Skip Navigation LinksHome > September 10, 2010 - Volume 24 - Issue 14 > HIV-1 subtype B and C integrase enzymes exhibit differential...
AIDS:
doi: 10.1097/QAD.0b013e32833cf265
Basic Science

HIV-1 subtype B and C integrase enzymes exhibit differential patterns of resistance to integrase inhibitors in biochemical assays

Bar-Magen, Tamaraa; Donahue, Daniel Aa,c; McDonough, Emily Ia; Kuhl, Björn Da,b; Faltenbacher, Verena Ha,*; Xu, Hongtaoa; Michaud, Veroniquea; Sloan, Richard Da; Wainberg, Mark Aa,b,c

Free Access
Article Outline
Collapse Box

Author Information

aMcGill University AIDS Centre, Lady Davis Institute-Jewish General Hospital, Canada

bDivision of Experimental Medicine, Canada

cDepartment of Microbiology and Immunology, McGill University, Montreal, Quebec, Canada.

*Current Address: Ludwig-Maximilians-Universität, Munich, Germany.

Received 16 February, 2010

Revised 1 June, 2010

Accepted 8 June, 2010

Correspondence to Mark A. Wainberg, PhD, McGill University AIDS Center, Lady Davis Institute for Medical Research, Sir Mortimer B. Davis Jewish General Hospital, 3755 Côte-Ste-Catherine Road, Montréal, QC H3T 1E2, Canada. Tel: +1 514 340 8307; fax: +1 514 340 7537; e-mail: mark.wainberg@mcgill.ca

Collapse Box

Abstract

Background: Because of high intersubtype HIV-1 genetic variability, it has been shown that subtype-specific patterns of resistance to antiretroviral drugs exist. We wished to ascertain whether this might be true for integrase inhibitors.

Methods: We compared the susceptibility of subtype B and C HIV-1 integrase enzymes, harboring the previously reported resistance mutations E92Q, N155H, and E92Q/N155H, to clinically relevant integrase inhibitors. This was performed biochemically using a microtiter plate system.

Results: Subtype C integrase enzymes bearing the resistance mutations E92Q/N155H were approximately 10-fold more susceptible to each of two integrase inhibitors, raltegravir and elvitegravir, than were subtype B recombinant integrase containing the same mutations.

Conclusion: Polymorphic differences within the subtype B and C integrase genes likely cause variations in the contribution of N155H alone or in combination with E92Q to drug resistance. It is possible that different viral subtypes may favor different mutational pathways, potentially leading to varying levels of drug resistance among different subtypes.

Back to Top | Article Outline

Background

HIV-1 integrase inhibitors have been approved for use in both first-line and later-stage therapy. Raltegravir (Ral) (Isentress, Merck) was the first integrase inhibitor to be approved by the US Food and Drug Administration (FDA) after clinical trials showed that this drug promoted a rapid and sustained antiretroviral effect [1]. Elvitegravir (Elv) (GS-9137, Gilead), another integrase inhibitor, is currently in phase III clinical trials [2].

Integrase is a 288-amino acid protein composed of three domains: an N-terminal zinc finger domain, a catalytic core domain (CCD), and a C-terminal DNA-binding domain. The N-terminal domain binds viral DNA sequences and promotes integrase multimerization. It is also necessary for 3′ processing and strand transfer, which are distinct enzymatic activities of integrase [3–5]. The CCD of integrase contains a D(64)D(116)E(152) (DDE) triad of amino acids that bind to Mg2+, an essential enzymatic cofactor. Ral and Elv strongly inhibit strand transfer through a mechanism believed to involve chelation of at least one divalent ion at the DDE motif [6–8]. The C-terminal domain of integrase interacts with reverse transcriptase [9] and binds DNA in a nonspecific manner [10]. Although crystallization of HIV-1 integrase domains has been reported, the full-length protein structure remains unsolved [11–14]. However, the crystal structure of full-length foamy virus integrase has recently been reported [15].

Treatment failure of patients treated with integrase inhibitors is associated with one of three main resistance pathways, whose primary resistance mutations include N155H, Q148K/R/H, or Y143R/C, respectively [16–18]. Cross-resistance between Ral and Elv has been reported in clinical trials as well as in cell culture and biochemical assays [19,20]. An accumulation of such primary mutations together with other secondary mutations is associated with reduced enzymatic activity [21–25].

Natural polymorphisms in HIV-1 integrase have been partially characterized and show the greatest degree of variation at the C-terminal domain, in close proximity to the active site [21,26–28]. The residues associated with catalytic activity (i.e. D64, D116 and E152) and primary resistance to both Ral and Elv (Y143, Q148 and N155) are highly conserved among subtypes. However, polymorphic variation has been observed at sites associated with secondary resistance mutations, including V72, L74, T125, and M154 [29].

Approximately 90% of HIV-1-infected individuals worldwide are infected with non-B subtypes [30], and subtype C is responsible for the majority of global infections, predominantly in sub-Saharan Africa and India [31]. Integrase inhibitors are active against both B and non-B subtypes in patients [16,32]. Although intersubtype variability in integrase at the amino acid level is relatively low (∼8–12%), subtype-specific amino acid differences are often found in proximity to known primary or secondary resistance sites [26]. In addition, natural polymorphisms in integrase have been reported at the C-terminal domain located close to the enzymatic active site [21,23,26,27,33]. It has been suggested that natural polymorphisms in non-B subtype integrases might alter inhibitor binding or activity [34]. An in silico comparison of subtype B and CRF02_A/G integrases predicted that polymorphisms between these two subtypes might affect the structure and substrate-binding characteristics of integrase enzymes [28].

N155H, a well described primary resistance mutation, and E92Q, a common secondary mutation in the N155H pathway, have been studied in vitro in subtype B, and the contribution of each of these mutations alone and in combination towards drug resistance has been well established clinically and in cell culture assays [23,24,35]. Recently, the integrase genes from several HIV-1 subtype B-infected patients failing treatment were cloned. Each of the Q148K/R/H mutations in these clones was shown to confer similar levels of resistance to Ral, whereas N155H was shown to confer a wide range of levels of resistance to Ral, suggesting a possible role for polymorphisms [35].

In contrast, we have shown that integrase inhibitors are equally effective in biochemical assays against wild-type integrase enzymes derived from subtype B and C molecular clones [36]. We have now evaluated the contribution to resistance of the N155H and E92Q mutations, individually and in combination, in integrase enzymes derived from subtypes B and C. The data show that the E92Q mutation did not result in significant differences in drug resistance between subtype B and C integrases; the N155H mutation did confer slightly higher levels of resistance with subtype B than subtype C integrase, and this difference was greater for Ral than for Elv; and the N155H/E92Q double mutant conferred approximately 10-fold higher levels of resistance to Ral and Elv with subtype B compared with subtype C integrase.

Back to Top | Article Outline

Materials and methods

Antiviral compounds

Ral and Elv were obtained from Merck Pharmaceuticals, Inc. and Gilead Biosciences, respectively.

Back to Top | Article Outline
Cloning and mutagenesis

Figure 1 depicts a representation of HIV integrase sequence variability between subtypes B and C. Subtype C integrase was PCR-amplified from the molecular clone pINDIE-C1 (NIH accession number AB023804) and subcloned into the bacterial expression vector pET15B, replacing the subtype B integrase ORF kindly obtained from Dr Robert Craigie [37].

Fig. 1
Fig. 1
Image Tools

The QuickChange II site-directed mutagenesis kit (Stratagene) was used to introduce the solubility mutations F185H and C280S into subtype C integrase. The primers used were INC-FF185H (5′-GCAGTATTCATTCACAATCATAAAAGAAAAGGGGGG-3′), INC-RF185H (5′-CCCCCCTTTTCTTTTATGATTGTGAATGAATACTGC-3′), INC-FC280S (5′-GCAGGTGCTGATTCTGTGGCAGGTAGACAG-3′) and INC-RC280S (5′-CTGTCTACCTGCCACAGAATCAGCACCTGC-3′). Similarly, N155H was introduced using primers INB-N155HFor (5′-ATAGAATCTATGCATAAAGAATTAAAG-3′) and INB-N155HRev (5′-CTTTAATTCTTTATGCATAGATTCTAT-3′) INC-N155HFor (5′-GTAGAATCTATGCATAAAGAATTAAAG-3′), INC-N155HRev (5′-CTTTAATTCTTTATGCATAGATTCTAC-3′). E92Q was introduced using a Gene Tailor Site Directed Mutagenesis System (Invitrogen) with the following primers: INB-E92QF (5′- AAGCAGAAGTAATTCCAGCACAGACAGGGCAA -3′) and INB-E92QR (5′-GCTGGAATTACTTCTGCTTCTATATATCCA-3′), INC-E92QF (5′-GCAGAGGTTATTCCAGCACAAACAGGACAAG-3′) and INC-E92QR (5′-TGCTGGAATAACCTCTGCTTCTATGTAGCC-3′).

Back to Top | Article Outline
Protein purification

Wild-type and mutant His-tagged integrase proteins were expressed in Escherichia coli BL21(DE3) and purified under nondenaturing conditions. Bacterial cultures were grown at 37oC. When cultures of BL21 achieved an optical density of 0.5 at 600 nm, protein expression was induced by the addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 1 mmol/l. The cultures were incubated for 3 h at 37°C, centrifuged (5000 r.p.m. for 12 min), and frozen at −80°C. The pellets were resuspended in lysis buffer (20 mmol/l Hepes pH 7.5, 100 mmol/l NaCl, 2 mmol/l β-ME, protease inhibitors) and lyzed by sonication. The lysates were centrifuged (12 500 r.p.m. for 30 min), the supernatants discarded, and the pellets resuspended in binding buffer (1 mol/l NaCl, 20 mmol/l imidazole, 20 mmol/l Hepes pH 7.5, 2 mmol/l β-ME, 100 μmol/l ZnCl2, protease inhibitors). Following centrifugation at 12 500 r.p.m. for 30 min, the supernatants were incubated with nickel-nitrioltriacetic acid (Ni-NTA) agarose beads (Qiagen) for 1 h at 4°C with mild agitation. Proteins were purified using polypropylene columns (Qiagen). His-tagged integrase protein was then eluted using a gradient of increasing imidazole concentration (0–2 mol/l) in elution buffer (1 mol/l NaCl, 20 mmol/l Hepes pH 7.5, 10% glycerol, 2 mmol/l β-ME, 100 μmol/l ZnCl2). The eluates were analyzed on 10% SDS-polyacrylamide gels with Coomassie staining (Sigma–Aldrich). Proteins were dialyzed overnight at 4°C against 1 mol/l NaCl, 200 mmol/l Hepes pH 7.5, 100 μmol/l ZnCl2, 10% glycerol and 2 mmol/l DTT in dialysis cassettes (10 000 MWCO, ThermoScientific). The samples were aliquoted and fast frozen at −80°C. Protein concentration was measured by Bradford assay using the Bradford Protein Assay kit (Bio-Rad Laboratories).

Back to Top | Article Outline
Microtiter plate strand transfer assay

A microtiter plate assay was used to evaluate MgCl2-mediated strand transfer as previously described [6,38]. Briefly, biotinylated oligonucleotides mimicking LTR donor DNA (5′-biotin-ACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT and 5′-ACTGCTAGAGATTTTCCACACTGACTAAAAG) were immobilized onto black-color Reacti-Bind Streptavidin-coated plates (ThermoFisher). 313 nmol/l recombinant enzyme was bound to donor DNA on the plates in the presence of 25 mmol/l MnCl2 and the plates were then washed to remove excess unbound enzyme. 3′-FITC-labeled dsDNA (5′-TGACCAAGGGCTAATTCACT-FITC-3′ and 5′-TCACTTAATCGGGAACCAGT-FITC-3′), used as a reaction target, was added to the wells in 25 mmol/l Hepes (pH 7.8), 25 mmol/l NaCl, 2.5 mmol/l MgCl2, and 50 μg/ml BSA [6,39] and the plate was incubated at 37°C for 1 h. Covalently linked target DNA was detected through use of an anti-FITC antibody conjugated to alkaline phosphatase (Roche) and a chemiluminescence substrate (CSPD Sapphire II, Applied Biosystems). Integrase inhibitors were added at increasing concentrations shortly before the addition of target DNA. Strand transfer was evaluated by chemiluminescence.

Back to Top | Article Outline
Statistical analysis

IC50 values were calculated on the basis of eight independent experiments performed with both wild-type and mutated integrase enzymes of each of subtypes B and C. The mutations studied were E92Q, N155H and E92Q+N155H, both within the same enzyme. Values of strand transfer in the absence of drug for each experiment were determined arbitrarily as 100% activity. IC50 values were calculated utilizing the sigmoidal dose response function GraphPad Prism 4.0 software. The extent of resistance for Ral and Elv was compared using an unpaired Student's t-test with Welch's correction by comparing for the presence of individual mutations in the B and C subtype enzymes. In addition, group analysis of all mutations and virus subtypes studied was performed using a one-way analysis of variance (ANOVA). Mean values of IC50 values calculated from eight independent experiments were expressed as mean ± standard error (SEM).

Back to Top | Article Outline

Results

Subtype B and subtype C integrase enzymes harboring mutations E92Q and N155H exhibit resistance to Ral and Elv

We have previously shown that wild-type subtype B and C integrase enzymes exhibit similar degrees of susceptibility to the integrase inhibitors Ral, Elv and MK-2048 [36]. Here, we compared the susceptibilities of subtype B and C enzymes harboring resistance mutations E92Q, N155H and E92Q/N155H to Ral and Elv. We analyzed the strand transfer activity of wild-type and mutated integrases from subtypes B and C using a microtiter plate in the presence of increasing concentrations of these compounds.

The E92Q and N155H mutations in subtype B integrase conferred resistance to both Ral and Elv (Table 1) (Fig. 2a, b, top); these results are consistent with previous studies [24,35]. Subtype C integrase harboring these same mutations also showed resistance to Ral and Elv (Fig. 2a, b, bottom). The IC50 values for these enzymes (Table 1) confirm that the E92Q and N155H mutations conferred resistance to both Ral and Elv in both subtypes B and C, with levels of resistance to both drugs being further increased with the double mutant (Table 1).

Table 1
Table 1
Image Tools
Fig. 2
Fig. 2
Image Tools
Back to Top | Article Outline
N155H confers higher-level resistance in subtype B than subtype C integrase, alone or in combination with the secondary mutation E92Q

Subtype B and C wild-type and E92Q enzymes showed a similar profile of resistance to Ral and Elv (Figs 2 and 3); a comparison of IC50 values shows that resistance to these two drugs was not significantly different (Table 1). However, introduction of N155H into subtype B and C enzymes, singly or in combination with E92Q, resulted in subtype-specific differences in levels of resistance. Subtype B integrase containing N155H was three-fold more resistant (P = 0.0148) to Ral than was subtype C integrase containing N155H. A similar pattern of resistance to Elv was observed but the difference was not statistically significant (P = 0.1049).

Fig. 3
Fig. 3
Image Tools

The differences between subtypes were intensified when the double mutants E92Q/N155H were analyzed. Subtype B integrase containing E92Q/N155H was more than 95-fold resistant to Ral compared with wild-type subtype B integrase, whereas the subtype C E92Q/N155H double mutant enzyme was only slightly more resistant than the single mutants (5.9-fold compared with wild-type) (Figs 2 and 4 and Table 1). A similar but less pronounced pattern of resistance to Elv was observed; the increased resistance conferred by the E92Q/N155H double mutant compared with wild-type was approximately 10-fold higher for subtype B than for the subtype C enzyme (Fig. 3 and Table 1).

Fig. 4
Fig. 4
Image Tools
Back to Top | Article Outline

Discussion

Three major pathways of resistance to Ral and Elv have been identified (Y143R/C, Q148H/K/R and N155H) [16,17,27]. The N155H pathway is thought to develop relatively early in patients and to confer a relatively high cost on replication capacity to the virus. It may often be supplanted by the Q148H/K/R pathway that imposes a lower fitness cost while simultaneously conferring a higher level of resistance to integrase inhibitors [35].

Although wild-type subtype B and subtype C integrases behaved similarly in regard to susceptibility to integrase inhibitors, we found important differences between mutated enzymes in regard to extent of resistance in comparisons of subtypes B and C. This suggests an important role of polymorphisms in the occurrence of drug resistance.

Although HIV subtypes B and C are the most important in terms of the worldwide epidemic, future work should also include enzymes derived from other viral subtypes and circulating recombinant forms in order to shed additional information on this topic. Resistance mutations such as N155H are thought to interfere with coordination of bound Mg2+, thereby affecting drug binding in the catalytic core [15]. This suggests that Ral and Elv are dependent on a highly specific structural organization for efficient binding and that modifications caused by polymorphisms or secondary resistance mutations might enhance or diminish the effect of primary resistance mutations. The integrase sequences of the molecular clones pNL4-3 (subtype B) and INDIE (subtype C) are similar but two regions containing polymorphic changes (Fig. 1) are the catalytic core and the C terminus. The subtype-specific differences in levels of resistance conferred by the N155 and E92 mutations, reported here, could be a result of such polymorphisms. More specifically, a polymorphic variation at position 151 (isoleucine in subtype B and valine in subtype C) is close to the N155 resistance site. I151 V has been suggested to act as a secondary mutation that increases resistance to integrase inhibitors in subtype B [19,40]. Even though wild-type subtype C integrase possesses the I151 V polymorphism, this did not result in subtype differences in susceptibility to integrase inhibitors. As a result of its proximity to N155, V151 might have an effect on integrase structure close to the catalytic core, minimizing the impact of the N155H mutation on subtype C resistance.

It should be emphasized that we cannot yet be certain that our findings will have clinical relevance. This will need to await further clinical experience with integrase inhibitors in parts of the world in which viral subtypes and recombinant forms other than subtype B are predominant. Our study was also limited to a consideration of subtypes B and C only due to the labor-intensive nature of the work involved, particularly that relating to enzyme purification. The fact that levels of resistance to Ral and Elv were lower with the subtype C than subtype B enzymes may mean that other mutations may be clinically observed over time as integrase inhibitors become more commonly used in the treatment of nonsubtype B infections. Our choice of subtype C was motivated by the fact that this subtype is now responsible for more than 50% of all new HIV infections worldwide [31]. In this context, it is important to note that both Ral and Elv specifically antagonize the strand transfer activity of the integrase enzyme. Previous work by our group has established that wild-type integrase enzymes and viruses of different subtypes show similar sensitivities to both these drugs. Thus, the current work suggests that significant subtype differences may only be revealed once the selection of drug-resistance mutations has taken place.

Work to extend the biochemical results obtained here on the basis of tissue culture observations performed on viruses of different subtypes containing appropriate drug-resistance mutations will soon be initiated. However, it is important to point out that many groups have already established excellent correlations between biochemical evaluations of resistance to integrase inhibitors and clinical/tissue culture observations [24,25,41].

Recently, the acquisition of different patterns of integrase resistance mutations was reported in different subtypes suggesting a role for subtype-related polymorphisms in the development of integrase drug resistance in patients [42].

It is important to perform further analysis of the contribution of polymorphisms toward drug resistance for all antiretroviral drugs. This is the first study of subtype-specific differences between integrase enzymes as analyzed biochemically. A high degree of intrasubtype variability in regard to levels of resistance conferred by the N155H mutation was reported in patients who failed Ral-containing regiments [35]. It is possible that other resistance mutations, such as Q148H/K, could also exhibit intersubtype variability.

Back to Top | Article Outline

Acknowledgements

The work was supported by grants from the Canadian Institutes of Health Research (CIHR) and Merck, Inc. D.A.D. is the recipient of a predoctoral fellowship from the Fonds de la Recherche en santé du Québec (FRSQ). R.D.S. is the recipient of a postdoctoral fellowship from the CIHR Canadian HIV Trials Network and the Canadian Foundation for AIDS Research (CANFAR). We thank Dr Robert Craigie for the pET15B IN subtype B expression vector, Dr Serge Simar of the Quebec Heart Institute for his assistance with biostatistical analysis, Dr Yudong Quan for helpful discussions, and Ms. Estrella Moyal and Ms. Bonnie Spira for assistance with digital artwork. We also thank Dr Daria Hazuda of Merck Inc. for helpful discussions and for providing drugs and Dr Lei Zhang of Merck-Frosst Canada for supplying drugs and for research support.

T.B. designed the overall study, expressed and purified the proteins, performed the biochemical assays, analyzed the data and wrote most of the manuscript. D.A.D. helped with data analysis, sequencing, and helped to write the manuscript. E.I.M. helped with mutagenesis, sequencing, expression of proteins and performed biochemical assays. B.D.K. and V.H.F. performed mutagenesis and sequencing. H.X. helped with protein purification, biochemical assays, and data analysis. V.M. helped with statistical analysis. R.D.S. designed parts of the study, helped with data analysis, and helped to write parts of the manuscript. M.A.W. provided supervision and oversaw all aspects of the work.

Back to Top | Article Outline

References

1. Grinsztejn B, Nguyen BY, Katlama C, Gatell JM, Lazzarin A, Vittecoq D, et al. Safety and efficacy of the HIV-1 integrase inhibitor raltegravir (MK-0518) in treatment-experienced patients with multidrug-resistant virus: a phase II randomised controlled trial. Lancet 2007; 369:1261–1269.

2. Shimura K, Kodama E, Sakagami Y, Matsuzaki Y, Watanabe W, Yamataka K, et al. Broad antiretroviral activity and resistance profile of the novel human immunodeficiency virus integrase inhibitor elvitegravir (JTK-303/GS-9137). J Virol 2008; 82:764–774.

3. Zheng R, Jenkins TM, Craigie R. Zinc folds the N-terminal domain of HIV-1 integrase, promotes multimerization, and enhances catalytic activity. Proc Natl Acad Sci U S A 1996; 93:13659–13664.

4. Engelman A, Bushman FD, Craigie R. Identification of discrete functional domains of HIV-1 integrase and their organization within an active multimeric complex. EMBO J 1993; 12:3269–3275.

5. Bushman FD, Engelman A, Palmer I, Wingfield P, Craigie R. Domains of the integrase protein of human immunodeficiency virus type 1 responsible for polynucleotidyl transfer and zinc binding. Proc Natl Acad Sci U S A 1993; 90:3428–3432.

6. Grobler JA, Stillmock K, Hu B, Witmer M, Felock P, Espeseth AS, et al. Diketo acid inhibitor mechanism and HIV-1 integrase: implications for metal binding in the active site of phosphotransferase enzymes. Proc Natl Acad Sci U S A 2002; 99:6661–6666.

7. Marchand C, Johnson AA, Karki RG, Pais GCG, Zhang X, Cowansage K, et al. Metal-dependent inhibition of HIV-1 integrase by {beta}-diketo acids and resistance of the soluble double-mutant (F185K/C280S). Mol Pharmacol 2003; 64:600–609.

8. Hazuda DJ, Felock P, Witmer M, Wolfe A, Stillmock K, Grobler JA, et al. Inhibitors of strand transfer that prevent integration and inhibit HIV-1 replication in cells. Science 2000; 287:646–650.

9. Hehl EA, Joshi P, Kalpana GV, Prasad VR. Interaction between human immunodeficiency virus type 1 reverse transcriptase and integrase proteins. J Virol 2004; 78:5056–5067.

10. Engelman A, Hickman AB, Craigie R. The core and carboxyl-terminal domains of the integrase protein of human immunodeficiency virus type 1 each contribute to nonspecific DNA binding. J Virol 1994; 68:5911–5917.

11. Dyda F, Hickman AB, Jenkins TM, Engelman A, Craigie R, Davies DR. Crystal structure of the catalytic domain of HIV-1 integrase: similarity to other polynucleotidyl transferases. Science 1994; 266:1981–1986.

12. Eijkelenboom AP, Sprangers R, Hard K, Puras Lutzke RA, Plasterk RH, Boelens R, Kaptein R. Refined solution structure of the C-terminal DNA-binding domain of human immunovirus-1 integrase. Proteins 1999; 36:556–564.

13. Chiu TK, Davies DR. Structure and function of HIV-1 integrase. Curr Top Med Chem 2004; 4:965–977.

14. Goldgur Y, Dyda F, Hickman AB, Jenkins TM, Craigie R, Davies DR. Three new structures of the core domain of HIV-1 integrase: an active site that binds magnesium. Proc Natl Acad Sci U S A 1998; 95:9150–9154.

15. Hare S, Gupta SS, Valkov E, Engelman A, Cherepanov P. Retroviral intasome assembly and inhibition of DNA strand transfer. Nature 2010; 464:232–236.

16. Cooper DA, Steigbigel RT, Gatell JM, Rockstroh JK, Katlama C, Yeni P, et al. Subgroup and resistance analyses of raltegravir for resistant HIV-1 infection. N Engl J Med 2008; 359:355–365.

17. Kobayashi M, Nakahara K, Seki T, Miki S, Kawauchi S, Suyama A, et al. Selection of diverse and clinically relevant integrase inhibitor-resistant human immunodeficiency virus type 1 mutants. Antiviral Res 2008; 80:213–222.

18. Nakahara K, Wakasa-Morimoto C, Kobayashi M, Miki S, Noshi T, Seki T, et al. Secondary mutations in viruses resistant to HIV-1 integrase inhibitors that restore viral infectivity and replication kinetics. Antiviral Res 2009; 81:141–146.

19. Serrao E, Odde S, Ramkumar K, Neamati N. Raltegravir, elvitegravir, and metoogravir: the birth of ‘me-too’ HIV-1 integrase inhibitors. Retrovirology 2009; 6:25.

20. Ferns RB, Kirk S, Bennett J, Williams I, Edwards S, Pillay D. The dynamics of appearance and disappearance of HIV-1 integrase mutations during and after withdrawal of raltegravir therapy. AIDS 2009; 23:2159–2164.

21. Lataillade M, Chiarella J, Kozal MJ. Natural polymorphism of the HIV-1 integrase gene and mutations associated with integrase inhibitor resistance. Antivir Ther 2007; 12:563–570.

22. Shafer RW, Schapiro JM. HIV-1 drug resistance mutations: an updated framework for the second decade of HAART. AIDS Rev 2008; 10:67–84.

23. Malet I, Delelis O, Valantin M-A, Montes B, Soulie C, Wirden M, et al. Mutations associated with failure of raltegravir treatment affect integrase sensitivity to the inhibitor in vitro. Antimicrob Agents Chemother 2008; 52:1351–1358.

24. Marinello J, Marchand C, Mott BT, Bain A, Thomas CJ, Pommier Y. Comparison of raltegravir and elvitegravir on HIV-1 integrase catalytic reactions and on a series of drug-resistant integrase mutants. Biochemistry 2008; 47:9345–9354.

25. Dicker IB, Terry B, Lin Z, Li Z, Bollini S, Samanta HK, et al. Biochemical analysis of HIV-1 integrase variants resistant to strand transfer inhibitors. J Biol Chem 2008; 283:23599–23609.

26. Myers RE, Pillay D. Analysis of natural sequence variation and covariation in human immunodeficiency virus type 1 integrase. J Virol 2008; 82:9228–9235.

27. Rhee SY, Liu TF, Kiuchi M, Zioni R, Gifford RJ, Holmes SP, Shafer RW. Natural variation of HIV-1 group M integrase: implications for a new class of antiretroviral inhibitors. Retrovirology 2008; 5:74.

28. Malet I, Soulie C, Tchertanov L, Derache A, Amellal B, Traore O, et al. Structural effects of amino acid variations between B and CRF02-AG HIV-1 integrases. J Med Virol 2008; 80:754–761.

29. Loizidou EZ, Kousiappa I, Zeinalipour-Yazdi CD, Van de Vijver DAMC, Kostrikis LG. Implications of HIV-1 M group polymorphisms on integrase inhibitor efficacy and resistance: genetic and structural in silico analyses. Biochemistry 2009; 48:4–6.

30. Jones GS, Yu F, Zeynalzadegan A, Hesselgesser J, Chen X, Chen J, et al. Preclinical evaluation of GS-9160, a novel inhibitor of human immunodeficiency virus type 1 integrase. Antimicrob Agents Chemother 2009; 53:1194–1203.

31. Hemelaar J, Gouws E, Ghys PD, Osmanov S. Global and regional distribution of HIV-1 genetic subtypes and recombinants in. AIDS 2006; 20:W13–W23.

32. Briz V, Garrido C, Poveda E, Morello J, Barreiro P, de Mendoza C, Soriano V. Raltegravir and etravirine are active against HIV type 1 group O. AIDS Res Hum Retroviruses 2009; 25:225–227.

33. Low A, Prada N, Topper M, Vaida F, Castor D, Mohri H, et al. Natural polymorphisms of human immunodeficiency virus type 1 integrase and inherent susceptibilities to a panel of integrase inhibitors. Antimicrob Agents Chemother 2009; 53:4275–4282.

34. Miller M, Danovich R, Witmer M, Nguyen B-Y, Teppler H, Zhao J, et al. and for the HIV-1 Integrase Inhibitor Devt Teams, Protocol 004 Team, and BENCHMRK-1 and -2 Teams. Emerging patterns of resistance to integrase inhibitors. In: 16th conference on retroviruses and opportunistic infections; Montreal, Canada; 2009.

35. Fransen S, Gupta S, Danovich R, Hazuda D, Miller M, Witmer M, et al. Loss of raltegravir susceptibility by human immunodeficiency virus type 1 is conferred via multiple nonoverlapping genetic pathways. J Virol 2009; 83:11440–11446.

36. Bar-Magen T, Sloan RD, Faltenbacher VH, Donahue DA, Kuhl BD, Oliveira M, et al. Comparative biochemical analysis of HIV-1 subtype B and C integrase enzymes. Retrovirology 2009; 6:103.

37. Jenkins TM, Engelman A, Ghirlando R, Craigie R. A soluble active mutant of HIV-1 integrase. J Biol Chem 1996; 271:7712–7718.

38. Hazuda DJ, Hastings JC, Wolfe AL, Emini EA. A novel assay for the DNA strand-transfer reaction of HIV-1 integrase. Nucl Acids Res 1994; 22:1121–1122.

39. Debyser Z, Cherepanov P, Pluymers W, De Clercq E. Assays for the evaluation of HIV-1 integrase inhibitors. Methods Mol Biol 2001; 160:139–155.

40. McColl DJ, Chen X. Strand transfer inhibitors of HIV-1 integrase: bringing in a new era of antiretroviral therapy. Antiviral Res 2009.

41. Delelis O, Thierry S, Subra F, Simon F, Malet I, Alloui C, et al. Impact of Y143 HIV-1 integrase mutations on resistance to raltegravir in vitro and in vivo. Antimicrob Agents Chemother 2010; 54:491–501.

42. Sichtig N, Sierra S, Kaiser R, Daumer M, Reuter S, Schulter E, et al. Evolution of raltegravir resistance during therapy. J Antimicrob Chemother 2009; 64:25–32.

43. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 1999; 41:95–98.

Cited By:

This article has been cited 1 time(s).

Current Opinion in Virology
Are subtype differences important in HIV drug resistance?
Lessells, RJ; Katzenstein, DK; de Oliveira, T
Current Opinion in Virology, 2(5): 636-643.
10.1016/j.coviro.2012.08.006
CrossRef
Back to Top | Article Outline
Keywords:

elvitegravir; integrase drug resistance; polymorphisms; raltegravir; subtype B; subtype C

© 2010 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.