Skip Navigation LinksHome > August 24, 2010 - Volume 24 - Issue 13 > Vaccine-induced IgG2 anti-HIV p24 is associated with control...
AIDS:
doi: 10.1097/QAD.0b013e32833c1ce0
Basic Science

Vaccine-induced IgG2 anti-HIV p24 is associated with control of HIV in patients with a ‘high-affinity’ FcγRIIa genotype

French, Martyn Aa,b; Tanaskovic, Saraa; Law, Matthew Gc; Lim, Andrewa; Fernandez, Soniaa; Ward, Larry Dd; Kelleher, Anthony Dc; Emery, Seanc

Free Access
Article Outline
Collapse Box

Author Information

aSchool of Pathology and Laboratory Medicine, University of Western Australia, Australia

bDepartment of Clinical Immunology, Royal Perth Hospital and PathWest laboratory Medicine, Perth, Australia

cNational Centre in HIV Epidemiology and Clinical Research, University of, New South Wales, Sydney, Australia

dVirax Development Pty Ltd, Melbourne, Australia.

Received 9 February, 2010

Revised 10 May, 2010

Accepted 14 May, 2010

Correspondence to Professor Martyn French, Department of Clinical Immunology, Royal Perth Hospital, GPO Box X2213, Perth, WA 6847, Australia. E-mail: martyn.french@uwa.edu.au

Collapse Box

Abstract

Objectives: We have previously shown that vaccination with a recombinant fowlpox virus carrying the genes for HIV Gag-Pol and interferon-gamma (IFN-γ) was associated with partial control of HIV replication after antiretroviral therapy (ART) was ceased but not with increased anti-HIV T-cell responses. Because IFN-γ enhances IgG2 production, and IgG2 antibodies to HIV antigens and the ‘high-affinity’ polymorphism of FcγRIIa (the major Fc receptor for IgG2) have been associated with a favourable outcome of HIV infection, we examined the association of IgG2 antibodies to HIV p24 and ‘high-affinity’ polymorphisms of FcγRIIa with control of HIV replication in these patients.

Methods: Plasma from weeks 0 (cessation of ART 1 week after the last vaccination), 9 and 20 was available from patients who had received the full construct vaccine, a partial construct (without IFN-γ) or placebo. IgG2 and IgG1 anti-p24 and anti-gp41 were assayed and all patients were genotyped for the FcγRIIa 131 R/H polymorphism that affects IgG2 binding.

Results: At week 0, IgG2 anti-p24 was present in five of nine full construct patients but none of 14 partial construct or placebo patients and was associated with a smaller increase in plasma HIV RNA over 20 weeks. Patients with IgG2 anti-p24 and the ‘high-affinity’ polymorphism of FcγRIIa exhibited lower HIV replication than other patients at week 20.

Conclusion: The role of IgG2 anti-HIV antibodies and FcγRIIa in the control of HIV replication should be investigated further. Inclusion of an IFN-γ gene in DNA vaccine constructs might be a means of enhancing IgG2 antibody production.

Back to Top | Article Outline

Introduction

In the light of recent ‘T-cell-based HIV vaccine’ failures, there is a widely held view that strategies for augmenting ‘protective’ immune responses against HIV antigens have to be rethought [1,2]. We have previously demonstrated that vaccination of HIV-infected patients receiving antiretroviral therapy (ART) with a recombinant fowlpox virus (rFPV) that carried the genes for HIV Gag-Pol and human interferon-γ (IFN-γ) was associated with partial suppression of HIV replication after the ART was ceased but that this was not associated with increased T-cell responses (IFN-γ ELISPOT, lymphoproliferation and Cr51 release assays) against vaccine-encoded antigens [3,4]. This finding suggested that inclusion of the IFN-γ gene in the rFPV vaccine had a beneficial effect but not by enhancing effector T-cell responses. In view of data from animal models suggesting that antibodies are important in the control of persistent virus infections [5], we have considered the possibility that the IFN-γ might have had an effect on antibody responses to the HIV antigens in the vaccine construct.

Several lines of evidence indicate that IFN-γ augments the production of IgG2 in humans. IFN-γ promotes the production of IgG2 by neonatal B cells [6] and the production of both Cγ2 transcripts and IgG2 by adult B cells [7,8]. Furthermore, IgG2 deficiency is associated with decreased production of IFN-γ [9,10]. Evidence from studies in humans with HIV infection and animals with other lentivirus infections suggests that IgG2 antibodies play a role in controlling viral replication. Thus, rates of HIV disease progression are slower in individuals who produce IgG2 antibodies against HIV antigens, particularly gp41 [11,12], and IgG2 antibodies to gp41 are very uncommon in patients with advanced HIV disease [13,14]. Lack of IgG2 antibodies in patients with HIV disease might reflect impaired B-cell immunoglobulin isotype switching induced by HIV Nef [15]. Similarly, IgG2 antibodies to envelope antigens of Caprine Arthritis Encephalitis Virus and Medi Visna Virus are associated with protection from disease caused by these lentiviruses in goats and sheep, respectively [16,17]. Unlike rodents, the IgG1 and IgG2 subclasses of goats and sheep have similar Fc-mediated antibody effector functions to primate IgG1 and IgG2 [18]. Finally, antibody-like ‘immunoadhesins’ produced after gene transfer by an adeno-associated virus vector that conferred complete protection from virulent simian immunodeficiency virus (SIV) challenge in monkeys possessed the Fc region of IgG2 [19].

IgG2 antibodies bind primarily to FcγRIIa (CD32a) in humans [20] and the binding affinity is affected by a polymorphism at amino acid position 131 of the receptor [21]. Homozygosity for arginine (131RR) confers lower affinity binding than homozygosity for histidine (131HH) or heterozygosity (131RH). The rate of CD4+ T-cell depletion in adults with HIV infection is faster in patients with the 131RR genotype and phagocytosis of immune complexes consisting of HIV gp120 and anti-gp120 is higher with monocytes from individuals who are 131HH [22]. We therefore hypothesized that suppression of HIV replication after vaccination of patients with the rFPV vaccine and cessation of ART would be associated with production of IgG2 antibodies to antigens in the vaccine construct (p24) and possession of the FcγRIIa 131HH or RH genotype.

Back to Top | Article Outline

Methods

Patients

Full details of the clinical trial are reported elsewhere [3,4]. Essentially, patients who commenced ART shortly after acquiring HIV infection resulting in control of the infection (plasma HIV RNA level <400 copies/ml) for at least 6 months were randomized to receive a course of four vaccinations with either the full construct of the rFPV vaccine that expressed HIV Gag-Pol and IFN-γ genes, a partial construct that expressed only the HIV Gag-Pol gene, or a placebo. ART was then ceased (week 0) a week after the fourth vaccination. Plasma samples collected at weeks 0, 9 and 20 were obtained for this study. Samples were available from nine patients in the full construct group, eight patients in the partial construct group and six patients in the placebo group.

Back to Top | Article Outline
Detection of HIV-specific IgG1 and IgG2 antibodies

HIV-1 nitrocellulose Western blot strips (National Serology Reference Laboratory, Victoria, Australia) were soaked in 1 ml Tris-buffered saline-Tween 20 (TBS-T) for 10 min at room temperature on a rocking platform (15 cycles/min, 15° tilt). Excess buffer was poured off and residual buffer removed by aspiration. The strips were then blocked with 3% skim milk/TBS for 1 h at room temperature (rocking at 45 cycles/min, 15° tilt), followed by three washes with TBS-T. Plasma samples were diluted 1: 10 in 1% skim milk/TBS and added to the strips to incubate for 1 h at room temperature (rocking at 15 cycles/min with 15° tilt). This was followed by three washes with TBS-T (one brief wash followed by two 10-min washes). Alkaline phosphatase-conjugated murine antibodies to human IgG1 or IgG2 (Invitrogen, Carlsbad, CA) were diluted 1: 1000 with 1% skim milk/TBS and added to the strips for 30 min at room temperature, followed by three washes with TBS-T (one brief wash followed by two 10-min washes). The substrate BCIP/NBT (Sigma, St Louis, MO) was added for 30 min at room temperature in the dark. Strips were washed with 70% ethanol, air-dried and stored in the dark in the presence of desiccant until analysed. High-resolution images of each strip were captured using a flat-bed scanner (HP Photosmart 2710). The intensity of bands corresponding to p24 and gp41 proteins was measured using the Quantity One program (Bio-Rad, Hercules, California, USA) and, after subtraction of background staining, the amount of antibody was reported as band intensity/mm2.

Back to Top | Article Outline
FcγRIIa genotyping

FcγRIIa genotyping was undertaken using a method adapted from the study by Brandt et al. [23]. Briefly, 100 ng genomic DNA was amplified in a 20 μl reaction mix containing 0.3 mmol/l dNTP, 2 mmol/l Mg2+, 5 ng/μl primers [5′ AATGGCTGGTGCTCCAGA 3′ (forward) and 5′ GCTTGTGGGATGGAGAAGGTGGGATCCACA 3′ (reverse)] and 1 U of Taq DNA polymerase (Invitrogen, Carlsbad, CA). PCR conditions were 94°C for 4 min, 30 cycles of 94°C for 30 s, 65°C for 30 s and 72°C for 30 s, followed by 72°C for 5 min. Amplicons were fragmented by restriction digest with 5U of Hsp92-II (Promega, Madison, WI) for 5 h at 37°C and then run on a 15% polyacrylamide gel for 1.5 h. The presence of an arginine at amino acid position 131 produced bands of 56 and 110 bp and presence of a histidine produced bands of 82, 56 and 28 bp.

Back to Top | Article Outline
Statistics

Nonparametric methods were used throughout. Comparisons between the randomized groups a priori were limited to a comparison of the full construct recipients with partial construct/control recipients combined. The overall distributions of the data for these two groups were compared using the log-rank test as this is a more powerful nonparametric test for alternative hypotheses that are not a simple uniform shift in location. Comparisons of multilevel groups were performed using the Kruskal–Wallis test for heterogeneity. Correlations between variables were assessed using Spearman's rank correlations coefficient. Statistical significance was taken at the P < 0.05 level, with no adjustment for multiple comparisons.

Back to Top | Article Outline

Results

Plasma levels of IgG2 antibodies to p24 were increased after vaccination with recombinant fowlpox virus encoding both HIV Gag-Pol and IFN-γ

Plasma levels of IgG2 and IgG1 antibodies to HIV-1 p24 and gp41 were assayed in patients who had received the full construct vaccine (n = 9), a partial construct vaccine (n = 8) or a placebo (n = 6). An a priori decision to combine data from the partial construct and control groups (n = 14) was made based on an assessment of previously published data [3,4]. Plasma levels of IgG2 antibodies to p24 were higher in the full construct vaccine group than the partial construct/control group (P = 0.028, Fig. 1a). It should be noted, however, that responses were bimodal and that antibodies were not detectable, or only just detectable, in four of the nine samples from the full construct group. In contrast, IgG2 antibodies to gp41 were very infrequent and did not differ between the two groups (Fig. 1b). At the same time point, plasma levels of IgG1 anti-p24 were also higher in the full construct group than the partial construct/control group (P = 0.006, Fig. 1c). In addition, plasma levels of IgG1 anti-gp41 were higher but the difference was not statistically significant (Fig. 1d). Correlations of antibody levels at week 0 demonstrated that IgG2 anti-p24 correlated with IgG1 anti-p24 (r = 0.57, P = 0.005) and IgG1 anti-gp41 (r = 0.50, P = 0.016) (Fig. 2a and b).

Fig. 1
Fig. 1
Image Tools
Fig. 2
Fig. 2
Image Tools
Back to Top | Article Outline
Plasma levels of IgG2 anti-p24 at week 0 were associated with a lower time-weighted increase in plasma HIV RNA after cessation of antiretroviral therapy

To determine the effect of vaccination on HIV replication after ceasing ART, plasma HIV RNA levels were measured weekly over 20 weeks. The relationship between plasma levels of IgG2 anti-p24 at week 0 and HIV replication after ceasing ART was examined by dividing antibody levels for each group into tertiles and comparing the time-weighted increase in plasma HIV RNA level over 20 weeks for each tertile. As shown in Table 1, the time-weighted increase in plasma HIV RNA levels was lowest in patients who belonged to the highest tertile of IgG2 anti-p24. However, a similar association was also observed for IgG1 antibodies to gp41, which was not encoded by the rFPV vaccine. As IgG2 anti-p24 correlated with IgG1 anti-gp41 at week 0, adjusted analyses were attempted but could not further delineate independent effects of IgG2 anti-p24 and IgG1 anti-gp41 tertiles at baseline on time-weighted increase in plasma HIV RNA levels.

Table 1
Table 1
Image Tools
Back to Top | Article Outline
Patients with ‘high-affinity’ FcγRIIa genotypes and IgG2 anti-p24 had lower HIV replication after ceasing antiretroviral therapy

To further investigate the role that IgG2 antibodies might have had in controlling HIV replication after the ART was ceased, analyses were undertaken to examine the relationship of IgG2 anti-p24 and FcγRIIa genotype on HIV replication. As shown in Fig. 3, plasma HIV RNA levels over 20 weeks were lowest in patients from the full construct group who had both an IgG2 anti-p24 band intensity of more than 200/mm2 and the FcγRIIa HH or RH genotype (n = 3) compared with patients who had one or neither of these characteristics (n = 6). At the 20-week time point, plasma HIV RNA levels were lower in patients with both an IgG2 anti-p24 band intensity of more than 200/mm2 and the FcγRIIa HH or RH genotype compared with other full construct group patients (P = 0.002) and other patients from all groups (P = 0.0001).

Fig. 3
Fig. 3
Image Tools
Back to Top | Article Outline
Both IgG2 and IgG1 antibodies to p24 and gp41 increased after cessation of antiretroviral therapy

We also examined the effect of ceasing ART on the plasma levels of IgG2 and IgG1 antibodies to a vaccine-encoded antigen (p24). As shown in Fig. 4, the full construct and partial construct/placebo groups did not differ when plasma levels of IgG2 anti-p24 and IgG1 anti-p24 were compared at week 9 (P = 0.75 and 0.93, respectively) or week 20 (P = 0.56 and 0.94, respectively).

Fig. 4
Fig. 4
Image Tools
Back to Top | Article Outline

Discussion

We have tested the hypothesis that control of HIV replication after cessation of ART in HIV-infected patients who received a course of vaccinations with a rFPV vaccine that encoded both HIV Gag-Pol and IFN-γ was associated with IgG2 antibodies to a Gag-encoded protein (p24) and possession of the ‘high-affinity’ FcγRIIa HH or RH genotypes. Although the number of patients assessed was small, we were able to show that those patients who received the full construct vaccine had higher plasma levels of IgG2 antibodies to p24 prior to the cessation of ART (week 0) and that at this time the highest IgG2 anti-p24 responses were associated with the lowest time-weighted increase in plasma HIV RNA level after cessation of ART. In addition, we demonstrated that patients who had both vaccine-induced IgG2 anti-p24 and ‘high-affinity’ FcγRIIa genotypes had the lowest plasma HIV RNA levels after ART was ceased.

Plasma levels of IgG1 antibody to p24 and to gp41 (an antigen not encoded by the rFPV vaccine) at week 0 were also higher in patients who had received the full construct vaccine. Indeed, at week 0, plasma levels of IgG2 anti-p24 correlated with levels of IgG1 antibodies to both p24 and gp41. In contrast, IgG2 anti-gp41 levels were not increased in the full construct vaccine group at week 0 (Fig. 1b). These findings suggest that the IFN-γ produced at the site of vaccination enhanced IgG1 antibody responses to both vaccine-encoded and nonencoded antigens but only induced isotype switching to IgG2 antibodies for an antigen encoded by the rFPV vaccine. Like IgG2 anti-p24, higher serum levels of IgG1 anti-gp41 at week 0 were associated with a lower time-weighted increase in plasma HIV RNA after cessation of ART (Table 1). We were unable to determine the relative effects of IgG2 anti-p24 and IgG1 anti-gp41 on HIV replication after ceasing ART because of small patient numbers. It is therefore not possible to exclude an effect of IgG1 anti-gp41 alone or in combination with IgG2 anti-p24. However, it should be noted that studies in patients with primary HIV infection suggest that IgG anti-gp41 has little impact on HIV replication [24].

Plasma levels of IgG2 and IgG1 anti-p24 progressively increased after cessation of ART, presumably reflecting the increase in HIV replication in most patients [25]. However, there was no difference in plasma levels of these antibodies between the full construct and partial construct/placebo groups at weeks 9 or 20. This suggests that when HIV replication is suppressed, IFN-γ at the site of vaccination facilitates production of IgG2 antibodies that may be associated with suppression of HIV replication when ART is ceased but that in the presence of generalized immune activation after resumption of HIV replication, IgG2 antibodies induced by polyclonal B-cell activation have no additional effect.

Human IgG2 antibodies are associated with type 1 ‘helper’ T-cell (Th1) responses in experimental cryptococcal infection [26] and systemic lupus erythematosus (SLE) [27]. This may also be the case in HIV infection because Martinez et al. [12] demonstrated that the combination of a strong Th1 CD4+ T-cell response to p24 and a strong IgG2 antibody response to gp41 predicted long-term nonprogression of HIV infection better than any other marker, including the genetic markers examined in that study. The nature of the association between IgG2 antibodies and Th1 responses has not been established but it might reflect functional characteristics of the Fc region of IgG2. The Fc region of IgG2 activates the complement system poorly [28] and mediates its effect predominantly by activating FcγRIIa (CD32a) [20], which is a low-affinity FcγR that is only activated by multimeric antibodies, particularly in immune complexes [29,30]. Of note, IgG2 is the predominant IgG subclass in circulating immune complexes of healthy individuals [31].

FcγRIIa is only present in higher primates and is expressed on the surface of cells that function as antigen-presenting cells (APCs) and/or phagocytes such as conventional dendritic cells, monocytes, macrophages, platelets, endothelial cells, neutrophils and eosinophils [30]. It is also expressed on plasmacytoid dendritic cell (pDC), the major cell type involved in antiviral immune responses, in which phagocytosis of antigens in immune complexes is one means by which antigens are acquired and presented on class II major histocompatibility complex (MHC) molecules to CD4+ T cells [32–34]. Studies in patients with SLE have shown that pDC activation and production of interferon-alpha (IFN-α) is induced by complexes of DNA and IgG anti-DNA binding to FcγRIIa leading to transportation of the immune complexes to endosomes in which CpG DNA binds to TLR9 [35]. This results in the production of proinflammatory and Th1 cytokines as well as IFN-α. A similar mechanism of phagocytosis via FcγRIIa and intracellular transportation to endosomal TLR7 has been described for immune complexes of Coxsackievirus RNA and antibody [36]. It is therefore possible that HIV antigens are processed by pDC in a similar way. FcγRIIa may be particularly effective in this process because, unlike FcγRI and FcγRIIIa, it is not functionally impaired by HIV infection [37].

Our argument that IgG2 antibodies against p24, an internal protein of HIV, might be enhancing opsonization of HIV may appear to be counter-intuitive. However, it has been clearly demonstrated that antibodies to p24 are associated with slower progression of HIV disease [38,39], though the mechanism is unclear. IgG2 antibodies are a major component of the antibody response to carbohydrate antigens and facilitate opsonization of encapsulated bacteria by binding to FcγRIIa [40–42]. An IgG2 antibody response to glycoproteins of the HIV envelope might therefore be an explanation for the association between nonprogressive HIV disease and IgG2 antibodies to HIV gp41 [13,14]. In this study, we evaluated IgG2 antibodies to p24 because the rFPV vaccine, which was designed to enhance T-cell responses, encoded only HIV Gag-Pol antigens. There are also other characteristics of IgG2 that might enhance a protective immune response against antigens of HIV. These include the ability of IgG2 to form covalent dimers, thereby enhancing FcγR binding [43], and resistance to the decreased binding of FcγRIIa to IgG antibodies caused by deglycosylation of the Fc region of IgG molecules [44], which is an effect of HIV infection [45].

In summary, we have demonstrated in a small randomized controlled trial that vaccination with rFPV that encoded HIV Gag-Pol and IFN-γ resulted in the production of IgG2 antibodies to a vaccine-encoded protein (p24) in five of nine (54.5%) patients and that such antibodies were associated with control of HIV replication in individuals who possessed the ‘high-affinity’ FcγRIIa HH or RH genotypes. We suggest that further attention should be paid to the role of B-cell immunoglobulin isotype switching, IgG2 antibodies and FcγRIIa in the control of HIV infection. Furthermore, inclusion of the IFN-γ gene in DNA vaccine constructs might be a means of enhancing switching to IgG2 antibody production.

Back to Top | Article Outline

Acknowledgements

The authors wish to thank Ibrahim Fleyfel for technical assistance and Professor Ian James for advice on statistical analysis of the data.

Author contributions: M.A.F. devised and undertook overall supervision of the study and wrote the first draft of the manuscript. S.T. and A.L. undertook the antibody assays. S.E., A.D.K. and L.D.W. established the original clinical trial and provided patient samples and funding. M.G.L. and S.F. undertook analysis and presentation of the data. All authors reviewed and approved the final version of the manuscript.

Back to Top | Article Outline

References

1. Walker BD, Burton DR. Towards an AIDS vaccine. Science 2008; 320:760–764.

2. Johnston MI, Fauci AS. An HIV vaccine: challenges and prospects. N Engl J Med 2008; 359:888–890.

3. Emery S, Kelleher AD, Workman C, Puls RL, Bloch M, Baker D, et al. Influence of IFNγ co-expression on the safety and antiviral efficacy of recombinant fowlpox virus HIV therapeutic vaccines following interruption of antiretroviral therapy. Hum Vaccines 2007; 3:260–267.

4. Emery S, Workman C, Puls RL, Bloch M, Baker D, Bodsworth N, et al. Randomised, placebo-controlled, phase I/IIa evaluation of the safety and immunogenecity of fowlpox virus expressing HIV gag-pol and interferon-γ in HIV-1 infected subjects. Hum Vaccines 2005; 1:232–238.

5. Bergthaler A, Flatz L, Verschoor A, Hegazy AN, Holdener M, Fink K, et al. Impaired antibody response causes persistence of prototypic T cell-contained virus. PLoS Biol 2009; 7:e1000080. Erratum in: PLoS Biol. 7, doi:10.1371/annotation/42dca769-eca8-4e8f-a6b5-236355b631ff.

6. Kawano Y, Noma T. Role of interleukin-2 and interferon-γ in inducing production of IgG subclasses in lymphocytes of human newborns. Immunology 1996; 88:40–48.

7. Kawano Y, Noma T, Yata J. Regulation of human IgG subclass production by cytokines. J Immunol 1994; 153:4948–4958.

8. Kitani A, Strober W. Regulation of C gamma subclass germ-line transcripts in human peripheral blood B cells. J Immunol 1993; 151:3478–3488.

9. Inoue R, Kondo N, Kobayashi Y, Fukutomi O, Orii T. IgG2 deficiency associated with defects in production of interferon-gamma; comparison with common variable immunodeficiency. Scand J Immunol 1995; 41:130–134.

10. Kondo N, Inoue R, Kasahara K, Fukao T, Kaneko H, Tashita H, et al. Reduced expression of the interferon-gamma messenger RNA in IgG2 deficiency. Scand J Immunol 1997; 45:227–230.

11. Ngo-Giang-Huong N, Candotti D, Goubar A, Autran B, Maynart M, Sicard D, et al. HIV type 1-specific IgG2 antibodies: markers of helper T cell type 1 response and prognostic marker of long-term nonprogression. AIDS Res Hum Retroviruses 2001; 17:1435–1446.

12. Martinez V, Costagliola D, Bonduelle O, N'go N, Schnuriger A, Théodorou I, et al. Combination of HIV-1-specific CD4 Th1 cell responses and IgG2 antibodies is the best predictor for persistence of long term nonprogression. J Infect Dis 2005; 191:2053–2063.

13. Mergener K, Enzensberger W, Rübsamen-Waigmann H, von Briesen H, Doerr HW. Immunoglobulin class- and subclass-specific HIV antibody detection in serum and CSF specimens by ELISA and western blot. Infection 1987; 15:317–322.

14. Lal RB, Heiba IM, Dhawan RR, Smith ES, Perine PL. IgG subclass responses to human immunodeficiency virus-1 antigens: lack of IgG2 response to gp41 correlates with clinical manifestation of disease. Clin Immunol Immunopathol 1991; 58:267–277.

15. Xu W, Santini PA, Sullivan JS, He B, Shan M, Ball SC, et al. HIV-1 evades virus-specific IgG2 and IgA responses by targeting systemic and intestinal B cells via long-range intercellular conduits. Nat Immunol 2009; 10:1008–1017.

16. Trujillo JD, Hötzel KJ, Snekvik KR, Cheevers WP. Antibody response to the surface envelope of caprine arthritis-encephalitis lentivirus: disease status is predicted by SU antibody isotype. Virology 2004; 325:129–136.

17. Singh I, McConnell I, Dalziel R, Blacklaws BA. Serum containing ovine IgG2 antibody specific for maedi visna envelope glycoprotein mediates antibody dependant cellular cytotoxicity. Vet Immunol Immunopathol 2006; 113:357–366.

18. Micusan VV, Borduas AG. Biological properties of goat immunoglobulin G. Immunology 1977; 32:373–381.

19. Johnson PR, Schnepp BC, Zhang J, Connell MJ, Greene SM, Yuste E, et al. Vector-mediated gene transfer engenders long-lived neutralizing activity and protection against SIV infection in monkeys. Nat Med 2009; 15:901–906.

20. Bruhns P, Iannascoli B, England P, Mancardi DA, Fernandez N, Jorieux S, et al. Specificity and affinity of human Fcgamma receptors and their polymorphic variants for human IgG subclasses. Blood 2009; 113:3716–3725.

21. Warmerdam PA, van de Winkel JG, Vlug A, Westerdaal NA, Capel PJ. A single amino acid in the second Ig-like domain of the human Fc gamma receptor II is critical for human IgG2 binding. J Immunol 1991; 147:1338–1343.

22. Forthal DN, Landucci G, Bream J, Jacobson LP, Phan TB, Montoya B. FcγRIIa genotype predicts progression of HIV infection. J Immunol 2007; 179:7916–7923.

23. Brandt JT, Isenhart CE, Osborne JM, Ahmed A, Anderson CL. On the role of platelet Fc gamma RIIa phenotype in heparin-induced thrombocytopenia. Thromb Haemost 1995; 74:1564–1572.

24. Tomaras GD, Yates NL, Liu P, Qin L, Fouda GG, Chavez LL, et al. Initial B-cell responses to transmitted human immunodeficiency virus type 1: virion-binding immunoglobulin M (IgM) and IgG antibodies followed by plasma antigp41 antibodies with ineffective control of initial viremia. J Virol 2008; 82:12449–12463.

25. Voltersvik P, Albrektsen G, Ulvestad E, Dyrhol-Riise AM, Sørensen B, Asjö B. Changes in immunoglobulin isotypes and immunoglobulin G (IgG) subclasses during highly active antiretroviral therapy: antip24 IgG1 closely parallels the biphasic decline in plasma viremia. J Acquir Immune Defic Syndr 2003; 34:358–367.

26. Beenhouwer DO, Yoo EM, Lai CW, Rocha MA, Morrison SL. Human immunoglobulin G2 (IgG2) and IgG4, but not IgG1 or IgG3, protect mice against Cryptococcus neoformans infection. Infect Immun 2007; 75:1424–1435.

27. Stummvoll GH, Fritsch RD, Meyer B, Hoefler E, Aringer M, Smolen JS, et al. Characterisation of cellular and humoral autoimmune responses to histone H1 and core histones in human systemic lupus erythematosus. Ann Rheum Dis 2009; 68:110–116.

28. Jefferis R, Lund J. Interaction sites on human IgG-Fc for FcgammaR: current models. Immunol Lett 2002; 82:57–65.

29. Worth RG, Chien CD, Chien P, Reilly MP, McKenzie SE, Schreiber AD. Platelet FcgammaRIIA binds and internalizes IgG-containing complexes. Exp Hematol 2006; 34:1490–1495.

30. Nimmerjahn F, Ravetch JV. Fcgamma receptors as regulators of immune responses. Nat Rev Immunol 2008; 8:34–47.

31. Stahl D, Sibrowski W. IgG2 containing IgM-IgG immune complexes predominate in normal human plasma, but not in plasma of patients with warm autoimmune haemolytic anaemia. Eur J Haematol 2006; 77:191–202.

32. Jaehn PS, Zaenker KS, Schmitz J, Dzionek A. Functional dichotomy of plasmacytoid dendritic cells: antigen-specific activation of T cells versus production of type I interferon. Eur J Immunol 2008; 38:1822–1832.

33. Benitez-Ribas D, Tacken P, Punt CJ, de Vries IJ, Figdor CG. Activation of human plasmacytoid dendritic cells by TLR9 impairs Fc gamma RII-mediated uptake of immune complexes and presentation by MHC class II. J Immunol 2008; 181:5219–5224.

34. Villadangos JA, Young L. Antigen-presentation properties of plasmacytoiddendritic cells. Immunity 2008; 29:352–361.

35. Means TK, Latz E, Hayashi F, Murali MR, Golenbock DT, Luster AD. Human lupus autoantibody-DNA complexes activate DCs through cooperation of CD32 and TLR9. J Clin Invest 2005; 115:407–417.

36. Wang JP, Asher DR, Chan M, Kurt-Jones EA, Finberg RW. Cutting edge: antibody-mediated TLR7-dependent recognition of viral RNA. J Immunol 2007; 178:3363–3367.

37. Leeansyah E, Wines BD, Crowe SM, Jaworowski A. The mechanism underlying defective Fcgamma receptor-mediated phagocytosis by HIV-1-infected human monocyte-derived macrophages. J Immunol 2007; 178:1096–1104.

38. Morand-Joubert L, Bludau H, Lerable J, Petit JC, Lefrère JJ. Serum antip24 antibody concentration has a predictive value on the decrease of CD4 lymphocyte count higher than acid-dissociated p24 antigen. J Med Virol 1995; 47:87–91.

39. Hogervorst E, Jurriaans S, de Wolf F, van Wijk A, Wiersma A, Valk M, et al. Predictors for non and slow progression in human immunodeficiency virus (HIV) type 1 infection: low viral RNA copy numbers in serum and maintenance of high HIV-1 p24-specific but not V3-specific antibody levels. J Infect Dis 1995; 171:811–821.

40. Soininen A, Seppälä I, Nieminen T, Eskola J, Käyhty H. IgG subclass distribution of antibodies after vaccination of adults with pneumococcal conjugate vaccines. Vaccine 1999; 17:1889–1897.

41. Vitharsson G, Jónsdóttir I, Jónsson S, Valdimarsson H. Opsonization and antibodies to capsular and cell wall polysaccharides of Streptococcus pneumoniae. J Infect Dis 1994; 170:592–599.

42. Rodriguez ME, van der Pol WL, Sanders LA, van de Winkel JG. Crucial role of FcγRIIa (CD32) in assessment of functional anti-Streptococcus pneumoniae antibody activity in human sera. J Infect Dis 1999; 179:423–433.

43. Yoo EM, Wims LA, Chan LA, Morrison SL. Human IgG2 can form covalent dimers. J Immunol 2003; 170:3134–3138.

44. Allhorn M, Olin AI, Nimmerjahn F, Collin M. Human IgG-FcγR interactions are modulated by streptococcal IgG glycan hydrolysis. PLoS ONE 2008; 3:e1413.

45. Moore JS, Wu X, Kulhavy R, Tomana M, Novak J, Moldoveanu Z, et al. Increased levels of galactose-deficient IgG in sera of HIV-1-infected individuals. AIDS 2005; 19:381–389.

Cited By:

This article has been cited 2 time(s).

Clinical and Vaccine Immunology
Induction of Both Cellular and Humoral Immunity following a Rational Prime-Boost Immunization Regimen That Incorporates Recombinant Ovine Atadenovirus and Fowlpox Virus
Fraser, CK; Diener, KR; Lousberg, EL; Both, GW; Ward, L; Brown, MP; Hayball, JD
Clinical and Vaccine Immunology, 17(): 1679-1686.
10.1128/CVI.00291-10
CrossRef
Journal of Virology
Enhanced Phagocytic Activity of HIV-Specific Antibodies Correlates with Natural Production of Immunoglobulins with Skewed Affinity for Fc gamma R2a and Fc gamma R2b
Ackerman, ME; Dugast, AS; McAndrew, EG; Tsoukas, S; Licht, AF; Irvine, DJ; Alter, G
Journal of Virology, 87(): 5468-5476.
10.1128/JVI.03403-12
CrossRef
Back to Top | Article Outline
Keywords:

FcγRIIa; HIV; IgG2; vaccine

© 2010 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.