Skip Navigation LinksHome > July 31, 2009 - Volume 23 - Issue 12 > Multiple transmissions of a stable human leucocyte antigen-B...
AIDS:
doi: 10.1097/QAD.0b013e32832d9267
Basic Science: Concise Communication

Multiple transmissions of a stable human leucocyte antigen-B27 cytotoxic T-cell-escape strain of HIV-1 in The Netherlands

Cornelissen, Mariona; Hoogland, Frederik Ma; Back, Nicole KTb; Jurriaans, Suzanneb; Zorgdrager, Foklaa; Bakker, Margreeta; Brinkman, Keesc; Prins, Mariad; van der Kuyl, Antoinette Ca

Free Access
Article Outline
Collapse Box

Author Information

aLaboratory of Experimental Virology, Center for Infection and Immunity Amsterdam (CINIMA), The Netherlands

bLaboratory of Clinical Virology, Department of Medical Microbiology, Academic Medical Centre, University of Amsterdam, The Netherlands

cDepartment of Internal Medicine, Onze Lieve Vrouwe Gasthuis, The Netherlands

dCluster Infectious Diseases, Health Service of Amsterdam, Amsterdam, The Netherlands.

Received 6 February, 2009

Revised 23 April, 2009

Accepted 30 April, 2009

Correspondence to Antoinette C. van der Kuyl, Laboratory of Experimental Virology, Department of Medical Microbiology, Centre of Infection and Immunity Amsterdam (CINIMA), Academic Medical Centre of the University of Amsterdam, Meibergdreef 15, 1105 AZ Amsterdam, The Netherlands. Tel: +31 20 5666778; fax: +31 20 5669064; e-mail: a.c.vanderkuyl@amc.uva.nl

Collapse Box

Abstract

Objective: The evolution of HIV-1 is largely shaped by the cytotoxic T-cell (CTL) response of the host as encoded by the human leucocyte antigen (HLA) genes. Certain HLA-B alleles can delay disease progression, but it is uncertain whether this protection will sustain or whether the virus is in the process of adaptation. In The Netherlands, HLA-B27 is moderately prevalent (approximately 8–16% of HLA-B alleles). If adaptation to HLA-B alleles is in progress, virus strains carrying escape mutations to HLA-B27 should appear in the epidemic by now.

Design: A subtype B HIV-1 strain carrying a HLA-B27 CTL-escape mutation in the main Gag-p24 KK10 epitope, R264G, together with a compensatory mutation outside this epitope, E260D, was detected in four patients from Amsterdam, The Netherlands, by sequence analysis of the gag gene. The patients were a drug user and three men who have sex with men, and were infected with HIV-1 between 2002 and 2008.

Methods: Characterization and evolutionary analysis of the HIV-1 CTL-escape strain was done by sequence analysis of serial blood plasma samples.

Results: The mutations involved were stable during follow-up and after transmission, also in two individuals lacking HLA-B27.

Conclusion: The finding that a stable HLA-B27 CTL-escape strain is circulating in The Netherlands has important implications for the understanding of virus–host interactions and vaccine design alike. Vaccines targeted at inducing a CTL response might easily be circumvented by the virus. Also, patients carrying protective HLA alleles might not be protected anymore from disease progression in the future.

Back to Top | Article Outline

Introduction

Escape from cytotoxic T-cell (CTL) response is a major force driving HIV-1 evolution [1], reviewed by [2], although many CTL-escape mutations revert back when transmitted to a host with a different human leucocyte antigen (HLA) type [3,4]. HLA-B alleles have a stronger effect upon viral evolution than HLA-A [5], probably because HIV-1 has already adapted to common HLA-A alleles encountered in the early years of its evolution [6]. Adaptation to HLA-A alleles could be faster because fewer polymorphisms are present in the HLA-A genes as compared with HLA-B [7], resulting in low frequencies of specific HLA-B alleles in the human population [8].

Individuals with certain HLA-B alleles have a survival advantage when infected with HIV-1 [9], for example, HLA-B27 and HLA-B57 have been associated with long-term control of the virus, probably through targeting peptides in Gag-p24, a highly conserved viral protein (reviewed in [9]). Allele frequencies for HLA-B27 range from 0–3.6% in sub-Saharan Africans to 8.4–16.7% in whites (www.allelefrequencies.net). For HLA-B57, frequency ranges in both populations are more similar (3.3–8.6% in whites and 6.3–9% in sub-Saharan Africans).

The first AIDS case in The Netherlands was reported in 1983 [10], suggesting that HIV-1 was introduced in the country in the 1970s [11]. By now, the virus has had over 20 years of evolution in a region where HLA-B27 is more prevalent than in sub-Saharan Africa. It could be imagined that adaptation to this host factor is ongoing. Indeed, we have detected an HIV-1 strain carrying an HLA-B27 CTL-escape mutation in the Gag-p24 KK10 epitope, R264G, together with a compensatory mutation outside this epitope, E260D. Both mutations were stable over almost 5 years of evolution in both an HLA-B27-positive and an HLA-B27-negative patient. In addition, the two mutations were also stable in two novel HIV-1 transmission cases found amongst Amsterdam men who have sex with men (MSM), dating from 2005 and 2008, respectively.

Back to Top | Article Outline

Patients and methods

Patients

Patients M28495 and M34217, participants in the Amsterdam Cohort Studies on HIV-AIDS (www.amsterdamcohortstudies.org), tested HIV-1 antibody positive in early 2003. Follow-up blood plasma and peripheral blood mononuclear cell (PBMC) samples were available from 2003 to 2007. Subsequent database analysis of pol genotyping sequences identified two additional patients, M31702 and M35843, infected with the above-described HIV-1 strain. HLA typing was done at Sanquin Diagnostiek (Amsterdam, The Netherlands). Patient characteristics are summarized in Table 1.

Table 1
Table 1
Image Tools
Back to Top | Article Outline
Amplification and sequencing of viral RNA

HIV-1 protease/reverse transcriptase gene sequences were generated with the ViroSeq HIV-1 genotyping kit version 2 (Celera Diagnostics, Alameda, California, USA).

Viral RNA was isolated from plasma with a method using silica and GuSCN [12]. A fragment from the HIV-1 gag (nt 835–1386 of the HXB2 reference sequence) gene was amplified as described [13]. Additional analysis of this gene was done with a second primer set, outer primers 5′GCAGAATGGGATAGATTACATCCAGT3′ and 5′TGGGTTCGCATTTTGGACCATCAT3′ and nested primers 5′ACCAAGGGGAAGTGACATAGCAGGA3′ and 5′AGTTTTATAGAACCGGTCTACATA3′.

The env V3–V4 fragment (nt 6949–7519 of HXB2) was amplified with primers ED12 and ED31 [14]. Nested primer sequences were 5′ACAGGGCCATGYAMAAATGT3′ and 5′ATGGGAGGGGCATACATTGC3′. Amplification products were cloned with the TOPO TA cloning kit (Invitrogen, Carlsbad, California, USA), and sequenced with the BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, California, USA). Sixteen clones were analysed per sample. Electrophoresis and data collection were performed on an ABI PRISM 3100 genetic analyser (Applied Biosystems).

Back to Top | Article Outline
Chemokine (C–C motif) receptor 5 haplotype analysis

A fragment of the chemokine (C–C motif) receptor 5 (CCR5) gene was amplified from PBMC DNA to investigate the presence of the CCR5-Δ32 deletion as described [15].

Back to Top | Article Outline

Results

Characterization of the HIV-1 strain from patients M34217 and M28495

Two patients participating in the Amsterdam Cohort Studies on HIV-AIDS were found HIV-1 antibody positive at the beginning of 2003. Patient M34217, a homosexual man, tested HIV-1 negative in September 2002, and HIV-1 positive in March 2003. By that time, he had a fully developed western blot (Fiebig stage VI [16]). Patient M28495, a drug user occasionally involved in sex work, tested HIV-1 negative in September 2002, and was found to be HIV-1 positive in January 2003. At that time, his western blot pattern was almost complete (Fiebig stage V [16]).

Genotyping showed that the virus strain infecting these patients was 100% identical at the nucleotide level in the pol gene; this was also the case for gag and env gene fragments. Analysis of the mitochondrial DNA HVR-I region (nt positions 16 046–16 479) confirmed that the samples indeed belonged to individuals harbouring divergent mitochondrial lineages that differed by 7 nt substitutions (not shown) so that sample mix-up could be excluded. Possibly, one patient infected the other during his acute HIV-1 infection or both patients were almost simultaneously infected by a third individual.

Closer inspection of the HIV-1 gag gene sequences amplified from these patients revealed that this particular HIV-1 strain is a CTL-escape mutant in the gag-p24 KRWIILGLNK263–272 or KK10 epitope targeted by HLA-B27 [17]. Both virus isolates had an R264G mutation in this epitope combined with a compensatory mutation E260D (Table 1) that markedly increases the strongly reduced replication capacity of the R264G variant in vitro [18]. The R264G mutation can be acquired by a relatively simple A to G transition, but the E260D mutation requires a transversion from A to C. A third mutation found to be associated with R264G, namely Q136R [19], was also present in all clones. Therefore, we named this HLA-B27 CTL-escape strain the Q136RE260DR264G or, in short, the RDG strain of HIV-1.

As patient M28495 carried the HLA-B27 allele, it is possible that this particular HIV-1 strain was generated de novo and subsequently transmitted. HLA-B27-escape mutations are normally found only in the later stages of infection [18,20,21], although CTL responses to the gag-p24 KK10 epitope can be detected at a very early stage [22,23]. Reanalysis of the first available sample from patient M28495 with a different primer set to circumvent eventual primer bias did not also reveal any wild-type sequences that could have pointed towards the CTL-escape strain being a de-novo variant. Also, in patient M34217, no heterogeneity was found in the sequence of the epitope.

Back to Top | Article Outline
Spread of the Q136RE260DR264G-escape strain in Amsterdam, The Netherlands

A database of current Dutch HIV-1 pol genotyping sequences is accessible from our Laboratory of Clinical Virology, encompassing sequences from patients failing antiretroviral therapy as well as from every newly diagnosed HIV-1-infected patient. Phylogenetic trees incorporating genotyping sequences retrieved two sequences clustering with a high bootstrap value (100) with those from patients M28495 and M34217 (Fig. 1 [24,25]). The patients from whom these sequences were derived were MSM from Amsterdam, The Netherlands. Patient M31702 presented with an acute HIV-1 infection in September 2005. He had tested HIV antibody negative a year earlier. Patient M35843 tested HIV-1 positive in June 2008 while having been HIV antibody negative 9 months earlier. Subsequent sequencing of HIV-1 gag revealed that the CTL-escape mutations near and in the KK10 epitope were still present in these patients (Table 1). No changes occurred after 1-year follow-up of patient M31702. In the gag clones from patient M35843, a G264→R mutation was seen in a single clone, without a reversal of the compensatory mutation at position 260. So, the RDG-escape strain of HIV-1 is both stable and circulating in The Netherlands.

Fig. 1
Fig. 1
Image Tools
Back to Top | Article Outline
Fitness of the Q136RE260DR264G-escape strain

Patient M28495 showed a much better control of his HIV-1 infection than patient M34217. At their first HIV-1-positive moment, the plasma viral load in both patients was around 14 000 copies/ml; mainly increasing thereafter in patient M34217, whereas strongly decreasing in patient M28495 (not shown). CD4+ T-cell counts showed an opposite pattern; being consistently high (>740 cells/μl) in patient M28495 and being low (<480 cells/μl) in patient M34217. Patient M28495 was found to carry a CCR5 Δ32aa-deletion allele associated with an attenuated disease course [26].

Back to Top | Article Outline
Evolution of the gag-p24 KK10 epitope of the Q136RE260DR264G-escape strain of HIV-1

Serial plasma and PBMC samples were available from patient M34217 (2003–2006, eight time-points) and for patient M28495 (2003–2007, seven time-points). HIV-1 gag fragments were amplified from blood plasma and analysed. No reversal of the KK10 CTL-escape or compensatory mutation was seen in any clone over the years (Table 1).

Back to Top | Article Outline

Discussion

We have identified, amongst Dutch HIV-1-infected patients, an HIV-1 strain that is adapted to escape CTL recognition by HLA-B27 of a conserved epitope in the gag-p24 protein. The HIV-1 RDG-escape strain contains at least one, E260D, and possibly a second, Q136R, compensatory mutation that restores the replicative defect produced by the R264G mutation in gag-p24. The Q136R has not been definitely proven to be a compensatory mutation to R264G, but was strongly associated with it in a database analysis [19], and was consistently present in HIV-1 sequences from our patients. Although in-vitro experiments suggest that viruses with E260D and R264G mutations in gag-p24 still do not replicate as well as wild-type HIV-1, the subtype B RDG-escape strain is stable and circulating in Amsterdam, The Netherlands amongst the high-risk group of MSM. Spread of this virus strain is recent, the first infection was detected in 2003 and the last in 2008. The RDG strain can infect heterozygous CCR5+/Δ32 individuals, who generally have a lower CCR5 cell surface density [27] and a lower number of cells expressing CCR5 [28] than CCR5+/+ individuals, suggesting that it is not less fit than other strains. In a patient carrying wild-type CCR5 alleles, the disease course is typical and not attenuated, again suggesting that the virus strain has no in-vivo fitness defect.

Detection of an HLA-B27-escape strain of HIV-1 that is both stable and circulating shows that HIV-1 is in the process of adapting to HLA-B27 alleles. It also shows that HIV-1 can circumvent the severe replication defects associated with mutations in its most conserved protein-coding regions. Reversal of these mutations is probably rare as associated compensatory mutations are needed and a significant fitness loss accompanies single position changes. Indeed, no reversal of E260D and R264G was seen over time in both an HLA-B27-positive individual and two HLA-B27-negative individuals and only a single clone out of eight from the first sample of a fourth patient showed a reversal at position 264. The adaptation of HIV-1 to HLA-B27 is also evident from another, a recent study [29] on transmitted mutations in the gag-p24 KK10 epitope in 211 HLA-B27-negative individuals with acute/early HIV-1 subtype B infection in North America, Europe and Australia. In 23 (11%) of these patients, a R264 mutation was found, in most cases with compensatory mutations outside the epitope. Two of the patients displayed the R264G mutation in combination with E260D; the other 21 individuals had the more common R264K mutation, mostly together with compensatory mutation S173A and with L268M. The two patients with the E260DR264G mutations were from Berlin, Germany. Berlin is only 600 km from Amsterdam, suggesting there could be an epidemiological link. So, it is not unlikely that in the near future protection from disease progression by HLA-B27 in HIV-1-infected individuals will be lost.

Back to Top | Article Outline

Acknowledgements

The Amsterdam Cohort Studies on HIV infection and AIDS, a collaboration between the Amsterdam Health Service, the Academic Medical Center of the University of Amsterdam, Sanquin Blood Supply Foundation and the University Medical Center Utrecht, are part of the Netherlands HIV Monitoring Foundation and financially supported by the Netherlands National Institute for Public Health and the Environment. The authors thank Debbie van Baarle for arranging the HLA typing of the first two patients.

M.C. and A.C.vdK. designed the experiments and the study. S.J. and N.K.T.B. performed the pol genotyping, HIV serology and viral load assays, and identified the first two patients together with M.P. M.B. kept the genotyping database and identified the next two patients. K.B. was the treating physician and collected the clinical data. F.M.H. and F.Z. performed the PCR amplifications, cloning and sequencing. A.C.vdK. analysed the data and drafted the paper.

Back to Top | Article Outline

References

1. Allen TM, Altfeld M, Geer SC, Kalife ET, Moore C, O'sullivan KM, et al. Selective escape from CD8+ T-cell responses represents a major driving force of human immunodeficiency virus type 1 (HIV-1) sequence diversity and reveals constraints on HIV-1 evolution. J Virol 2005; 79:13239–13249.

2. Carlson JM, Brumme ZL. HIV evolution in response to HLA-restricted CTL selection pressures: a population-based perspective. Microbes Infect 2008; 10:455–461.

3. Friedrich TC, Dodds EJ, Yant LJ, Vojnov L, Rudersdorf R, Cullen C, et al. Reversion of CTL escape-variant immunodeficiency viruses in vivo. Nat Med 2004; 10:275–281.

4. Leslie AJ, Pfafferott KJ, Chetty P, Draenert R, Addo MM, Feeney M, et al. HIV evolution: CTL escape mutation and reversion after transmission. Nat Med 2004; 10:282–289.

5. Kiepiela P, Leslie AJ, Honeyborne I, Ramduth D, Thobakgale C, Chetty S, et al. Dominant influence of HLA-B in mediating the potential co-evolution of HIV and HLA. Nature 2004; 432:769–775.

6. Moore CB, John M, James IR, Christiansen FT, Witt CS, Mallal SA. Evidence of HIV-1 adaptation to HLA-restricted immune responses at a population level. Science 2002; 296:1439–1443.

7. Parham P, Lawlor DA, Lomen CE, Ennis PD. Diversity and diversification of HLA-A,B,C alleles. J Immunol 1989; 142:3937–3950.

8. Hendel H, Caillat-Zucman S, Lebuanec H, Carrington M, O'Brien S, Andrieu JM, et al. New class I and II HLA alleles strongly associated with opposite patterns of progression to AIDS. J Immunol 1999; 162:6942–6946.

9. Carrington M, O'Brien SJ. The influence of HLA genotype on AIDS. Annu Rev Med 2003; 54:535–551.

10. Prummel MF, ten Berge RJ, Barrowclough H, Cejka V. Kaposi's sarcoma and fatal opportunistic infections in a homosexual man with immunodeficiency. Ned Tijdschr Geneeskd 1983; 127:820–824.

11. Coutinho RA, Krone WJ, Smit L, Albrecht-van Lent P, van der NJ, Schaesberg W, et al. Introduction of lymphadenopathy associated virus or human T lymphotropic virus (LAV/HTLV-III) into the male homosexual community in Amsterdam. Genitourin Med 1986; 62:38–43.

12. Boom R, Sol CJ, Salimans MM, Jansen CL, Wertheim-van Dillen PM, van der Noordaa J. Rapid and simple method for purification of nucleic acids. J Clin Microbiol 1990; 28:495–503.

13. Cornelissen M, Kampinga G, Zorgdrager F, Goudsmit J. Human immunodeficiency virus type 1 subtypes defined by env show high frequency of recombinant gag genes. The UNAIDS Network for HIV Isolation and Characterization. J Virol 1996; 70:8209–8212.

14. Delwart EL, Herring B, Rodrigo AG, Mullins JI. Genetic subtyping of human immunodeficiency virus using a heteroduplex mobility assay. PCR Methods Appl 1995; 4:S202–S216.

15. Roda Husman AM, Koot M, Cornelissen M, Keet IP, Brouwer M, Broersen SM, et al. Association between CCR5 genotype and the clinical course of HIV-1 infection. Ann Intern Med 1997; 127:882–890.

16. Fiebig EW, Wright DJ, Rawal BD, Garrett PE, Schumacher RT, Peddada L, et al. Dynamics of HIV viremia and antibody seroconversion in plasma donors: implications for diagnosis and staging of primary HIV infection. AIDS 2003; 17:1871–1879.

17. Nietfield W, Bauer M, Fevrier M, Maier R, Holzwarth B, Frank R, et al. Sequence constraints and recognition by CTL of an HLA-B27-restricted HIV-1 gag epitope. J Immunol 1995; 154:2189–2197.

18. Schneidewind A, Brockman MA, Sidney J, Wang YE, Chen H, Suscovich TJ, et al. Structural and functional constraints limit options for cytotoxic T-lymphocyte escape in the immunodominant HLA-B27-restricted epitope in human immunodeficiency virus type 1 capsid. J Virol 2008; 82:5594–5605.

19. Carlson JM, Brumme ZL, Rousseau CM, Brumme CJ, Matthews P, Kadie C, et al. Phylogenetic dependency networks: inferring patterns of CTL escape and codon covariation in HIV-1 Gag. PLoS Comput Biol 2008; 4:e1000225.

20. Goulder PJ, Brander C, Tang Y, Tremblay C, Colbert RA, Addo MM, et al. Evolution and transmission of stable CTL escape mutations in HIV infection. Nature 2001; 412:334–338.

21. Brumme ZL, Brumme CJ, Carlson J, Streeck H, John M, Eichbaum Q, et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. J Virol 2008; 82:9216–9227.

22. Wilson JD, Ogg GS, Allen RL, Davis C, Shaunak S, Downie J, et al. Direct visualization of HIV-1-specific cytotoxic T lymphocytes during primary infection. AIDS 2000; 14:225–233.

23. Betts MR, Exley B, Price DA, Bansal A, Camacho ZT, Teaberry V, et al. Characterization of functional and phenotypic changes in anti-Gag vaccine-induced T cell responses and their role in protection after HIV-1 infection. Proc Natl Acad Sci U S A 2005; 102:4512–4517.

24. Tamura K, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 1993; 10:512–526.

25. Leitner T, Kumar S, Albert J. Tempo and mode of nucleotide substitutions in gag and env gene fragments in human immunodeficiency virus type 1 populations with a known transmission history. J Virol 1997; 71:4761–4770.

26. Michael NL, Chang G, Louie LG, Mascola JR, Dondero D, Birx DL, et al. The role of viral phenotype and CCR-5 gene defects in HIV-1 transmission and disease progression. Nat Med 1997; 3:338–340.

27. Reynes J, Portales P, Segondy M, Baillat V, Andre P, Reant B, et al. CD4+ T cell surface CCR5 density as a determining factor of virus load in persons infected with human immunodeficiency virus type 1. J Infect Dis 2000; 181:927–932.

28. Roda Husman AM, Blaak H, Brouwer M, Schuitemaker H. CC chemokine receptor 5 cell-surface expression in relation to CC chemokine receptor 5 genotype and the clinical course of HIV-1 infection. J Immunol 1999; 163:4597–4603.

29. Schneidewind A, Brumme ZL, Brumme CJ, Power KA, Reyor LL, O'Sullivan K, et al. Transmission and long-term stability of compensated CD8 escape mutations. J Virol 2009; 83:3993–3997.

Cited By:

This article has been cited 2 time(s).

Tissue Antigens
Genetic determinants of HIV-1 infection and progression to AIDS: immune response genes
Kaur, G; Mehra, N
Tissue Antigens, 74(5): 373-385.
10.1111/j.1399-0039.2009.01337.x
CrossRef
Journal of Virology
Significant Reductions in Gag-Protease-Mediated HIV-1 Replication Capacity during the Course of the Epidemic in Japan
Nomura, S; Hosoya, N; Brumme, ZL; Brockman, MA; Kikuchi, T; Koga, M; Nakamura, H; Koibuchi, T; Fujii, T; Carlson, JM; Heckerman, D; Kawana-Tachikawa, A; Iwamoto, A; Miura, T
Journal of Virology, 87(3): 1465-1476.
10.1128/JVI.02122-12
CrossRef
Back to Top | Article Outline
Keywords:

chemokine (C–C motif) receptor 5; drug user; HIV-1; human leucocyte antigen-B27; men who have sex with men

© 2009 Lippincott Williams & Wilkins, Inc.

Login

Search for Similar Articles
You may search for similar articles that contain these same keywords or you may modify the keyword list to augment your search.