Am J Respir Cell Mol Biol 1998; 8:129–35

20. Saliba AM, Filloux A, Ball G, Silva AS, Assis MC, Plotkowski MC: Type III secretion-mediated killing of endothelial cells by Pseudomonas aeruginosa. Microb Pathog 2002; 33:153–66

21. Groeneveld AB, Kindt I, Raijmakers PG, Hack CE, Thijs LG: Systemic coagulation and fibrinolysis in patients with or at risk for the adult respiratory distress syndrome. Thromb Haemost 1997; 78:1444–9

22. Determann RM, Millo JL, Garrard CS, Schultz MJ: Bronchoalveolar levels of plasminogen activator inhibitor-1 and soluble tissue factor are sensitive and specific markers of pulmonary inflammation. Intensive Care Med 2006; 32:946–7

23. Kipnis E, Sawa T, Wiener-Kronish JP: Targeting mechanisms of Pseudomonas aeruginosa pathogenesis. Med Mal Infect 2006; 36:78–91

24. Lee VT, Smith RS, Tummler B, Lory S: Activities of Pseudomonas aeruginosa effectors secreted by the type III secretion system in vitro and during infection. Infect Immun 2005; 73:1695–705

25. Kurahashi K, Kajikawa O, Sawa T, Ohara M, Gropper MA, Frank DW, Martin TR, Wiener-Kronish JP: Pathogenesis of septic shock in Pseudomonas aeruginosa pneumonia. J Clin Invest 1999; 104:743–50

26. Le Manach Y, Perel A, Coriat P, Godet G, Bertrand M, Riou B: Early and delayed myocardial infarction after abdominal aortic surgery. Anesthesiology 2005; 102:885–91

27. Bernard GR: Quantification of organ dysfunction: Seeking standardization. Crit Care Med 1998; 26:1767–8

Cited By:

This article has been cited 12 time(s).

American Journal of Physiology-Lung Cellular and Molecular Physiology
Protein C and acute inflammation: a clinical and biological perspective
Christiaans, SC; Wagener, BM; Esmon, CT; Pittet, JF
American Journal of Physiology-Lung Cellular and Molecular Physiology, 305(7): L455-L466.
10.1152/ajplung.00093.2013
CrossRef
Intensive Care Medicine
Elevated PAI-1 is associated with poor clinical outcomes in pediatric patients with acute lung injury
Sapru, A; Curley, MAQ; Brady, S; Matthay, MA; Flori, H
Intensive Care Medicine, 36(1): 157-163.
10.1007/s00134-009-1690-2
CrossRef
American Journal of Respiratory and Critical Care Medicine
Persistent infection with Pseudomonas aeruginosa in ventilator-associated pneumonia
El Solh, AA; Alkinnusi, ME; Wiener-Kronish, JP; Lynch, SV; Pineda, LA; Szarpa, K
American Journal of Respiratory and Critical Care Medicine, 178(5): 513-519.
10.1164/rccm.200802-239OC
CrossRef
Critical Care
4G/5G polymorphism of PAI-1 gene is associated with multiple organ dysfunction and septic shock in pneumonia induced severe sepsis: prospective, observational, genetic study
Madach, K; Aladzsity, I; Szilagyi, A; Fust, G; Gal, J; Penzes, I; Prohaszka, Z
Critical Care, 14(2): -.
ARTN R79
CrossRef
European Journal of Haematology
A review of pulmonary coagulopathy in acute lung injury, acute respiratory distress syndrome and pneumonia
Nieuwenhuizen, L; de Groot, PG; Grutters, JC; Biesma, DH
European Journal of Haematology, 82(6): 413-425.
10.1111/j.1600-0609.2009.01238.x
CrossRef
Journal of Antimicrobial Chemotherapy
Update on the treatment of Pseudomonas aeruginosa pneumonia
El Solh, AA; Alhajhusain, A
Journal of Antimicrobial Chemotherapy, 64(2): 229-238.
10.1093/jac/dkp201
CrossRef
Anesthesiology
Decreased Alveolar Fibrinolysis in Patients with Ventilator-associated Pneumonia: A Species-specific Event
El Solh, AA; Schultz, M
Anesthesiology, 107(4): 677.
10.1097/01.anes.0000281981.78659.26
PDF (510) | CrossRef
Anesthesiology
Assessment of the Accuracy of Procalcitonin to Diagnose Postoperative Infection after Cardiac Surgery
Jebali, MA; Hausfater, P; Abbes, Z; Aouni, Z; Riou, B; Ferjani, M
Anesthesiology, 107(2): 232-238.
10.1097/01.anes.0000271871.07395.ad
PDF (331) | CrossRef
Critical Care Medicine
Targeting lung coagulation disorders in acute lung injury: Easy as pie (PAI-1)?
Kipnis, E; Guery, B
Critical Care Medicine, 35(5): 1448-1449.
10.1097/01.CCM.0000262547.19416.3B
PDF (465) | CrossRef
Critical Care Medicine
Influence of renal dysfunction on the accuracy of procalcitonin for the diagnosis of postoperative infection after vascular surgery
Amour, J; Birenbaum, A; Langeron, O; Le Manach, Y; Bertrand, M; Coriat, P; Riou, B; Bernard, M; Hausfater, P
Critical Care Medicine, 36(4): 1147-1154.
10.1097/CCM.0b013e3181692966
PDF (690) | CrossRef
Critical Care Medicine
Increased mortality of ventilated patients with endotracheal Pseudomonas aeruginosa without clinical signs of infection*
Zhuo, H; Yang, K; Lynch, SV; Dotson, RH; Glidden, DV; Singh, G; Webb, WR; Elicker, BM; Garcia, O; Brown, R; Sawa, Y; Misset, B; Wiener-Kronish, JP
Critical Care Medicine, 36(9): 2495-2503.
10.1097/CCM.0b013e318183f3f8
PDF (536) | CrossRef
Critical Care Medicine
Targeting lung coagulation disorders in acute lung injury: Easy as pie (PAI-1)?
Goda, C; Schultz, MJ; Solh, AE
Critical Care Medicine, 35(5): 1449.
10.1097/01.CCM.0000262533.91817.74
PDF (465) | CrossRef
Back to Top | Article Outline

© 2007 American Society of Anesthesiologists, Inc.

Publication of an advertisement in Anesthesiology Online does not constitute endorsement by the American Society of Anesthesiologists, Inc. or Lippincott Williams & Wilkins, Inc. of the product or service being advertised.
Login

Article Tools

Images

Share