Skip Navigation LinksHome > November 27, 2010 - Volume 24 - Issue 18 > Broadening of CD8+ cell responses in vaccine-based simian im...
AIDS:
doi: 10.1097/QAD.0b013e3283402206
Basic Science

Broadening of CD8+ cell responses in vaccine-based simian immunodeficiency virus controllers

Iwamoto, Namia; Tsukamoto, Tetsuoa; Kawada, Mikia; Takeda, Akikoa; Yamamoto, Hiroyukia; Takeuchi, Hiroakia; Matano, Tetsuroa,b

Free Access
Article Outline
Collapse Box

Author Information

aInternational Research Center for Infectious Diseases, The Institute of Medical Science, The University of Tokyo, Japan

bAIDS Research Center, National Institute of Infectious Diseases, Tokyo, Japan.

Received 19 June, 2010

Revised 23 August, 2010

Accepted 1 September, 2010

Correspondence to Tetsuro Matano, International Research Center for Infectious Diseases, The Institute of Medical Science, The University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639, Japan. Tel: +81 3 6409 2078; fax: +81 3 6409 2076; e-mail: matano@ims.u-tokyo.ac.jp

Collapse Box

Abstract

Objective: In our prior study on a prophylactic T-cell-based vaccine, some vaccinated macaques controlled a simian immunodeficiency virus (SIV) challenge. These animals allowed viremia in the acute phase but showed persistent viral control after the setpoint. Here, we examined the breadth of postchallenge virus-specific cellular immune responses in these SIV controllers.

Design: We previously reported that in a group of Burmese rhesus macaques possessing the MHC haplotype 90-120-Ia, immunization with a Gag-expressing vaccine results in nonsterile control of a challenge with SIVmac239 but not a mutant SIV carrying multiple cytotoxic T lymphocyte (CTL) escape gag mutations. In the present study, we investigated whether broader cellular immune responses effective against the mutant SIV replication are induced after challenge in those vaccinees that maintained wild-type SIVmac239 control.

Methods: We analyzed cellular immune responses in these SIV controllers (n = 8).

Results: These controllers elicited CTL responses directed against SIV non-Gag antigens as well as Gag in the chronic phase. Postvaccinated, prechallenge CD8+ cells obtained from these animals suppressed wild-type SIV replication in vitro, but mostly had no suppressive effect on the mutant SIV replication, whereas CD8+ cells in the chronic phase after challenge showed efficient antimutant SIV efficacy. The levels of in-vitro antimutant SIV efficacy of CD8+ cells correlated with Vif-specific CD8+ T-cell frequencies. Plasma viremia was kept undetectable even after the mutant SIV superchallenge in the chronic phase.

Conclusion: These results suggest that vaccine-based wild-type SIV controllers can acquire CD8+ cells with the potential to suppress replication of SIV variants carrying CTL escape mutations.

Back to Top | Article Outline

Introduction

Virus-specific CD8+ cytotoxic T lymphocyte (CTL) responses are crucial for the control of HIV and simian immunodeficiency virus (SIV) replication [1–6]. Cumulative studies on HIV-infected individuals have shown association of HLA genotypes with rapid or delayed AIDS progression [7,8]. For instance, most of the HIV-infected individuals possessing HLA-B*57 have been indicated to show a better prognosis with lower viral loads, implicating HLA-B*57-restricted epitope-specific CTL responses in this viral control [9–11]. Indian rhesus macaques possessing particular major histocompatibility complex class I (MHC-I) alleles such as Mamu-B*17 tend to show SIV control [12–14]. These imply possible HIV control by induction of particular effective CTL responses.

Recent trials of prophylactic T-cell-based vaccines in macaque AIDS models have indicated a possibility of reduction in postchallenge viral loads [15–20]. We previously developed a prophylactic AIDS vaccine consisting of a DNA prime followed by a boost with a Sendai virus (SeV) vector expressing SIVmac239 Gag (SeV-Gag) [21,22]. Our trial showed vaccine-based control of a SIVmac239 challenge in a group of Burmese rhesus macaques sharing the MHC-I haplotype 90–120-Ia; these 90-120-Ia-positive vaccinees dominantly elicited Gag206-216 (IINEEAADWDL) epitope-specific and Gag241-249 (SSVDEQIQW) epitope-specific CTL responses and contained SIVmac239 replication after challenge [15,23]. In contrast, 90-120-Ia-positive vaccinees failed to control a challenge with a mutant virus, SIVmac239Gag216S244E247L312V373T (referred to as SIV-G64723mt), which carries five gag mutations resulting in escape from recognition by Gag-specific CTLs including Gag206-216-specific and Gag241-249-specific CTLs. This indicates that these CTL responses play a crucial role in the vaccine-based primary control of wild-type SIVmac239 replication [24]. Furthermore, in a SIVmac239 challenge experiment of 90-120-Ia-positive rhesus macaques that received a prophylactic vaccine expressing the Gag241-249 epitope fused with enhanced green fluorescent protein (EGFP), this single epitope vaccination resulted in control of SIVmac239 replication with dominant induction of Gag241-249-specific CTL responses in the acute phase after challenge [25]. We refer to these vaccinated animals that controlled viral replication after wild-type SIVmac239 challenge as SIV controllers in the present study.

Administration of SIV controllers with a monoclonal anti-CD8 antibody (i.e., CD8 depletion after the establishment of primary viral control) has suggested that CD8+ cell responses play an important role in maintaining the viral control in the chronic phase [26,27]. Then, it is of great concern whether these wild-type SIV controllers can acquire CD8+ cells effective against replication of SIV variants escaping from dominant CTL responses. In the present study, we have analyzed 90-120-Ia-positive vaccinees controlling a SIVmac239 challenge in order to examine whether 90-120-Ia-positive animals can elicit cellular immune responses effective against the mutant SIV, SIV-G64723mt, carrying multiple CTL escape gag mutations. Our analyses in these vaccine-based SIV controllers revealed dynamics of virus-specific cellular immune responses during persistent viral control and suggested postchallenge induction of CD8+ cells able to suppress replication of SIV variants carrying CTL escape mutations.

Back to Top | Article Outline

Materials and methods

SIV-G64723mt

The SIV-G64723mt (SIVmac239Gag216S244E247L312V373T) carries five gag mutations, GagL216S (leading to a leucine [L]-to-serine [S] substitution at the 216th amino acid in Gag, GagD244E (aspartic acid [D]-to-glutamic acid [E] at the 244th amino acid), GagI247L (isoleucine [I] to L at the 247th amino acid), GagA312 V (alanine [A] to valine [V] at the 312th amino acid), and GagA373T (A to threonine [T] at the 373rd amino acid), which were selected, at the cost of viral fitness, in a SIVmac239-infected macaque possessing the MHC-I haplotype 90-120-Ia, as described previously [23,28]. GagL216S, GagD244E, GagI247L, and GagA373T mutations, which became dominant mostly in SIVmac239-infected 90-120-Ia-positive rhesus macaques, result in viral escape from recognition by Gag206-216-specific, Gag241-249-specific, and Gag373-380-specific CTLs, respectively, whereas it remains unclear whether GagA312V was selected for by CTLs.

Back to Top | Article Outline
Animal experiments

Eight Burmese rhesus macaques (Macaca mulatta) possessing the MHC-I haplotype 90-120-Ia, which showed vaccine-based control of a SIVmac239 challenge, were used in this study and divided into two groups (Fig. 1a). Five macaques, R06-015, R03-014, R03-012, R02-002, and R02-003, in group I received a prophylactic DNA prime/SeV-Gag boost vaccine (referred to as DNA/SeV-Gag vaccine) and contained SIVmac239 challenge as reported previously [15,24,29]. The DNA used for the vaccination, CMV-SHIVdEN [15], was constructed from env-deleted and nef-deleted simian–human immunodeficiency virus SHIVMD14YE [30] molecular clone DNA (SIVGP1) and has the genes encoding SIVmac239 Gag, Pol, Vif, and Vpx, SIVmac239-HIV chimeric Vpr, and HIV Tat and Rev. At the DNA vaccination, animals received 5 mg of CMV-SHIVdEN DNA intramuscularly. Six weeks after the DNA prime, animals received a single boost intranasally with 6 × 109 cell infectious units (CIUs) of F-deleted replication-defective SeV-Gag [31,32]. At week 1 after SIV challenge, macaque R03-014 was inoculated with nonspecific immunoglobulin G (IgG), and macaques R03-012 and R02-002 with IgG purified from neutralizing antibody-positive plasma of chronically SIV-infected macaques in our previous study [29]. Two macaques R04-016 and R06-007 in group II received a prophylactic prime-boost vaccine eliciting single Gag241-249 epitope-specific CTL responses (referred to as DNA/SeV-Gag236-250-EGFP vaccine) and contained SIVmac239 challenge as reported previously [25]. In this vaccine protocol, animals were primed with 5 mg of pGag236-250-EGFP-N1 DNA expressing a Gag236-250-EGFP fusion protein, followed by a boost with 6 × 109 CIU of F-deleted SeV expressing the Gag236-250-EGFP fusion protein (SeV-Gag236-250-EGFP). Macaque R04-015 in group II received a prophylactic prime-boost vaccine eliciting Gag206-216 epitope-specific and Gag241-249 epitope-specific CTL responses (referred to as DNA/SeV-Gag202-216-EGFP and DNA/SeV-Gag236-250-EGFP vaccine); this animal was primed with pGag202-216-EGFP-N1 and pGag236-250-EGFP-N1 DNAs, followed by a boost with SeV-Gag202-216-EGFP and SeV-Gag236-250-EGFP. Both pGag202-216-EGFP-N1 and SeV-Gag202-216-EGFP express a Gag202-216-EGFP fusion protein [33]. These vaccinated animals were challenged intravenously with 1000 50% tissue culture infective doses (TCID50) of SIVmac239 [34] approximately 3 months after the boost and were superchallenged intravenously with 1000 TCID50 of SIV-G64723mt in the chronic phase. The challenge virus stocks were prepared by virus propagation on rhesus macaque peripheral blood mononuclear cells (PBMCs). All animals were maintained in accordance with the guidelines for animal experiments at the National Institute of Infectious Diseases.

Fig. 1
Fig. 1
Image Tools
Back to Top | Article Outline
In-vitro viral suppression assay

To evaluate in-vitro anti-SIVmac239 or anti-SIV-G64723mt efficacy of CD8+ cells, we examined SIVmac239 or SIV-G64723mt replication on CD8-depleted PBMCs in the presence of CD8+ cells positively selected from macaque PBMCs as described previously [27,35]. In brief, PBMCs were separated into CD8+ and CD8 cells by using Macs CD8 MicroBeads (Miltenyi Biotec, Tokyo, Japan). For preparing target cells, the CD8 cells selected from PBMCs obtained before SIVmac239 challenge were cultured in the presence of 2 μg/ml phytohemagglutinin L and 20 IU/ml recombinant human interleukin-2 (Roche Diagnostics, Tokyo, Japan) and infected with SIVmac239 at a multiplicity of infection (MOI) of 1: 103 TCID50/cell or with SIV-G64723mt at MOI of 1: 102 TCID50/cell, using the virus stocks prepared by virus propagation on HSC-F cells (herpesvirus saimiri-immortalized macaque T-cell line) [36]. SIV-G64723mt with lower replicative ability was added at higher MOI to show similar replication kinetics with SIVmac239 replication in the control culture without CD8+ cells. Target cells were cultured for 2 days and then effector CD8+ cells selected from PBMCs obtained 1 week after boost or at several time points after the challenge were added to the target cells at an effector: target (E: T) ratio of 1: 4. Reverse transcriptase activities in these culture supernatants were measured [37] to determine the peak of viral production in the control culture of target cells without CD8+ cells. RNA was extracted from culture supernatants at the peak using the high pure viral RNA Kit (Roche Diagnostics) and viral RNA levels were measured by LightCycler system (Roche Diagnostics) using SIV gag-specific primers (GTAGTATGGGCAGCAAATGA and TGTTCCTGTTTCCACCACTA) and probes (GCATTCACGCAGAAGAGAAAGTGAAACA-Flu and LCRed-ACTGAGGAAGCAAAACAGATAGTGCAGAGA) (Nihon Gene Research Laboratories Inc., Sendai, Japan). Reduction in viral production by addition of each group of CD8+ cells was shown as reduction (fold) in viral RNA level compared with that in the supernatant from virus-infected CD8 cell culture without CD8+ cells.

Back to Top | Article Outline
Analysis of virus-specific CD8+ T-cell responses

We measured virus-specific CD8+ T-cell levels by flow cytometric analysis of gamma interferon (IFN-γ) induction after specific stimulation as described previously [15]. In brief, PBMCs were cocultured for 6 h with autologous herpesvirus papio-immortalized B-lymphoblastoid cell lines pulsed with 1 μmol/l SIVmac239 Gag206-216, Gag241-249, or Gag367-381 peptides for Gag206-216-specific, Gag241-249-specific, or Gag367-381-specific stimulation. Alternatively, PBMCs were cocultured with B-lymphoblastoid cell lines pulsed with peptide pools using panels of overlapping peptides spanning the entire SIVmac239 Gag, Pol, Vif, Vpx, Vpr, Tat, Rev, Nef, and Env amino acid sequences. Intracellular IFN-γ staining was performed using a CytofixCytoperm kit (BD, Tokyo, Japan) and fluorescein isothiocyanate-conjugated antihuman CD4, peridinin chlorophyll protein-conjugated antihuman CD8, allophycocyanin-conjugated antihuman CD3, and phycoerythrin-conjugated antihuman IFN-γ monoclonal antibodies (BD). Specific CD8+ T-cell levels were calculated by subtracting nonspecific IFN- γ+ CD8+ T-cell frequencies from those after peptide-specific stimulation. Specific CD8+ T-cell levels lower than 100 per million PBMCs were considered negative.

Back to Top | Article Outline
Analysis of virus-specific neutralizing antibody responses

SIVmac239-specific neutralizing antibody responses were examined by determining the end point plasma titers for inhibiting 10 TCID50 virus replication as described previously [26]. Serial two-fold dilutions of heat-inactivated plasma were prepared in quadruplicate and mixed with 10 TCID50 of SIVmac239. In each culture, 5 μl of virus was incubated with 5 μl of plasma for 45 min and was added to 5 × 104 MT4 cells. Reverse transcriptase activities in the culture supernatants on day 12 were measured to determine the 100% neutralizing endpoint. The lower limit of detection is a titer of 1: 2.

Back to Top | Article Outline
Statistical analysis

Statistical analysis was performed using Prism software version 4.03 (GraphPad Software Inc., San Diego, California, USA) with significance levels set at a P value of less than 0.05. Specific CD8+ T-cell frequencies and in-vitro anti-SIV efficacy levels (fold of reduction in viral production) were log transformed and correlation was analyzed by the Pearson test.

Back to Top | Article Outline

Results

Anti-SIVmac239 and anti-SIV-G64723mt efficacy in vitro of CD8+ cells in simian immunodeficiency virus controllers

We analyzed eight 90-120-Ia-positive rhesus macaques that showed vaccine-based control of a SIVmac239 challenge (Fig. 1a). These SIV controllers were divided into group I consisting of five animals (R06-015, R03-014, R03-012, R02-002, and R02-003) vaccinated with DNA/SeV-Gag [15] and group II consisting of one animal (R04-015) vaccinated with DNA/SeV-Gag202-216-EGFP and DNA/SeV-Gag236-250-EGFP and two (R04-016 and R06-007) vaccinated with DNA/SeV-Gag236-250-EGFP [25]. After an intravenous challenge with SIVmac239, all of these macaques showed viremia in the acute phase, but then controlled viral replication; plasma viremia was undetectable after the setpoint (Fig. 1b).

First, we investigated the potential of macaque CD8+ cells obtained at several time points, after boost but before SIVmac239 challenge (referred to as postboost) and after challenge, to suppress SIVmac239 (Fig. 2) or SIV-G64723mt (Fig. 3) replication by in-vitro viral suppression assay [27,38–40]. In this assay, PBMC-derived CD8 target cells infected with SIVmac239 or SIV-G64723mt were cocultured with effector CD8+ cells from PBMCs obtained at several time points at an E/T ratio of 1: 4, and viral production in culture supernatants was examined to assess suppressive effect of CD8+ cells on viral replication in vitro.

Fig. 2
Fig. 2
Image Tools
Fig. 3
Fig. 3
Image Tools

CD8+ cells 1 week after boost mostly suppressed wild-type SIVmac239 replication efficiently. In contrast, these postboost CD8+ cells failed to show efficient suppressive effect on SIV-G64723mt replication. These results suggest that Gag206-216-specific, Gag241-249-specific, and Gag367-381-specific CTL responses play a central role in the suppression of SIVmac239 replication by postboost CD8+ cells.

After SIVmac239 challenge, all these animals showed efficient in-vitro anti-SIV-G64723mt efficacy (more than two-fold reduction in viral production) of CD8+ cells, sooner or later, in the chronic phase. The levels of in-vitro anti-SIV-G64723mt efficacy of CD8+ cells tended to become higher in the chronic phase. Anti-SIVmac239 efficacy of CD8+ cells was not associated with anti-SIV-G64723mt efficacy. For instance, some CD8+ cells efficiently suppressed SIV-G64723mt but not SIVmac239 replication. After all, all SIV controllers acquired CD8+ cells able to suppress the mutant SIV-G64723mt replication in vitro in the chronic phase.

Back to Top | Article Outline
Control of a mutant simian immunodeficiency virus superchallenge

These animals were superchallenged with a mutant SIV, SIV-G64723mt, that has five gag mutations resulting in escape from recognition by Gag206-216-specific, Gag241-249-specific, and Gag367-381-specific CTLs around 1 year (R06-015, R03-014, and R03-012), 2 years (R04-015, R04-016, and R06-007), 3 years (R02-002), or 4 years (R02-003) after SIVmac239 challenge. The replicative ability of SIV-G64723mt is significantly lower than that of wild-type SIVmac239, but SIV-G64723mt challenge of naive 90-120-Ia-negative rhesus macaques can result in persistent viral replication and AIDS progression [23,28]. It has previously been shown that 90-120-Ia-positive macaques vaccinated with DNA-prime/SeV-Gag-boost are unable to contain a SIV-G64723mt challenge, whereas they can control replication of wild-type SIVmac239 [24]. Indeed, we confirmed that CD8+ cells obtained from these 90-120-Ia-positive vaccinees before challenge efficiently suppressed wild-type SIVmac239 but not SIV-G64723mt replication in vitro. In the present study, however, all eight wild-type SIV controllers contained the SIV-G64723mt superchallenge without detectable viremia (Fig. 1b). SIVmac239-specific neutralizing antibody responses were undetectable around the superchallenge in any of these controllers (Fig. 1a). These results indicate that, after SIVmac239 challenge, the SIV controllers acquired the potential to control SIV-G64723mt replication in the absence of neutralizing antibody responses, although to what extent CD8+ cell responses may contribute to this containment of SIV-G64723mt superchallenge remains unclear. Postsuperchallenge CD8+ cells suppressed both SIVmac239 and SIV-G64723mt replication in vitro efficiently (Figs. 2 and 3).

Back to Top | Article Outline
Simian immunodeficiency virus Gag-specific cytotoxic T lymphocyte responses in simian immunodeficiency virus controllers

Then, in these SIV controllers, we examined Gag206-216-specific, Gag241-249-specific, and Gag367-381-specific CTL responses, which have previously been indicated responsible for control of SIVmac239 replication in 90-120-Ia-positive vaccinees [24] (Fig. 4a). In DNA/SeV-Gag vaccinated animals (R06-015, R03-014, R03-012, and R02-002), SIV-specific CTL responses were undetectable before SeV-Gag boost (data not shown), but Gag206-216-specific, Gag241-249-specific, and Gag367-381-specific responses were efficiently induced 1 week after the boost. After SIVmac239 challenge, these animals showed efficient responses of these CTLs in the acute phase. These CTL levels were reduced in the chronic phase, but Gag241-249-specific CTL responses were detectable even 1 year after challenge. In macaque R04-015 vaccinated with DNA/SeV-Gag202-216-EGFP and DNA/SeV-Gag236-250-EGFP, Gag206-216-specific CTL responses were induced dominantly 1 week after boost and 2 weeks after SIVmac239 challenge, whereas Gag241-249-specific CTL responses were detected predominantly in the chronic phase. In macaques R04-016 and R06-007 vaccinated with DNA/SeV-Gag236-250-EGFP, Gag241-249-specific CTL responses were induced dominantly 1 week after boost and 2 weeks after SIVmac239 challenge and were maintained in the chronic phase. No significant enhancement of these CTL responses was observed after SIV-G64723mt superchallenge.

Fig. 4
Fig. 4
Image Tools

We also examined Gag-specific CTL responses in SIV controllers at several time points by using a panel of overlapping peptides (Gag peptide pools 1–10) spanning the entire SIVmac239 Gag (Fig. 4b). Group I macaques vaccinated with DNA/SeV-Gag elicited CTL responses directed against not only Gag peptide pool 5 (including Gag206-216 and Gag241-249) and 7 (including Gag367-381) but also other Gag peptide pools after boost and after challenge; some peptide pool-specific CTLs were diminished, whereas others appeared in the chronic phase. In contrast, group II macaques eliciting CTL responses directed against single Gag206-216 (R04-015) or Gag241-249 (R04-016 and R06-007) epitope after boost showed predominant Gag peptide pool 5-specific CTL responses after challenge and accumulated multiple Gag epitope-specific CTL responses in the chronic phase. These results indicate dynamics of postchallenge Gag-specific CTL responses in vaccine-based SIV controllers. After SIV-G64723mt superchallenge, changes in the pattern of Gag-specific CTL responses were observed in some animals.

Back to Top | Article Outline
Simian immunodeficiency virus non-Gag antigen-specific cytotoxic T lymphocyte responses in simian immunodeficiency virus controllers

Next, in SIV controllers, we examined CTL responses directed against SIV non-Gag antigens by using panels of overlapping peptides spanning the entire SIVmac239 antigens other than Gag (Fig. 5a). These SIV controllers showed SIV non-Gag-specific CTL responses from the early phase after challenge. After SIV-G64723mt superchallenge, broadening or changes in the pattern of these CTL responses were observed in some animals; Vif-specific or Nef-specific CTL responses were detected predominantly, although we did not find common CTL epitopes in Vif or Nef.

Fig. 5
Fig. 5
Image Tools
Back to Top | Article Outline
Correlation of antigen-specific cytotoxic T lymphocyte levels with in-vitro antivirus efficacy levels

Finally, we analyzed correlation of antigen-specific CTL levels with in-vitro anti-SIVmac239 or anti-SIV-G64723mt efficacy levels of CD8+ cells (Fig. 5b). We found a correlation of anti-SIVmac239 efficacy levels with Gag206-216-specific and Gag241-249-specific CTL levels but not with total Gag-specific CTL levels. The anti-SIVmac239 efficacy levels did not correlate with either Gag206-216-specific or Gag241-249-specific CTL levels alone (data not shown), although our previous study [25] indicated inverse correlation between peak plasma viral loads and the levels of Gag241-249-specific CTLs dominantly induced in DNA/SeV-Gag236-250-EGFP-vaccinated animals in the acute phase after challenge. Correlations of anti-SIVmac239 efficacy levels after challenge with Vif-specific CTL levels and with Nef-specific CTL levels were indicated. On the contrary, anti-SIV-G64723mt efficacy levels after challenge strongly correlated with Vif-specific CTL levels, although any correlation of these levels with other SIV antigen-specific CTL levels was not indicated. These results suggest that Vif-specific CTL induction may contribute in part to acquisition of the potential to suppress SIV-G64723mt replication efficiently.

Back to Top | Article Outline

Discussion

We have previously shown that 90-120-Ia-positive macaques eliciting Gag-specific CTL responses by vaccination can control SIVmac239 replication but are unable to contain a challenge with a mutant SIV, SIV-G64723mt, carrying multiple gag mutations that result in escape from recognition by Gag206-216-specific and Gag241-249-specific CTLs [24]. The present study revealed, by in-vitro viral suppression assay, that those 90-120-Ia-positive vaccinees can acquire, after wild-type SIVmac239 challenge, CD8+ cells able to suppress the mutant SIV replication. Induction of these CD8+ cell responses may have some supportive effect on the maintenance of viral control after the initial viral containment [4,26,27]. Such dynamics of anti-SIV responses have not been shown clearly even in live attenuated SIV infection [41–44]. Recently, HIVs have been suggested to accumulate mutations escaping from dominant CTL responses [45–51], but our results imply a possibility of induction of cellular immune responses effective against even those HIV variants escaping from dominant CTL responses.

The group I animals induced multiple Gag epitope-specific CTL responses after boost (before challenge) and after challenge, whereas the group II animals elicited only Gag206-216-specific or Gag241-249-specific CTL responses before challenge and showed induction of additional CTL responses directed against Gag epitopes other than Gag206-216 and Gag241-249 after challenge. Furthermore, both groups elicited SIV non-Gag-specific CTL responses after challenge. These results indicate postchallenge accumulation of broader CTL responses. The in-vitro anti-SIVmac239 efficacy levels correlated with Vif-specific and Nef-specific CTL as well as Gag206-216-specific and Gag241-249-specific CTL levels but not with total Gag-specific or total SIV-specific CTL levels, suggesting that not all but some particular epitope-specific CTL responses were involved in suppression of SIVmac239 replication. Nef-specific CTL responses were detected more frequently than Vif-specific ones, whereas the latter showed stronger correlation with antiviral efficacy levels (Fig. 5). We did not find common CTL epitopes in Vif or Nef. These may imply higher frequencies of effective CTLs in Vif-specific ones; conversely, Nef-specific CTLs may include effective ones but with higher frequencies of ineffective ones.

Postboost CD8+ cells able to suppress SIVmac239 replication failed to show suppressive effect on SIV-G64723mt replication. We confirmed it also in two 90-120-Ia-positive vaccinated animals that had failed to control the mutant SIV challenge in our previous studies [24] (data not shown). However, CD8+ cells in the chronic phase suppressed SIV-G64723mt replication efficiently. This indicates postchallenge induction of CD8+ cells with the potential to suppress SIV-G64723mt replication in vaccine-based SIVmac239 controllers, although it remains unclear whether these CD8+ cells with antimutant SIV efficacy are responsible for the control of mutant SIV superchallenge in vivo. The in-vitro anti-SIV-G64723mt efficacy levels correlated with Vif-specific CTL levels and CD8+ cells with detectable Vif-specific CTL responses showed suppressive effect on SIV-G64723mt replication. These results implicate Vif-specific CTL responses in the suppression of SIV-G64723mt replication in vitro by CD8+ cells in the chronic phase, although other factors may also be involved in this suppression. Preservation of memory CD4+ T cells by vaccine-based SIV control [26] may contribute to induction of these effective CTL responses.

We found dynamics of cellular immune responses during viral control in vaccine-based SIV controllers, but the exact mechanism for broadening or changes in dominance patterns of CTL responses remains unclear. All the group I animals and macaque R04-015 showed rapid selection of a CTL escape gag mutation, L216S, at week 5 after challenge, whereas no gag mutations were selected at week 5 in macaques R04-016 or R06-007 (data not shown). We failed to recover viral genome cDNAs for sequencing from plasma after week 5 due to undetectable viral loads, but selection of viral CTL escape mutations and reversions [23,28,52–57] under undetectable levels of viral replication may contribute to induction of broader CTL responses in SIV controllers.

It is difficult to directly compare anti-SIVmac239 and anti-SIV-G64723mt efficacy of CD8+ cells because of difference in their replicative ability, but the ratios of the latter level to the former 1 year after challenge were higher than those after boost in all animals. Indeed, CD8+ cells 1 year after challenge in macaques R03-012 and R02-003 showed suppressive effect on SIV-G64723mt but not on wild-type SIVmac239 replication, although R03-012 CD8+ cells at 5 months and 1 year after challenge efficiently suppressed SIVmac239 replication at higher E/T ratio of 1: 1 (R02-003 CD8+ cells in the chronic phase for this analysis were unavailable). Because no SIV controllers elicited CTL responses specific for peptides with mutated amino acid sequences (data not shown), all CTLs specific for SIV-G64723mt antigens in SIV controllers are expected to recognize SIVmac239 antigens also. Thus, our observation that some postchallenge CD8+ cells showed efficient suppressive effect on SIV-G64723mt but not on SIVmac239 replication in vitro may be explained by higher replicative ability of SIVmac239 compared with SIV-G64723mt; it could be more difficult for CD8+ cells to suppress replication of the wild-type SIVmac239 than the mutant SIV-G64723mt, implying a possible requirement of more potent CTL responses for SIVmac239 control than for SIV-G64723mt control.

In summary, this study showed dynamics of postchallenge cellular immune responses in vaccine-based SIV controllers. Our results suggest that, during persistent viral control, vaccine-based SIV controllers can acquire CD8+ cells with the potential to suppress replication of SIV variants carrying CTL escape mutations. Elucidation of the mechanism for induction of broader responses in these controllers may contribute to development of a vaccine effective against highly diversified HIV infection.

Back to Top | Article Outline

Acknowledgements

This work was supported by grants-in-aid from the Ministry of Education, Culture, Sports, Science, and Technology, a grant-in-aid from the Japan Society for the Promotion of Science, grants-in-aid from the Ministry of Health, Labor, and Welfare, and a grant from Takeda Science Foundation in Japan. N.I. is a Research Fellow of the Japan Society for the Promotion of Science. The animal experiments were conducted through the Cooperative Research Program in the Tsukuba Primate Research Center (TPRC), National Institute of Biomedical Innovation, with the help of the Corporation for Production and Research of Laboratory Primates (CPRLP). We thank Dr H. Akari, A. Saito, Y. Yasutomi, A. Hiyaoka, K. Komatsuzaki, K. Oto, and F. Ono for their assistance in animal experiments, T. Naruse and A. Kimura for MHC-I haplotyping, and DNAVEC Corporation for providing SeV vectors.

Author contributions: N.I., T.T., M.K., and T.M. designed the study. T.M. ordered animal maintenance and experimental support to TPRC and CPRLP. N.I., T.T., and M.K. contributed to vaccination and challenge experiments. A.T. contributed to blood processing and measurement of plasma viral loads. N.I., T.T., and H.T. contributed to analyses of anti-SIV efficacy of CD8+ cells. N.I., T.T., M.K., and H.Y. analyzed SIV-specific immune responses. N.I. and T.M. analyzed the data and wrote the article.

Back to Top | Article Outline

References

1. Koup RA, Safrit JT, Cao Y, Andrews CA, McLeod G, Borkowsky W, et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. J Virol 1994; 68:4650–4655.

2. Borrow P, Lewicki H, Hahn BH, Shaw GM, Oldstone MB. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. J Virol 1994; 68:6103–6110.

3. Matano T, Shibata R, Siemon C, Connors M, Lane HC, Martin MA. Administration of an anti-CD8 monoclonal antibody interferes with the clearance of chimeric simian/human immunodeficiency virus during primary infections of rhesus macaques. J Virol 1998; 72:164–169.

4. Jin X, Bauer DE, Tuttleton SE, Lewin S, Gettie A, Blanchard J, et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. J Exp Med 1999; 189:991–998.

5. Schmitz JE, Kuroda MJ, Santra S, Sasseville VG, Simon MA, Lifton MA, et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science 1999; 283:857–860.

6. Goulder PJ, Watkins DI. HIV and SIV CTL escape: implications for vaccine design. Nat Rev Immunol 2004; 4:630–640.

7. Tang J, Tang S, Lobashevsky E, Myracle AD, Fideli U, Aldrovandi G, et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. J Virol 2002; 76:8276–8284.

8. Goulder PJ, Watkins DI. Impact of MHC class I diversity on immune control of immunodeficiency virus replication. Nat Rev Immunol 2008; 8:619–630.

9. Kaslow RA, Carrington M, Apple R, Park L, Munoz A, Saah AJ, et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nat Med 1996; 2:405–411.

10. Migueles SA, Sabbaghian MS, Shupert WL, Bettinotti MP, Marincola FM, Martino L, et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proc Natl Acad Sci U S A 2000; 97:2709–2714.

11. Altfeld M, Addo MM, Rosenberg ES, Hecht FM, Lee PK, Vogel M, et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS 2003; 17:2581–2591.

12. Mothe BR, Weinfurter J, Wang C, Rehrauer W, Wilson N, Allen TM, et al. Expression of the major histocompatibility complex class I molecule Mamu-A*01 is associated with control of simian immunodeficiency virus SIVmac239 replication. J Virol 2003; 77:2736–2740.

13. Yant LJ, Friedrich TC, Johnson RC, May GE, Maness NJ, Enz AM, et al. The high-frequency major histocompatibility complex class I allele Mamu-B*17 is associated with control of simian immunodeficiency virus SIVmac239 replication. J Virol 2006; 80:5074–5077.

14. Loffredo JT, Bean AT, Beal DR, Leon EJ, May GE, Piaskowski SM, et al. Patterns of CD8+ immunodominance may influence the ability of Mamu-B*08-positive macaques to naturally control simian immunodeficiency virus SIVmac239 replication. J Virol 2008; 82:1723–1738.

15. Matano T, Kobayashi M, Igarashi H, Takeda A, Nakamura H, Kano M, et al. Cytotoxic T lymphocyte-based control of simian immunodeficiency virus replication in a preclinical AIDS vaccine trial. J Exp Med 2004; 199:1709–1718.

16. Letvin NL, Mascola JR, Sun Y, Gorgone DA, Buzby AP, Xu L, et al. Preserved CD4+ central memory T cells and survival in vaccinated SIV-challenged monkeys. Science 2006; 312:1530–1533.

17. Mattapallil JJ, Douek DC, Buckler-White A, Montefiori D, Letvin NL, Nabel GJ, Roederer M. Vaccination preserves CD4 memory T cells during acute simian immunodeficiency virus challenge. J Exp Med 2006; 203:1533–1541.

18. Wilson NA, Reed J, Napoe GS, Piaskowski S, Szymanski A, Furlott J, et al. Vaccine-induced cellular immune responses reduce plasma viral concentrations after repeated low-dose challenge with pathogenic simian immunodeficiency virus SIVmac239. J Virol 2006; 80:5875–5885.

19. Hansen SG, Vieville C, Whizin N, Coyne-Johnson L, Siess DC, Drummond DD, et al. Effector memory T cell responses are associated with protection of rhesus monkeys from mucosal simian immunodeficiency virus challenge. Nat Med 2009; 15:293–299.

20. Liu J, O'Brien KL, Lynch DM, Simmons NL, La Porte A, Riggs AM, et al. Immune control of an SIV challenge by a T-cell-based vaccine in rhesus monkeys. Nature 2009; 457:87–91.

21. Kano M, Matano T, Kato A, Nakamura H, Takeda A, Suzaki Y, et al. Primary replication of a recombinant Sendai virus vector in macaques. J Gen Virol 2002; 83:1377–1386.

22. Matano T, Kano M, Nakamura H, Takeda A, Nagai Y. Rapid appearance of secondary immune responses and protection from acute CD4 depletion after a highly pathogenic immunodeficiency virus challenge in macaques vaccinated with a DNA prime/Sendai virus vector boost regimen. J Virol 2001; 75:11891–11896.

23. Kawada M, Igarashi H, Takeda A, Tsukamoto T, Yamamoto H, Dohki S, et al. Involvement of multiple epitope-specific cytotoxic T-lymphocyte responses in vaccine-based control of simian immunodeficiency virus replication in rhesus macaques. J Virol 2006; 80:1949–1958.

24. Kawada M, Tsukamoto T, Yamamoto H, Iwamoto N, Kurihara K, Takeda A, et al. Gag-specific cytotoxic T-lymphocyte-based control of primary simian immunodeficiency virus replication in a vaccine trial. J Virol 2008; 82:10199–10206.

25. Tsukamoto T, Takeda A, Yamamoto T, Yamamoto H, Kawada M, Matano T. Impact of cytotoxic-T-lymphocyte memory induction without virus-specific CD4+ T-Cell help on control of a simian immunodeficiency virus challenge in rhesus macaques. J Virol 2009; 83:9339–9346.

26. Kawada M, Tsukamoto T, Yamamoto H, Takeda A, Igarashi H, Watkins DI, Matano T. Long-term control of simian immunodeficiency virus replication with central memory CD4+ T-cell preservation after nonsterile protection by a cytotoxic T-lymphocyte-based vaccine. J Virol 2007; 81:5202–5211.

27. Tsukamoto T, Yuasa M, Yamamoto H, Kawada M, Takeda A, Igarashi H, Matano T. Induction of CD8+ cells able to suppress CCR5-tropic simian immunodeficiency virus SIVmac239 replication by controlled infection of CXCR4-tropic simian-human immunodeficiency virus in vaccinated rhesus macaques. J Virol 2007; 81:11640–11649.

28. Seki S, Kawada M, Takeda A, Igarashi H, Sata T, Matano T. Transmission of simian immunodeficiency virus carrying multiple cytotoxic T-lymphocyte escape mutations with diminished replicative ability can result in AIDS progression in rhesus macaques. J Virol 2008; 82:5093–5098.

29. Yamamoto H, Kawada M, Takeda A, Igarashi H, Matano T. Postinfection immunodeficiency virus control by neutralizing antibodies. PLoS One 2007; 2:e540.

30. Shibata R, Maldarelli F, Siemon C, Matano T, Parta M, Miller G, et al. Infection and pathogenicity of chimeric simian-human immunodeficiency viruses in macaques: determinants of high virus loads and CD4 cell killing. J Infect Dis 1997; 176:362–373.

31. Li HO, Zhu YF, Asakawa M, Kuma H, Hirata T, Ueda Y, et al. A cytoplasmic RNA vector derived from nontransmissible Sendai virus with efficient gene transfer and expression. J Virol 2000; 74:6564–6569.

32. Takeda A, Igarashi H, Nakamura H, Kano M, Iida A, Hirata T, et al. Protective efficacy of an AIDS vaccine, a single DNA priming followed by a single booster with a recombinant replication-defective Sendai virus vector, in a macaque AIDS model. J Virol 2003; 77:9710–9715.

33. Moriya C, Igarashi H, Takeda A, Tsukamoto T, Kawada M, Yamamoto H, et al. Abrogation of AIDS vaccine-induced cytotoxic T lymphocyte efficacy in vivo due to a change in viral epitope flanking sequences. Microbes Infect 2008; 10:285–292.

34. Kestler HW 3rd, Ringler DJ, Mori K, Panicali DL, Sehgal PK, Daniel MD, Desrosiers RC. Importance of the nef gene for maintenance of high virus loads and for development of AIDS. Cell 1991; 65:651–662.

35. Yamamoto T, Iwamoto N, Yamamoto H, Tsukamoto T, Kuwano T, Takeda A, et al. Polyfunctional CD4+ T-cell induction in neutralizing antibody-triggered control of simian immunodeficiency virus infection. J Virol 2009; 83:5514–5524.

36. Akari H, Mori K, Terao K, Otani I, Fukasawa M, Mukai R, Yoshikawa Y. In vitro immortalization of Old World monkey T lymphocytes with Herpesvirus saimiri: its susceptibility to infection with simian immunodeficiency viruses. Virology 1996; 218:382–388.

37. Miyagi E, Opi S, Takeuchi H, Khan M, Goila-Gaur R, Kao S, Strebel K. Enzymatically active APOBEC3G is required for efficient inhibition of human immunodeficiency virus type 1. J Virol 2007; 81:13346–13353.

38. Yang OO, Kalams SA, Trocha A, Cao H, Luster A, Johnson RP, Walker BD. Suppression of human immunodeficiency virus type 1 replication by CD8+ cells: evidence for HLA class I-restricted triggering of cytolytic and noncytolytic mechanisms. J Virol 1997; 71:3120–3128.

39. Gauduin MC, Glickman RL, Means R, Johnson RP. Inhibition of simian immunodeficiency virus (SIV) replication by CD8(+) T lymphocytes from macaques immunized with live attenuated SIV. J Virol 1998; 72:6315–6324.

40. Loffredo JT, Rakasz EG, Giraldo JP, Spencer SP, Grafton KK, Martin SR, et al. Tat(28-35)SL8-specific CD8+ T lymphocytes are more effective than Gag(181-189)CM9-specific CD8+ T lymphocytes at suppressing simian immunodeficiency virus replication in a functional in vitro assay. J Virol 2005; 79:14986–14991.

41. Johnson RP, Desrosiers RC. Protective immunity induced by live attenuated simian immunodeficiency virus. Curr Opin Immunol 1998; 10:436–443.

42. Johnson RP, Lifson JD, Czajak SC, Cole KS, Manson KH, Glickman R, et al. Highly attenuated vaccine strains of simian immunodeficiency virus protect against vaginal challenge: inverse relationship of degree of protection with level of attenuation. J Virol 1999; 73:4952–4961.

43. Koff WC, Johnson PR, Watkins DI, Burton DR, Lifson JD, Hasenkrug KJ, et al. HIV vaccine design: insights from live attenuated SIV vaccines. Nat Immunol 2006; 7:19–23.

44. Reynolds MR, Weiler AM, Weisgrau KL, Piaskowski SM, Furlott JR, Weinfurter JT, et al. Macaques vaccinated with live-attenuated SIV control replication of heterologous virus. J Exp Med 2008; 205:2537–2550.

45. Phillips RE, Rowland-Jones S, Nixon DF, Gotch FM, Edwards JP, Ogunlesi AO, et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature 1991; 354:453–459.

46. Borrow P, Lewicki H, Wei X, Horwitz MS, Peffer N, Meyers H, et al. Antiviral pressure exerted by HIV-1-specific cytotoxic T lymphocytes (CTLs) during primary infection demonstrated by rapid selection of CTL escape virus. Nat Med 1997; 3:205–211.

47. Goulder PJ, Phillips RE, Colbert RA, McAdam S, Ogg G, Nowak MA, et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nat Med 1997; 3:212–217.

48. Price DA, Goulder PJ, Klenerman P, Sewell AK, Easterbrook PJ, Troop M, et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proc Natl Acad Sci U S A 1997; 94:1890–1895.

49. Brander C, Walker BD. Gradual adaptation of HIV to human host populations: good or bad news? Nat Med 2003; 9:1359–1362.

50. Gras L, Jurriaans S, Bakker M, van Sighem A, Bezemer D, Fraser C, et al. Viral load levels measured at set-point have risen over the last decade of the HIV epidemic in the Netherlands. PLoS One 2009; 4:e7365.

51. Kawashima Y, Pfafferott K, Frater J, Matthews P, Payne R, Addo M, et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature 2009; 458:641–645.

52. O'Connor DH, Allen TM, Vogel TU, Jing P, DeSouza IP, Dodds E, et al. Acute phase cytotoxic T lymphocyte escape is a hallmark of simian immunodeficiency virus infection. Nat Med 2002; 8:493–499.

53. Friedrich TC, Dodds EJ, Yant LJ, Vojnov L, Rudersdorf R, Cullen C, et al. Reversion of CTL escape-variant immunodeficiency viruses in vivo. Nat Med 2004; 10:275–281.

54. Leslie AJ, Pfafferott KJ, Chetty P, Draenert R, Addo MM, Feeney M, et al. HIV evolution: CTL escape mutation and reversion after transmission. Nat Med 2004; 10:282–289.

55. Barouch DH, Powers J, Truitt DM, Kishko MG, Arthur JC, Peyerl FW, et al. Dynamic immune responses maintain cytotoxic T lymphocyte epitope mutations in transmitted simian immunodeficiency virus variants. Nat Immunol 2005; 6:247–252.

56. Kobayashi M, Igarashi H, Takeda A, Kato M, Matano T. Reversion in vivo after inoculation of a molecular proviral DNA clone of simian immunodeficiency virus with a cytotoxic-T-lymphocyte escape mutation. J Virol 2005; 79:11529–11532.

57. Goepfert PA, Lumm W, Farmer P, Matthews P, Prendergast A, Carlson JM, et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. J Exp Med 2008; 205:1009–1017.

Cited By:

This article has been cited 4 time(s).

Immunological Reviews
A global approach to HIV-1 vaccine development
Stephenson, KE; Barouch, DH
Immunological Reviews, 254(): 295-304.
10.1111/imr.12073
CrossRef
Plos One
A Novel Protective MHC-I Haplotype Not Associated with Dominant Gag-Specific CD8(+) T-Cell Responses in SIVmac239 Infection of Burmese Rhesus Macaques
Takahashi, N; Nomura, T; Takahara, Y; Yamamoto, H; Shiino, T; Takeda, A; Inoue, M; Iida, A; Hara, H; Shu, T; Hasegawa, M; Sakawaki, H; Miura, T; Igarashi, T; Koyanagi, Y; Naruse, TK; Kimura, A; Matano, T
Plos One, 8(1): -.
ARTN e54300
CrossRef
Journal of Virology
Robust Immunity to an Auxotrophic Mycobacterium bovis BCG-VLP Prime-Boost HIV Vaccine Candidate in a Nonhuman Primate Model
Chege, GK; Burgers, WA; Stutz, H; Meyers, AE; Chapman, R; Kiravu, A; Bunjun, R; Shephard, EG; Jacobs, WR; Rybicki, EP; Williamson, AL
Journal of Virology, 87(9): 5151-5160.
10.1128/JVI.03178-12
CrossRef
AIDS
HIV vaccines: sin boldly!
Cohen, GB
AIDS, 24(18): 2877-2879.
10.1097/QAD.0b013e328340fefc
PDF (183) | CrossRef
Back to Top | Article Outline
Keywords:

AIDS vaccine; cytotoxic T lymphocyte; major histocompatibility complex; mutation; simian immunodeficiency virus

© 2010 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.