Skip Navigation LinksHome > March 13, 2010 - Volume 24 - Issue 5 > High prevalence of bevirimat resistance mutations in proteas...
AIDS:
doi: 10.1097/QAD.0b013e32833160fa
Basic Science: Concise Communication

High prevalence of bevirimat resistance mutations in protease inhibitor-resistant HIV isolates

Verheyen, Jensa; Verhofstede, Chrisb; Knops, Elenaa; Vandekerckhove, Linosb; Fun, Axelc; Brunen, Diedec; Dauwe, Kennyb; Wensing, Annemarie MJc; Pfister, Herberta; Kaiser, Rolfa; Nijhuis, Moniquec

Free Access
Article Outline
Collapse Box

Author Information

aInstitute of Virology, University of Cologne, Cologne, Germany

bAIDS Reference Laboratory, Ghent University, Ghent, Belgium

cDepartment of Medical Microbiology, University Medical Center Utrecht, Utrecht, The Netherlands.

Received 28 April, 2009

Revised 16 July, 2009

Accepted 30 July, 2009

Correspondence to Jens Verheyen, MD, Institute of Virology, University of Cologne, Fürst-Pückler Street 56, 50935 Cologne, Germany. Tel: +49 211 4783927; fax: +49 211 4783927; e-mail: jens.verheyen@uk-koeln.de

Collapse Box

Abstract

Objective: Bevirimat is the first drug of a new class of antivirals that hamper the maturation of HIV. The objective of this study was to evaluate the sequence variability of the gag region targeted by bevirimat in HIV subtype-B isolates.

Methods: Of 484 HIV subtype-B isolates, the gag region comprising amino acids 357–382 was sequenced. Of the patients included, 270 were treatment naive and 214 were treatment experienced. In the latter group, 48 HIV isolates harboured mutations associated with reverse transcriptase inhibitor resistance only, and 166 HIV isolates carried mutations associated with protease inhibitor resistance.

Results: In the treatment-naive patient population, approximately 30% harboured an HIV isolate with at least one mutation associated with a reduced susceptibility to bevirimat (H358Y, L363M, Q369H, V370A/M/del and T371del). In HIV isolates with protease inhibitor resistance, the prevalence of bevirimat resistance mutations increased to 45%. Accumulation of mutations at four positions in the bevirimat target region, S368C, Q369H, V370A and S373P, was significantly observed. Mutations associated with bevirimat resistance were detected more frequently in HIV isolates with three or more protease inhibitor resistance mutations than in those with less than three protease inhibitor mutations.

Conclusion: Reduced bevirimat activity can be expected in one-third of treatment-naive HIV subtype-B isolates and significantly more in protease inhibitor-resistant HIV. These data indicate that screening for bevirimat resistance mutations before administration of the drug is essential.

Back to Top | Article Outline

Introduction

Selection of resistance to antiretroviral drugs remains a major obstacle to achieving sustainable suppression of viral replication in HIV-infected patients. Cross-resistance between antiretroviral drugs sharing the same target in the HIV replication cycle can lead to an important reduction in the number of therapeutic options. The availability of an increasing number of drug classes will help to individualize antiretroviral therapy with respect to drug resistance as well as other drug-related factors such as side effects [1] and cardiovascular risk [2].

Bevirimat (PA-457; Myriad Pharmaceuticals Inc., Salt Lake City, Utah, USA), successfully used in phase I and II studies, is the first compound in the class of maturation inhibitors. This maturation inhibitor hampers the processing of the precursor gag protein by the viral protease [3,4]. Analysis of bevirimat-treated cell cultures demonstrated the release of noninfectious virus particles with accumulation of the precursor protein p25 [5]. Although the exact mechanism of action is unknown, cleavage site p24/p2 and p2 were identified as target regions. Mutations conferring resistance to the maturation inhibitor were located at both sites [6,7] and might either increase the cleavage rate of cleavage site p24/p2 by the viral protease or infer with binding of the drug [8].

Placebo-controlled, phase I/II monotherapy studies show a dose-dependent inhibition of virus replication [9]. Bevirimat in-vitro selection experiments reveal the accumulation of mutations at the cleavage site p24/p2 conferring phenotypic resistance to bevirimat (H358Y, L363M/F/Y, A364V/F/I/L/M and A366V/T) [6,8]. These mutations result in an increased cleavage rate in the presence of bevirimat [7,10]. So far, no in-vivo-selected resistance-conferring mutations have been reported after short-term exposure to the inhibitor in clinical trials. However, from in-vivo observations, it became apparent that the effectiveness of bevirimat therapy was impaired by naturally occurring HIV polymorphisms in the QVT motif of p2 (amino acids 369–371) [6,11]. Bevirimat resistance was confirmed by phenotypic assays ranging from 3.2-fold (Q369H) to 54-fold (V370A) [12]. So far, the prevalence of gag polymorphisms at any position relevant for bevirimat resistance is thought to be approximately 40% regardless of antiretroviral therapy [11,13]. As HIV gag is the substrate of the viral protease and coevolution of HIV protease and gag has been observed during protease inhibitor exposure [14,15], further data on the prevalence of bevirimat resistance mutations, especially in protease inhibitor-resistant HIV isolates, are needed. The objective of this study was to analyse polymorphisms in the bevirimat target region in therapy-naive and therapy-experienced HIV isolates from three centres in Europe.

Back to Top | Article Outline

Patients and methods

Patients

Gag sequences (amino acids 357–382) of 484 HIV subtype-B isolates from clinical samples collected between 2000 and 2008 in Utrecht (The Netherlands), Ghent (Belgium) and Cologne (Germany) were studied. HIV isolates from drug-naive patients were examined for the absence of transmitted drug resistance according to the surveillance list for primary resistance [16]. Only samples from drug-naive patients with wild-type virus were included (therapy naive, n = 270). HIV isolates collected from patients after treatment failure were grouped according to the presence of resistance in the protease (treatment-experienced protease, n = 166) or the absence of these mutations but the presence of reverse transcriptase inhibitor (RTI) resistance-associated International AIDS Society (IAS) mutations (treatment-experienced reverse transcriptase, n = 48) [17]. Overall, the therapy-experienced HIV isolates harboured a median of three protease mutations.

Back to Top | Article Outline
Methods

Reverse transcriptase-PCR amplification and sequencing of the viral protease and reverse transcriptase were performed using the routine HIV genotypic resistance test protocols from Utrecht [18], Ghent [19] and Cologne [20]. The HIV gag region (amino acids 357–382) was analysed from PCR amplification products [Utrecht: as previously described [18]; Ghent: outer-sense (1309→1336): GCATTATCAGAAGGAGCCACCCCACAAG, outer-antisense (2716→2735): GGCAAATACTGGAGTATTGT, inner-sense (1359→1388): AGTGGGGGGACATCAAGCAGCCATGCAAAT, inner-antisense (2586→2605): GGGCCATCCATTCCTGGCTT; Cologne: gag6fw (nt1737–1759): GATGAC AGAAACCTTGTTGGTCC and p6-1rev (nt2382–2404): CCAATTCCCCCTATC ATTTTTGG) using the sequence primers {Ghent: inner-sense primer and sense (1918–1937) ATGATGCAGAGARRYAATTT, sense (2148–2166) AGAGCCAACAGC CCCACCA, antisense (2148–2167) CTGGTGGGGCTGTTGGYTCY; Cologne: gag6fw and p6-1rev)}]. Gag nucleotide sequences were edited and translated into amino acid sequences. Sequences were aligned to the consensus B sequence, and amino acid substitutions were identified as compared with the consensus B sequence (amino acids 357–382). HIV populations with mixtures of mutant and wild-type amino acids were considered as mutant.

Back to Top | Article Outline
Statistical analysis

Categorical variables were analysed using either the chi-squared test of association or Fisher's exact test, according to the size of the analysed group.

Back to Top | Article Outline

Results

In the treatment-naive patients, a clear difference in sequence variability of the cleavage site p24/p2 (amino acids 359–368) and cleavage site p2/p7 (amino acids 373–382) was observed, with cleavage site p24/p2 being highly conserved (at least one mutation at one position: n = 38, 14.1%) and cleavage site p2/p7 highly variable (at least one mutation at one position: n = 246, 91.1%) (Table 1). The variability of cleavage site p2/p7 was most pronounced at the p2 site: amino acid positions 373–377 (at least one mutation at one position: n = 214, 79.3%). The remaining part of p2, outside of the cleavage sites (amino acids 369–372), was also highly variable (at least one mutation at one position: n = 160, 59.3%). One or more polymorphisms at the QVT (amino acid positions 369–371) were found in 41.5% of all HIV therapy-naive patient samples. Overall, at least one mutation conferring reduced bevirimat activity in phenotypic resistance tests (H358Y, L363M, Q369H, V370A, V370M, V370del and T371del) was observed in 85 (31.5%) of the 270 isolates from therapy-naive individuals (Table 2).

Table 1
Table 1
Image Tools
Table 2
Table 2
Image Tools

In the 48 isolates with RTI resistance but no protease inhibitor resistance, the frequency of any mutation at cleavage site p24/p2, cleavage site p2/p7, cleavage site p2 and the QVT motif was 16.7, 86.7, 52.1 and 37.5%, respectively (Table 1). Mutations associated with resistance to bevirimat were observed in 25% (n = 12) (Table 2).

In the 166 isolates with protease resistance, the overall prevalence of cleavage site polymorphisms was only slightly different from the prevalence observed in therapy-naive individuals: any mutation at cleavage site p24/p2 (n = 30, 18.1%) and any mutation at cleavage site p2/p7 (n = 159, 95.8%). But a significant accumulation of specific mutations was observed at both cleavage sites: S368C at cleavage site p24/p2 (P < 0.05) and S373P at cleavage site p2/p7 (P < 0.05) (Table 2). Other cleavage site mutations were found exclusively in the TE-PR group (H358Y, A364G, S373del, T375I, M378ins, G381del, N382D, N382Q and N382del).

Furthermore, two of the mutations in the QVT motif that are associated with bevirimat resistance were significantly more frequently identified in the TE-PR patient group (Q369H: P < 0.01 and V370A: P < 0.05) (Table 2).

Overall, mutations conferring bevirimat resistance were detected in 45.2% of all TE-PR isolates, which is significantly higher than their frequency of detection in treatment-naive individuals (P < 0.01). More detailed analysis revealed a significantly higher frequency of these mutations in isolates with three or more protease resistance mutations compared with isolates with two or less mutations [1–2 protease inhibitor mutations: 23/67 (34%) vs. ≥3 protease inhibitor mutations: 52/99 (53%), P < 0.05].

Back to Top | Article Outline

Discussion

Bevirimat, the first maturation inhibitor tested in phase I/II monotherapy studies, targets the gag region and hampers the accurate processing of the gag precursor protein. Resistance-conferring mutations to this new compound were identified in vitro and in vivo at the cleavage site p24/p2 (H358Y, L363M/F, A364I/M/V and A366V/T) and in p2 (QVT motif Q369H, V370A/M/del and T371del) [21]. All these mutations conferred phenotypic resistance to bevirimat, when introduced as single mutations in a subtype-B background [6]. Different mechanisms of resistance seemed to be involved, with L363F and A364V increasing the cleavage at p24/p2 and other mutations potentially affecting bevirimat binding (amino acids 369–371) [8].

The results of the study presented showed that overall, 30% of therapy-naive HIV isolates harboured at least one mutation associated with bevirimat resistance. In general, these data are in agreement with the data published by McCallister et al. [11] from therapy-naive patients.

HIV gag is a substrate of the viral protease, and coevolution of HIV protease and gag has been observed during protease inhibitor exposure [15,22,23]. Indeed, two gag mutations that accumulate during protease inhibitor exposure (S368C and S373P) were located at the cleavage sites p24/p2 and p2/p7. Whether these cleavage site mutations compensate for the impaired enzymatic activity of the mutant protease, or directly contribute to protease inhibitor resistance [22], still has to be determined. Interestingly, it has been demonstrated that S373P has a negative impact on the virological response to antiretroviral therapy with protease inhibitors [24].

In this study, we have compared the prevalence of bevirimat resistance mutations in protease inhibitor susceptible and protease inhibitor-resistant clinical isolates. Interestingly, in these resistant isolates, an increased prevalence of bevirimat resistance mutations was seen. These findings are different as compared to those reported previously [13,25]. This discordance can most likely be explained by the different composition of the study groups, with the inclusion of more patients with a higher number of protease resistance mutations (median of three protease mutations) in our study compared with the study by Malet et al. [13,24] (median of two protease mutations) or Knapp et al. [25] (number of protease mutations not specified). The observation of a significant association between the number of protease mutations and the presence of bevirimat resistance mutations again emphasizes that these bevirimat resistance mutations are coselected during prolonged protease inhibitor therapy failure.

In particular, the increased prevalence of QVT motif mutations Q369H (12.0%) and V370A (21.1%) contributes to the overall increase in bevirimat resistance mutations in protease inhibitor-resistant isolates. Both mutations were less prevalent in the protease inhibitor-experienced patients studied by Malet et al. [13] (Q369H: 2.4% and V370A: 17.0%). However, a comparable prevalence of these mutations was also found in the heavily pretreated patients in the bevirimat phase II studies (Q369H: 15.4% and V370A: 25.4% [11]).

The overall prevalence of primary resistance to bevirimat in therapy-naive or experienced patients might be even higher. The presence of several other mutations for which the influence on bevirimat resistance is not yet clear (V362I, L363S, A364S and S368C) was observed. The S368C mutation is of special interest, as this mutation was reported in bevirimat-resistant HIV in combination with V370A and Q369H [6,26]. Conflicting results regarding the impact of mutation V362I [27] on phenotypic bevirimat resistance require further phenotypic testing. Scoring all mutations in the QVT motif (amino acids 369–371) for primary bevirimat resistance can also be misleading, as not all substitutions are associated with reduced susceptibility to bevirimat (e.g. T371Q) [6,12]. Even absence of bevirimat resistance mutations might be no guarantee for a sustained suppression of viral replication in HIV-infected patients by bevirimat therapies, as these mutations might already be present as minority species or might easily develop depending on the genetic barrier of bevirimat.

This study concentrated on the detection of mutations in the bevirimat target region of subtype-B isolates, but an even greater variability of the bevirimat target region of non-B HIV isolates is to be expected [12]. Especially, HIV subtype-C isolates might be less susceptible to bevirimat as a result of the more frequent presence of V370A, which is also found in the consensus gag sequence of HIV subtype-C isolates [12].

Back to Top | Article Outline
Conclusion

The findings presented here indicate that coevolution in gag during protease inhibitor treatment failure increases the prevalence of resistance to bevirimat and reduces clinical outcome during bevirimat therapy. These results emphasize the importance of screening for gag mutations before the administration of maturation inhibitors.

Back to Top | Article Outline

Acknowledgements

This study was supported by a grant of the German Ministry of Health and Social Security (AZ 319-4476-02/03) and funded by European Union grant (LSHP-CT-2007-037693), a Dutch AIDS Fonds grant (#2006028) and The Netherlands Organization for Scientific Research (NWO) VIDI grant (#91796349). We thank Tessa James for critical reading of our manuscript.

E.K., A.F., D.B. and K.D. performed the practical work of this study. R.K., H.P., L.V. and A.M.W. supervised the routine HIV drug resistance tests. The analysis of the gag sequences was supervised by J.V., C.V. and M.N. The manuscript was written by J.V., L.V., C.V. and M.N. All authors contributed to critical revision of the manuscript and provided final approval of the version to be published.

Back to Top | Article Outline

References

1. Chiao SK, Romero DL, Johnson DE. Current HIV therapeutics: mechanistic and chemical determinants of toxicity. Curr Opin Drug Discov Devel 2009; 12:53–60.

2. Aberg JA. Cardiovascular complications in HIV management: past, present, and future. J Acquir Immune Defic Syndr 2009; 50:54–64.

3. Zhou J, Huang L, Hachey DL, Chen CH, Aiken C. Inhibition of HIV-1 maturation via drug association with the viral gag protein in immature HIV-1 particles. J Biol Chem 2005; 280:42149–42155.

4. Zhou J, Yuan X, Dismuke D, Forshey BM, Lundquist C, Lee KH, et al. Small-molecule inhibition of human immunodeficiency virus type 1 replication by specific targeting of the final step of virion maturation. J Virol 2004; 78:922–929.

5. Li F, Zoumplis D, Matallana C, Kilgore NR, Reddick M, Yunus AS, et al. Determinants of activity of the HIV-1 maturation inhibitor PA-457. Virology 2006; 356:217–224.

6. Salzwedel K, Reddick M, Matallana C, Finnegan C, Adamson C, Sakalian M, et al. Role of gag polymorphisms in HIV-1 sensitivity to the maturation inhibitor bevirimat. In: XVII International HIV Drug Resistance Workshop; 10–14 June 2008; Sitges, Spain.

7. Zhou J, Chen CH, Aiken C. Human immunodeficiency virus type 1 resistance to the small molecule maturation inhibitor 3-O-(3′,3′-dimethylsuccinyl)-betulinic acid is conferred by a variety of single amino acid substitutions at the CA-SP1 cleavage site in Gag. J Virol 2006; 80:12095–12101.

8. Salzwedel K, Martin DE, Sakalian M. Maturation inhibitors: a new therapeutic class targets the virus structure. AIDS Rev 2007; 9:162–172.

9. Smith PF, Ogundele A, Forrest A, Wilton J, Salzwedel K, Doto J, et al. Phase I and II study of the safety, virologic effect, and pharmacokinetics/pharmacodynamics of single-dose 3-o-(3′,3′-dimethylsuccinyl)betulinic acid (bevirimat) against human immunodeficiency virus infection. Antimicrob Agents Chemother 2007; 51:3574–3581.

10. Adamson CS, Ablan SD, Boeras I, Goila-Gaur R, Soheilian F, Nagashima K, et al. In vitro resistance to the human immunodeficiency virus type 1 maturation inhibitor PA-457 (Bevirimat). J Virol 2006; 80:10957–10971.

11. McCallister S, Lalezari J, Richmond G, Thompson M, Harrigan R, Martin D, et al. HIV-1 gag polymorphisms determine treatment response to bevirimat (PA-457). In: XVII International HIV Drug Resistance Workshop; 10–14 June 2008; Sitges, Spain.

12. Salzwedel K, Hamy F, Louvel S, Sakalian M, Reddick M, Finnegan C, et al. Susceptibility of diverse HIV-1 patient isolates to the maturation inhibitor, bevirimat, is determined by clade-specific polymorphisms in gag CA-SP1. In: 16th Conference on Retroviruses and Opportunistic Infections; 8–11 February 2009; Montreal, Quebec.

13. Malet I, Wirden M, Derache A, Simon A, Katlama C, Calvez V, Marcelin AG. Primary genotypic resistance of HIV-1 to the maturation inhibitor PA-457 in protease inhibitor-experienced patients. AIDS 2007; 21:871–873.

14. Verheyen J, Knops E, Kupfer B, Hamouda O, Somogyi S, Schuldenzucker U, et al. Prevalence of C-terminal gag cleavage site mutations in HIV from therapy-naive patients. J Infect 2009; 58:61–67.

15. Verheyen J, Litau E, Sing T, Daumer M, Balduin M, Oette M, et al. Compensatory mutations at the HIV cleavage sites p7/p1 and p1/p6-gag in therapy-naive and therapy-experienced patients. Antivir Ther 2006; 11:879–887.

16. Shafer RW, Rhee SY, Pillay D, Miller V, Sandstrom P, Schapiro JM, et al. HIV-1 protease and reverse transcriptase mutations for drug resistance surveillance. AIDS 2007; 21:215–223.

17. Johnson VA, Brun-Vezinet F, Clotet B, Gunthard HF, Kuritzkes DR, Pillay D, et al. Update of the drug resistance mutations in HIV-1. Top HIV Med 2008; 16:138–145.

18. van Maarseveen NM, de Jong D, Boucher CA, Nijhuis M. An increase in viral replicative capacity drives the evolution of protease inhibitor-resistant human immunodeficiency virus type 1 in the absence of drugs. J Acquir Immune Defic Syndr 2006; 42:162–168.

19. Steegen K, Demecheleer E, De Cabooter N, Nges D, Temmerman M, Ndumbe P, et al. A sensitive in-house RT-PCR genotyping system for combined detection of plasma HIV-1 and assessment of drug resistance. J Virol Methods 2006; 133:137–145.

20. Oette M, Kaiser R, Daumer M, Petch R, Fatkenheuer G, Carls H, et al. Primary HIV drug resistance and efficacy of first-line antiretroviral therapy guided by resistance testing. J Acquir Immune Defic Syndr 2006; 41:573–581.

21. Van Baelen K, Salzwedel K, Rondelez E, Van Eygen V, De Vos S, Verheyen A, et al. Susceptibility of human immunodeficiency virus type 1 to the maturation inhibitor bevirimat is modulated by baseline polymorphisms in Gag spacer peptide 1. Antimicrob Agents Chemother 2009; 53:2185–2188.

22. Nijhuis M, van Maarseveen NM, Lastere S, Schipper P, Coakley E, Glass B, et al. A novel substrate-based HIV-1 protease inhibitor drug resistance mechanism. PLoS Med 2007; 4:e36.

23. Nijhuis M, van Maarseveen NM, Verheyen J, Boucher CAB. Novel mechanisms of HIV protease inhibitor resistance. Curr Opin HIV AIDS 2008; 3:627–632.

24. Malet I, Roquebert B, Dalban C, Wirden M, Amellal B, Agher R, et al. Association of gag cleavage sites to protease mutations and to virological response in HIV-1 treated patients. J Infect 2007; 54:367–374.

25. Knapp DJHF, Huang S, Harrigan PR. Stable prevalence of bevirimat-related HIV gag polymorphisms both before and after HAART exposure. In: 16th Conference on Retroviruses and Opportunistic Infections; 8–11 February 2009; Montreal, Quebec.

26. Van Baelen K, Salzwedel K, De Wolf H, Verlinden Y, Stuyver LJ. HIV-1 susceptibility to the maturation inhibitor bevirimat is modulated by natural polymorphisms at positions 369 -371 in Gag spacer peptide 1. In: XVII International HIV Drug Resistance Workshop; 10–14 June 2008; Sitges, Spain.

27. Margot NA, Gibbs CS, Miller MD. Phenotypic susceptibility to bevirimat among HIV-infected patient isolates without prior exposure to bevirimat. In: 16th Conference on Retroviruses and Opportunistic Infections; 8–11 February 2009; Montreal, Quebec.

Cited By:

This article has been cited 3 time(s).

Biochemistry
A Sensitive Assay Using a Native Protein Substrate for Screening HIV-1 Maturation Inhibitors Targeting the Protease Cleavage Site between the Matrix and Capsid
Lee, SK; Cheng, N; Hull-Ryde, E; Potempa, M; Schiffer, CA; Janzen, W; Swanstrom, R
Biochemistry, 52(): 4929-4940.
10.1021/bi4005232
CrossRef
New Phytologist
Bioengineering of plant (tri)terpenoids: from metabolic engineering of plants to synthetic biology invivo and invitro
Moses, T; Pollier, J; Thevelein, JM; Goossens, A
New Phytologist, 200(1): 27-43.
10.1111/nph.12325
CrossRef
AIDS
Can the further clinical development of bevirimat be justified?
Wainberg, MA; Albert, J
AIDS, 24(5): 773-774.
10.1097/QAD.0b013e328331c83b
PDF (244) | CrossRef
Back to Top | Article Outline
Keywords:

bevirimat; cleavage sites; gag p2; protease inhibitor resistance

© 2010 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.